Previous Article | Next Article 
Infection and Immunity, July 2001, p. 4329-4336, Vol. 69, No. 7
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.7.4329-4336.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Antigenic Diversity among Helicobacter pylori
Vacuolating Toxins
Arlene D.
Vinion-Dubiel,1
Mark S.
McClain,2
Ping
Cao,2
Raymond L.
Mernaugh,3 and
Timothy
L.
Cover1,2,4,*
Departments of
Medicine,2 Microbiology and
Immunology,1 and Biochemistry and the
Vanderbilt-Ingram Cancer Center,3 Vanderbilt
University School of Medicine, Nashville, Tennessee 37232, and
Veterans Affairs Medical Center, Nashville, Tennessee
372124
Received 8 January 2001/Returned for modification 28 March
2001/Accepted 23 April 2001
 |
ABSTRACT |
Helicobacter pylori vacuolating cytotoxin (VacA) is a
secreted protein that induces vacuolation of epithelial cells. To study VacA structure and function, we immunized mice with purified type s1-m1
VacA from H. pylori strain 60190 and generated a panel of 10 immunoglobulin G1
anti-VacA monoclonal antibodies. All of the
antibodies reacted with purified native VacA but not with denatured
VacA, suggesting that these antibodies react with conformational epitopes. Seven of the antibodies reacted with both native and acid-treated VacA, which suggests that epitopes present on both oligomeric and monomeric forms of the toxin were recognized. Two monoclonal antibodies, both reactive with epitopes formed by amino acids in the carboxy-terminal portion of VacA (amino acids 685 to 821),
neutralized the cytotoxic activity of type s1-m1 VacA when toxin and
antibody were mixed prior to cell contact but failed to neutralize the
cytotoxic activity of type s1-m2 VacA. Only 3 of the 10 antibodies
consistently recognized type s1-m1 VacA toxins from multiple H. pylori strains, and none of the antibodies recognized type s2-m2
VacA toxins. These results indicate that there is considerable
antigenic diversity among VacA toxins produced by different H. pylori strains.
 |
INTRODUCTION |
Helicobacter pylori is a
gram-negative bacterium that colonizes the mucosal layer of the human
stomach and induces chronic superficial gastritis (10,
20). Colonization with this bacterium is a risk factor for the
development of peptic ulcer disease and gastric cancer
(20). One virulence factor produced by H. pylori is a secreted protein toxin (VacA) that induces the
formation of large cytoplasmic vacuoles in epithelial cells (9,
40). At neutral pH, VacA assembles into large, water-soluble
oligomeric complexes composed predominantly of 12 or 14 identical
monomers (14, 32). When exposed to acidic or alkaline pH,
these oligomeric complexes disassemble into component monomers
(14, 38, 58). Acid-activated VacA can insert into lipid
bilayers and the plasma membrane of eukaryotic cells to form
anion-selective membrane channels (17, 29, 38, 51, 52).
The mature secreted VacA toxin has a molecular mass of 88 kDa and
consists of about 821 amino acids (11, 41). In HeLa cells
transiently transfected with vacA-containing plasmids,
expression of the amino-terminal 422 amino acids of VacA is sufficient
to induce vacuole formation (18, 59). Rabbit antiserum
generated against a recombinant peptide containing amino acids 476 to
803 of VacA inhibits the binding of VacA to cells and neutralizes toxin
activity (23). When taken together, these data suggest that a carboxy-terminal VacA domain mediates binding of the toxin to
cells and an amino-terminal domain mediates the intracellular activity
of VacA.
H. pylori strains isolated from different human stomachs are
genetically very heterogeneous (2, 3, 36). For essentially any gene selected for analysis, the sequences from different strains exhibit 95 to 98% nucleotide identity (1, 4, 22, 31). Suerbaum et al. analyzed a 450-nucleotide segment of vacA
(nucleotides 802 to 1245; GenBank accession no. Z26883) in 69 H. pylori strains isolated from two different geographic locations
and found that very few sequences were identical (50).
Within this region of vacA, 25.4% of the nucleotide
positions were polymorphic among the different strains, but almost all
of these polymorphisms represented synonymous substitutions. Another
study of 153 isolates by Göttke et al. revealed similar levels of
sequence diversity in this region of vacA (25).
Both studies concluded that genetic recombination has occurred more
frequently in H. pylori than in most other bacteria analyzed
thus far.
Certain regions in vacA exhibit greater sequence diversity
than the segments analyzed by Suerbaum et al. (50)
and Göttke et al. (25). Within a 0.7-kb region
of vacA known as the midregion, the sequences of
vacA alleles from different H. pylori strains can
exhibit <70% nucleotide identity (5, 7, 42, 49). Diversity is also prominent in the 5' portion of vacA that
encodes the amino-terminal signal sequence and the amino terminus of
the mature toxin (5, 7, 54, 55). Based on analysis of
vacA alleles from large numbers of H. pylori
strains, two families of midregions (m1 and m2) and two families of
signal sequence regions (s1 and s2) are currently recognized
(5-7, 53, 55).
Classification of vacA alleles into families (s1, s2, m1,
and m2) has proven useful as a method for predicting levels of
cytotoxin activity in vitro. Broth culture supernatants from H. pylori strains containing type s1-m1 vacA alleles
typically exhibit a high level of cytotoxic activity for multiple cell
types, whereas supernatants from strains containing type s2-m2
vacA alleles lack cytotoxic activity (5, 21).
Some type s1-m2 vacA toxins exhibit cytotoxic activity
toward selected cell types, including RK-13 and Vero, but relatively
little activity for HeLa cells (references 30 and 42 and
our unpublished data). The basis for these differences in cytotoxic
activity among H. pylori strains is probably multifactorial and may reflect differences in vacA transcription,
expression, or secretion (21) or may be directly related
to polymorphisms in VacA amino acid sequences (5).
Heterogeneity among vacA alleles may be an important
factor in understanding variations in clinical manifestations among
H. pylori-infected persons. Several studies have
demonstrated that gastric infection with H. pylori strains
containing type s1 vacA alleles is associated with a higher
risk for development of peptic ulcer disease than is infection with
strains containing type s2 vacA alleles (5, 24, 47,
53). This association seems to be less apparent in many Asian
countries than in Europe and the Americas (27, 43).
Thus far, nearly all studies of VacA diversity have been based on
analysis of vacA nucleotide sequences, rather than on
analysis of VacA proteins. In this study we sought to analyze VacA
structure, function, and diversity by using a panel of anti-VacA
monoclonal antibodies. We report here that VacA activity can be
neutralized by monoclonal antibodies reactive with the carboxy-terminal
portion of the toxin and demonstrate that VacA proteins from different H. pylori strains exhibit considerable antigenic diversity,
even within the same vacA family.
 |
MATERIALS AND METHODS |
Growth of H. pylori and purification of VacA.
H. pylori strains were grown routinely on Trypticase soy
agar plates containing 5% sheep blood in room air containing 5%
CO2 at 37°C. H. pylori broth culture
supernatants were prepared by growing the bacteria in sulfite-free
brucella broth containing either 5% fetal bovine serum (FBS) or 0.5%
charcoal for 48 h and removing the bacteria by centrifugation
(11). VacA was purified from broth culture supernatant of
H. pylori strain 60190 (ATCC 49503), as described previously
(14). Acid activation of purified VacA was accomplished by
dropwise addition of 250 mM HCl until the pH was reduced to 2.0 (14, 19).
Production and purification of monoclonal antibodies.
Female
BALB/c mice (6 to 8 weeks old) were injected intraperitoneally with 15 µg of purified VacA from H. pylori strain 60190 (ATCC
49503) in 0.5 ml of complete Freund's adjuvant. Mice were boosted 4 and 8 weeks after the initial immunization with VacA in
phosphate-buffered saline (PBS). Twelve weeks after the initial immunization, spleens were harvested from immunized mice, and the cells
were fused with SP2/0 cells. Hybridoma cells were selected by growth in
medium containing hypoxanthine-azaserine-thymidine and screened for
production of anti-VacA antibodies by enzyme-linked immunosorbent assay
(ELISA), as described below. Single clonal populations of
anti-VacA-producing hybridoma cells were isolated by the
limiting-dilution method. Ten different clonal populations of
anti-VacA-producing hybridoma cells were injected intraperitoneally into pristane-primed BALB/c mice in order to generate ascites fluid.
Antibodies in ascites fluid were isotyped by ELISA as described below,
using a panel of different secondary antibody-horseradish peroxidase
(HRP) conjugates (Southern Biotechnology Associates, Inc.). To purify
monoclonal antibodies from ascites fluid, 1.5% caprylic acid in 45 mM
sodium acetate (pH 4.8) was mixed with ascites fluid to precipitate
contaminating proteins, and anti-VacA IgG antibodies were then
precipitated from the supernatant with a 50% saturated solution of
ammonium sulfate (26). Antibody concentrations were
determined by measuring absorbance at 280 nm and confirmed by Micro BCA
assay (Pierce). Purified monoclonal antibodies (1 mg/ml) were stored at
20°C in 0.15 M NaCl and 50% glycerol.
Construction of H. pylori strains expressing mutant
VacA proteins.
A panel of H. pylori strains containing
in-frame deletion mutations in vacA has been described
previously (56). In addition, a panel of H. pylori strains expressing mutant VacA proteins in which various
clusters of amino acids were changed to alanine residues has been
constructed (M. S. McClain, P. Cao, D. Choate, and T. L. Cover, Abstr. 99th Gen. Meet. Am. Soc. Microbiol., abstr. D/B-192,
1999). To construct these strains, vacA-containing plasmids were mutated by using the method of Perrin and Gilliland
(45), and these plasmids were then transformed into
H. pylori strains containing sacB-kan
insertions in vacA (8, 56). The desired transformants, in which sacB-kan cassettes were
replaced by vacA sequences via a double-crossover event,
were selected by growth on Columbia blood agar plates containing 6%
sucrose (8, 56). H. pylori strain VM044
expressed a mutant VacA protein in which the underlined residues (63 to
69) of the mature toxin were changed to alanine
(KEYDLYK), and H. pylori strain VM074 expressed a mutant toxin in which the
underlined residues (420 to 428) of the mature VacA protein were
changed to alanine
(RVNNQVGGY)
(Fig. 1). Based on secondary
structure predictions (MacVector), the latter region is predicted to
form an amphipathic
sheet.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
H. pylori strains expressing mutant forms of
VacA used in this study. The dark boxes represent regions deleted in
the translated vacA product from H. pylori strain
60190 (56), striped boxes represent VacA sequences from
H. pylori strain 60190 replaced with corresponding sequences
from H. pylori Tx30a in VacA chimeras, and the X's
represent sites where selected amino acids were replaced with alanine.
The amino acid numbering system is based on designation of the
N-terminal alanine of the mature toxin from H. pylori strain
60190 as amino acid 1.
|
|
To construct chimeric
vacA genes containing portions of m1
vacA and portions of m2
vacA, vacA fragments from
H. pylori Tx30a
(ATCC 51932) (containing a type s2-m2
vacA allele) (
5) were
PCR amplified using the
following primer pairs, which were designed
to contain the indicated
restriction enzyme sites (underlined):
primer C7386
(5'
CCTCCCGAAGGCGGTTATGAG) (
EcoNI) and
primer C6908
(5'
GCTAGCGAAACGCGCGTTATTAG)
(
NheI), primer C7386 (
EcoNI) and primer
C6906 (5'
GACTATAGTCCATGCTTGCGTTG)
(
PshAI), primer C6904
(5'
GACTATAGTCAAGATTTGGATTTAACC)
(
PshAI) and primer C6908 (
NheI), and primer
C6905 (5'
AGATCTCACTAAAAATAAAGAACATG)
(
BglII) and primer C6908 (
NheI). The
resulting PCR products encode
amino acids 337 to 876, 337 to 674, 671 to 876, and 735 to 876,
respectively, of the VacA protoxin from Tx30a
(
5). The PCR
products were subcloned into pGEM-T Easy
(Promega). Following
digestion with the restriction enzymes listed
above, the
vacA fragments were cloned into pCTB6, containing
a
vacA fragment from
H. pylori strain 60190 (
16), using the same sites. The resulting
plasmids were
termed pMM446, pMM443, pMM439, and pMM441, respectively.
The chimeric
sequences were introduced into
H. pylori strain VM002
or
VM018, containing
sacB-
km cassettes in the
vacA gene of
H. pylori 60190, using allelic
exchange as described previously (
56).
The resulting
H. pylori strains contained type s1
vacA alleles
with portions of the m1 regions replaced by m2
vacA
sequences
and were designated as follows: G117 contains amino acids 671
to 876 from Tx30a, G118 contains amino acids 337 to 674 from Tx30a,
G119 contains amino acids 337 to 876 from Tx30a, and G120 contains
amino acids 735 to 876 from Tx30a (Fig.
1).
ELISAs.
Purified VacA or various VacA-containing
preparations were diluted in PBS and adsorbed to microtiter wells in
96-well ELISA plates (Dynex) by incubation at 4°C for 18 h.
Purified oligomeric VacA from H. pylori strain 60190 was
adsorbed to wells at a final concentration of 2 µg/ml, and in
experiments using unconcentrated H. pylori broth culture
supernatants as antigens, undiluted supernatants were adsorbed directly
to microtiter plates. Nonspecific protein binding sites were blocked by
incubating plates with PBS (pH 7) containing 0.05% (vol/vol) Tween 20 (PBS-Tween) at room temperature for 5 min. Purified anti-VacA
monoclonal antibodies, standardized by protein concentration, were
diluted in PBS, added to the wells, and incubated for 1 h at room
temperature. After being washed with PBS-Tween, bound monoclonal
antibodies were detected with goat anti-mouse immunoglobulin G1 (IgG1)
conjugated to HRP (Southern Biotechnology Associates, Inc.). Hydrogen
peroxide (Sigma) and 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic
acid) (ABTS) (Sigma) were added, and color development was quantified
at 410 nm with an MRX microplate reader (Dynatech).
Several variations in ELISA methodology were also utilized. (i) To
screen hybridoma cells for production of anti-VacA antibodies,
purified
VacA was adsorbed to an ELISA plate as described above.
Aliquots of
undiluted growth media from hybridoma cells were then
added to the
wells for 1 h, followed by goat anti-mouse Ig antibodies
conjugated to HRP (Boehringer Mannheim). (ii) To analyze the reactivity
of the monoclonal antibodies to acidified VacA, purified VacA
from
H. pylori strain 60190 was acid activated by the addition
of
250 mM HCl to pH 2, diluted to 2 µg/ml in 5% glacial acetic
acid,
and adsorbed to the microtiter plates, and the liquid was
allowed to
evaporate. Subsequent steps were performed as described
in the previous
paragraph. (iii) The ELISA reactivity of antibodies
with denatured VacA
was examined by two different approaches.
As a first approach, purified
VacA from
H. pylori strain 60190
(final concentration, 2 µg/ml) was boiled in 6 M urea for 15 min
and added to microtiter
plates, and the liquid was allowed to
evaporate. As a second approach,
purified VacA (final concentration,
2 µg/ml) was heated at 95°C for
5 min in 1.5% Tris (pH 8.5) containing
2% sodium dodecyl sulfate and
10% glycerol, added to microtiter
plates, and incubated at 4°C for
18 h. All subsequent steps were
performed as described above. (iv)
In the antigen capture ELISA,
goat anti-mouse IgG (Southern
Biotechnology Associates, Inc.)
(5 µg/ml in PBS) was first adsorbed
to a microtiter plate. Then,
anti-VacA monoclonal antibodies (10 µg/ml), purified VacA (1 µg/ml),
anti-VacA rabbit sera (958), and
goat anti-rabbit Ig conjugated
to HRP (Boehringer Mannheim) (5 µg/ml)
were sequentially added
to the ELISA plate and incubated for 1 h
each. Plates were washed
with PBS-Tween between each
component.
Immunoprecipitations of VacA-anti-VacA monoclonal antibody
complexes.
Purified VacA was diluted in PBS-Tween containing 2%
(wt/vol) ammonium sulfate (pH 7), to yield a final concentration of 0.5 µg/ml. Anti-VacA monoclonal antibody (1 µg) was added to 1 ml of
the VacA preparation and incubated at 4°C for 1 h. Protein G-Sepharose beads (Zymed) (25 µl), washed twice with PBS-Tween, were
then added to the toxin-antibody mixtures and incubated for an
additional hour at 4°C. Beads were then washed three times in
PBS-Tween containing 2% ammonium sulfate. Immunoprecipitated proteins
were separated from the beads by being boiled in sodium dodecyl
sulfate-polyacrylamide gel electrophoresis sample buffer and analyzed
by immunoblot analysis with rabbit anti-VacA serum, as described
previously (11).
Toxin neutralizing activity of monoclonal antibodies.
Purified VacA was acid activated (14, 19) and
reneutralized by diluting the acid-activated VacA in Dulbecco's
modified Eagle's medium (DMEM) containing 10% FBS and 10 mM ammonium
chloride to yield a final VacA concentration of 6 µg/ml.
Alternatively, proteins in H. pylori broth culture
supernatants from cultures grown in sulfite-free brucella broth
containing 5% FBS were precipitated with a 50% saturated ammonium
sulfate solution and diluted in DMEM containing 10% FBS. Purified
monoclonal antibodies (standardized by protein concentration) were
added to the toxin preparations and incubated at 37°C for 1 h
prior to addition to HeLa or RK-13 cells. To test the capacity of
antibodies to neutralize VacA that was already bound to cells,
acid-activated VacA (final concentration, 18 µg/ml) was incubated
with HeLa cells for 4 h at 4°C, cells were washed with DMEM
containing 10% FBS, and then monoclonal antibodies (10 µg/ml) were
added to tissue culture medium overlying the cells. The medium
overlying cells was routinely supplemented with 10 mM ammonium chloride
for these assays (11). Following incubation at 37°C and
5% CO2 for 18 h, vacuolation was quantified by a
neutral red uptake assay, as described previously (15).
 |
RESULTS |
Production of anti-VacA monoclonal antibodies.
BALB/c mice
were immunized with purified, oligomeric VacA from H. pylori
strain 60190 as described in Materials and Methods. Thirteen hybridoma
cell lines that secreted anti-VacA antibodies were isolated and
characterized. A total of 10 antibodies were of the IgG1 isotype with a
light chain, and 3 were of the IgM isotype. Compared with the IgG
antibodies, the three IgM antibodies reacted weakly with VacA and
therefore were not studied further. Ascites fluid was generated from
each of the 10 IgG-producing hybridomas, and monoclonal antibodies were
purified as described in Materials and Methods. Each of the 10 IgG1
antibodies reacted significantly more strongly in an ELISA with broth
culture supernatant from wild-type H. pylori strain 60190 than with broth culture supernatant from H. pylori strain
60190v-1, an isogenic vacA-null mutant strain
(16) (Fig. 2), which
indicated that the antibodies reacted specifically to VacA. None of the
antibodies recognized denatured VacA in Western blot assays, nor did
they react with two different preparations of denatured VacA in ELISAs
(data not shown). These results suggest that the 10 IgG monoclonal
antibodies all recognized conformational epitopes of VacA.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Specificity of monoclonal antibodies for VacA. H. pylori strain 60190 (wild type) and strain 60190 v-1 (an isogenic
vacA-null mutant) (16) were grown in
sulfite-free brucella broth containing 5% FBS. ELISA wells were coated
with unconcentrated broth culture supernatants that were standardized
by protein concentration. Reactivity of the purified monoclonal
antibodies (standardized by protein concentration) to the broth culture
supernatants was determined by an ELISA. Values represent the
means ± standard deviation from triplicate determinations.
|
|
As an initial approach to characterize the panel of monoclonal
antibodies, we first compared the reactivity of the purified
antibodies
(standardized by protein concentration) to VacA in
three different
types of ELISAs: (i) purified VacA from
H. pylori strain
60190 adsorbed directly to ELISA plates in an oligomeric
form (at pH
7), (ii) acidified VacA adsorbed to ELISA plates (at
pH 2), and (iii)
oligomeric VacA in an antigen capture ELISA (Table
1). Seven of the antibodies reacted
strongly with VacA in all
three ELISAs. The titers of reactivity for
four of these antibodies
(5G5, B13O, 4E, and B3D) were slightly higher
in ELISAs using
native (oligomeric) VacA than in ELISAs using
acid-treated VacA.
In contrast, antibodies 13B, B13B, and C10F reacted
weakly with
oligomeric VacA in the pH 7 ELISA but had no detectable
reactivity
with either acid-treated (monomeric) VacA or VacA in an
antigen
capture ELISA. All of the antibodies with the exception of the
latter three (13B, B13B, and C10F) were able to immunoprecipitate
VacA
(data not shown). Thus, at least two different classes of
monoclonal
antibodies could be distinguished based on their reactivity
to
different forms of VacA.
Neutralization of VacA cytotoxic activity by monoclonal
antibodies.
Rabbits immunized with VacA produce serum anti-VacA
antibodies with toxin-neutralizing activity (11, 23, 33),
and toxin-neutralizing antibodies are also present in serum from some
H. pylori-infected humans (13). To determine if
any of the monoclonal antibodies could neutralize VacA activity, each
antibody was mixed with VacA from H. pylori strain 60190, and the toxin-antibody mixtures were then added to HeLa cells (Fig.
3). Only antibodies 9F2 and 5E4 exhibited
detectable toxin-neutralizing activity under these conditions. In
contrast, when toxin was first bound to HeLa cells at 4°C, a
procedure that prevents toxin internalization (23, 37,
56), and the cells were then incubated with antibodies 9F2 or
5E4, no neutralization of toxin activity was detectable (data not
shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Neutralization of VacA activity by monoclonal
antibodies. Monoclonal antibodies were mixed with acid-activated,
purified VacA from H. pylori strain 60190 that was diluted
and adjusted to neutral pH by the addition of DMEM containing 10% FBS
and incubated for 1 h at 37°C before being added to HeLa cells. Final
concentrations of monoclonal antibodies and VacA were 10 and 6 µg/ml,
respectively. After incubation for 18 h at 37°C, the extent of
vacuolation was determined by a neutral red uptake assay
(15). Values represent the means ± standard
deviation of triplicate determinations. No Ab, no antibody.
|
|
Mapping monoclonal antibody epitopes.
To map the regions of
VacA to which the monoclonal antibodies bound, we first examined the
reactivity of the antibodies with a panel of VacA mutant proteins
containing internal deletions (Fig. 1). Antibodies 9F2 and 5E4 reacted
to all of the mutant proteins tested. Five antibodies reacted strongly
to all but one mutant protein (Table 2);
antibodies 1B6, B13O, 4E, and B3D did not react with VacA
517-536
and antibody 5G5 did not recognize VacA
114-294, which suggests that
the relevant epitopes for these antibodies may be located in these
regions. Antibodies 13B, B13B, and C10F reacted with VacA
6-27 and
VacA
517-536 but not with the other five VacA deletion mutants (all
of which contained deletions in the region comprising amino acids 28 to
294). Notably, a previous study demonstrated that the latter five
mutant toxins (i.e., those not recognized by antibodies 13B, B13B, or
C10F) were unable to form oligomers similar to wild-type toxin
(56).
To further define the epitopes to which the antibodies bound, we
analyzed the reactivity of the antibodies with a panel of
12 mutant
VacA proteins in which various clusters of amino acids
throughout the
toxin were changed to alanine residues. All of
the monoclonal
antibodies reacted with all of the VacA alanine
substitution mutants
tested (data not shown), with two exceptions.
Antibodies 5G5, 1B6,
B13O, 4E, and B3D did not react with VacA
from
H. pylori
strain VM074, in which five residues between amino
acids 420 and 428 were changed to alanine, as described in Materials
and Methods (data
not shown). Antibodies 13B, B13B, and C10F did
not react with VacA from
strain VM044, in which polar or charged
residues between amino acids 63 and 69 were changed to alanine,
as described in Materials and Methods
(data not shown). Thus,
it appears that the relevant epitopes for these
antibodies are
localized in these two regions. Overall, these results
are consistent
with the patterns of reactivity described above with the
VacA
deletion mutations (Table
2). Any apparent discrepancies in
localization
of reactive epitopes are probably attributable to the
reactivity
of the antibodies with conformational
epitopes.
Antigenic diversity of VacA.
Nucleotide sequence analyses of
vacA alleles from different H. pylori strains
have revealed considerable genetic diversity (5, 16, 28, 42,
53). To experimentally determine whether there is antigenic
diversity among VacA proteins, we analyzed the reactivity of the
anti-VacA monoclonal antibodies with VacA proteins from a panel of 12 H. pylori strains, which were each isolated from different
human stomachs (Table 3) (5,
21). To verify that VacA was present in the culture supernatants
of each of these strains, the supernatants were tested for reactivity in an ELISA with pooled polyclonal antisera from rabbits immunized with
purified VacA from H. pylori strains 60190 (s1-m1), 95-54 (s1-m2), and 86-338 (s2-m2) (Table 3). The pooled polyclonal antisera
yielded a positive signal with each of the 12 wild-type strains tested
but not with supernatant from strain 60190-v1, a vacA-null
mutant strain (Table 3) (16). All 10 of the monoclonal antibodies recognized type s1-m1 VacA proteins from strains 60190, 87-81, 92-29, and 87-29 (Table 3). However, only 3 of the 10 antibodies
(9F2, 5E4, and 5G5) recognized s1-m1 VacA toxins from all six of the
s1-m1 strains tested. None of the monoclonal antibodies recognized type
s2-m2 VacA proteins, and only four antibodies (5G5, 13B, B13B, and
C10F) reacted with any of the s1-m2 proteins. In accordance with these
results, the two antibodies (9F2 and 5E4) with neutralizing activity
for s1-m1 toxins lacked any detectable neutralizing activity for an
s1-m2 toxin from H. pylori strain 95-54 (data not shown).
These results imply that there is considerable antigenic diversity in
VacA proteins, even within the same vacA family.
Epitope mapping using chimeric VacA proteins.
As noted above,
none of the antibodies reacted with the type s2-m2 VacA from H. pylori strain Tx30a (Table 3). Therefore, in an effort to further
map the regions to which the antibodies bound, we constructed four
chimeric vacA genes in H. pylori 60190, such that
segments of the original vacA sequence were replaced with
vacA sequences from H. pylori Tx30a (Fig. 1).
Each of the four chimeric strains expressed a VacA product, and each of
these chimeric proteins oligomerized similarly to wild-type VacA, as determined by elution in the same high-molecular-mass fractions from a
size exclusion column (data not shown). Antibodies 9F2 and 5E4 (which
exhibited toxin-neutralizing activity for s1-m1 VacA) did not react
with chimeric proteins from strains G117, G119, and G120, which all had
residues 685 to 820 replaced with type m2 sequences (Table
4 and Fig. 1). Antibodies 5G5, 1B6, B13O,
4E, and B3D did not react with chimeric proteins from strains G118 and
G119, which all had amino acid residues 332 to 623 replaced with type
m2 sequences (Table 4 and Fig. 1). These results are consistent with
previous mapping data using the deletion mutations and alanine
substitution mutations (Table 2). Thus, the mapping data for the two
neutralizing antibodies, 9F2 and 5E4, suggest that relevant epitopes
for neutralization of VacA activity contain amino acids located between
amino acids 685 and 820.
 |
DISCUSSION |
In this study, we generated a panel of 10 monoclonal anti-VacA
antibodies, all of which were of the IgG1
isotype. An intriguing finding was that all of these antibodies reacted only with
conformational epitopes of VacA and thus failed to react with denatured
VacA in immunoblot assays. The failure to identify any antibodies
recognizing linear VacA epitopes potentially reflects a relative
resistance of the VacA oligomer to proteolytic degradation during
antigen processing or may result from the ability of VacA to alter
antigen presentation in mice (39, 48). Alternatively, a
bias may have been introduced by our screening methodology, in which
oligomeric VacA (hypothesized to contain surface-exposed epitopes
comprising predominantly highly folded rather than linear peptide
structures) was used as the antigen to identify reactive hybridoma
cells. The characteristics of the monoclonal antibodies described in this study are consistent with those of a previously described anti-VacA monoclonal antibody, C1G9, which was also an IgG1
isotype and reacted with a conformational VacA epitope (46).
Several antibodies described in this study recognized both oligomeric
and disassembled (acidified) forms of VacA, whereas other antibodies
reacted detectably only with the oligomeric form of VacA (Table 1). One
possible explanation for the differential reactivity of the latter
antibodies (13B, B13B, and C10F) is that certain conformational
epitopes might be displayed only when VacA is in an oligomeric state.
This model is consistent with the failure of these antibodies to react
with nonoligomerizing mutant forms of VacA (Table 2). However, we
cannot exclude the possibility that antibodies 13B, B13B, and C10F have
a relatively low affinity for VacA in general and that reactivity with
disassembled or nonoligomerizing forms of VacA was simply below the
threshold of detection.
By analyzing the reactivity of the 10 monoclonal antibodies with
various mutant VacA proteins, we were able to recognize at least four
distinct patterns of reactivity. Based on these patterns, we are able
to tentatively map the regions of VacA to which these antibodies bind
(Fig. 4). The patterns of reactivity of
the monoclonal antibodies to the VacA deletion mutations (Table 2),
alanine substitution mutations (data not shown), and VacA chimeras
(Table 4) were generally in agreement. Reactivity of the antibodies with conformational epitopes probably accounts for occasional instances
when the mapping data were not completely concordant with these
different types of mutant VacA proteins. At present, it is not known
whether the antibodies with similar patterns of reactivity recognize
identical epitopes or different epitopes within the same region of
VacA.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Schematic representation of the regions in VacA from
H. pylori strain 60190 to which the monoclonal antibodies
bind, based upon data shown in Tables 2 and 4 as well as reactivity of
antibodies with mutant VacA proteins containing alanine substitution
mutations (see text). The numbers represent amino acids in the mature
VacA toxin from H. pylori strain 60190.
|
|
In a previous study, polyclonal antiserum reactive with a recombinant
peptide of the C-terminal region of VacA (amino acids 476 to 803) was
reported to neutralize VacA cytotoxic activity (23). In
the present study, two of the monoclonal antibodies (9F2 and 5E4) that
exhibited toxin-neutralizing activity are predicted to react with a
portion of VacA located between amino acids 685 and 820. Therefore, it
seems likely that amino acid sequences in this portion of VacA mediate
toxin binding to cells and that these antibodies, 9F2 and 5E4, block
toxin activity by inhibiting toxin binding to cells. This hypothesis is
supported by a recent study which suggested that the C-terminal 100 amino acids of the mature VacA protein may be important for the binding
of recombinant VacA fusion proteins to HeLa cells (57).
H. pylori vacA is known to exhibit considerable allelic
diversity (5, 53, 55). However, the extent of antigenic
diversity among VacA toxins has not previously been investigated in
detail. In this study, we demonstrate that there is considerable
variation among VacA toxins in reactivity with our panel of monoclonal
antibodies. The most striking finding was that all of the monoclonal
antibodies produced against type s1-m1 VacA failed to recognize type
s2-m2 VacA toxins (Table 3). This result is not completely unexpected because mature type s1-m1 and type s2-m2 VacA toxins are about 75%
identical in amino acid sequences overall and exhibit <70% amino acid
identity in the VacA midregion (5). Another notable result
was that various monoclonal antibodies were unable to consistently recognize type s1-m1 toxins from multiple different strains (Table 3).
Type s1-m1 toxins produced by different H. pylori strains are typically >90% identical in amino acid sequence
(5,7). To account for the lack of uniform antibody
reactivity, we speculate that amino acid diversity among VacA proteins
from different H. pylori strains occurs disproportionately
in surface-exposed epitopes.
Anti-VacA antibodies are present in serum and gastric juice from the
majority of H. pylori-infected humans (12, 44),
and neutralizing IgG anti-VacA antibodies are sometimes detectable in
human serum (13). At present, it is not known whether
these antibodies play an important role in the biology of H. pylori-host interactions. Clearly the presence of anti-VacA
antibodies in physiologic concentrations does not result in the
eradication of established H. pylori infection in humans.
However, it seems plausible that such antibodies might modulate the
course of H. pylori infection or might inhibit colonization
by newly ingested H. pylori strains. In the latter case,
antigenic variation among VacA toxins from different strains might
render preexisting antibodies relatively ineffective.
In an effort to prevent serious complications of H. pylori
infection, such as peptic ulcer disease and distal gastric
adenocarcinoma, there has been an interest in development of an
H. pylori vaccine (34). Immunization with VacA
confers protective immunity in an experimental mouse model of H. pylori infection, and therefore VacA is considered a candidate
antigen for inclusion in an H. pylori vaccine (34,
35). In one study, immunization with purified type s1-m1 VacA
conferred protection against subsequent challenge by two H. pylori strains that produced vacuolating toxin activity in vitro
but failed to protect against challenge with a wild-type Tox
strain that lacked detectable toxic activity for HeLa
cells (34, 35). It is now known that many H. pylori strains that lack toxic activity (Tox
) for
HeLa cells contain type s1-m2 or s2-m2 vacA alleles and express detectable VacA products (5, 21, 42). Based on the
results of the present study, we speculate that the failure of an s1-m1
VacA antigen to induce protective immunity against a Tox
strain may be due to antigenic diversity among different VacA proteins.
In particular, it seems clear that many antibodies that are reactive
with type s1-m1 VacA fail to recognize type s2-m2 VacA. Therefore, if
VacA is to be included as a vaccine component, it might be appropriate
to immunize with pooled VacA antigens derived from several different
VacA families.
 |
ACKNOWLEDGMENTS |
We thank Donna Choate, Phillip Budge, and Beverly Hosse for
technical support.
This work was supported by the National Institutes of Health (RO1
AI-39657 and DK-53623), the Medical Research Service of the Department
of Veterans Affairs, and a grant from the Vanderbilt-Ingram Cancer
Center (2P30 CA69485-04) (R.L.M.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Infectious Diseases, A3310 Medical Center North, Vanderbilt University School of Medicine, Nashville, TN 37232. Phone: (615) 322-2035. Fax:
(615) 343-6160. E-mail: COVERTL{at}CTRVAX.VANDERBILT.EDU.
Editor:
J. T. Barbieri
 |
REFERENCES |
| 1.
|
Achtman, M.,
T. Azuma,
D. E. Berg,
Y. Ito,
G. Morelli,
Z. J. Pan,
S. Suerbaum,
S. A. Thompson,
A. van der Ende, and L. J. van Doorn.
1999.
Recombination and clonal groupings within Helicobacter pylori from different geographical regions.
Mol. Microbiol.
32:459-470[CrossRef][Medline].
|
| 2.
|
Akopyanz, N.,
N. O. Bukanov,
T. U. Westblom, and D. E. Berg.
1992.
PCR-based RFLP analysis of DNA sequence diversity in the gastric pathogen Helicobacter pylori.
Nucleic Acids Res.
20:6221-6225[Abstract/Free Full Text].
|
| 3.
|
Akopyanz, N.,
N. O. Bukanov,
T. U. Westblom,
S. Kresovich, and D. E. Berg.
1992.
DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting.
Nucleic Acids Res.
20:5137-5142[Abstract/Free Full Text].
|
| 4.
|
Alm, R. A.,
L. S. Ling,
D. T. Moir,
B. L. King,
E. D. Brown,
P. C. Doig,
D. R. Smith,
B. Noonan,
B. C. Guild,
B. L. deJonge,
G. Carmel,
P. J. Tummino,
A. Caruso,
M. Uria-Nickelsen,
D. M. Mills,
C. Ives,
R. Gibson,
D. Merberg,
S. D. Mills,
Q. Jiang,
D. E. Taylor,
G. F. Vovis, and T. J. Trust.
1999.
Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori.
Nature
397:176-180[CrossRef][Medline].
|
| 5.
|
Atherton, J. C.,
P. Cao,
R. M. Peek, Jr.,
M. K. Tummuru,
M. J. Blaser, and T. L. Cover.
1995.
Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration.
J. Biol. Chem.
270:17771-17777[Abstract/Free Full Text].
|
| 6.
|
Atherton, J. C.,
T. L. Cover,
R. J. Twells,
M. R. Morales,
C. J. Hawkey, and M. J. Blaser.
1999.
Simple and accurate PCR-based system for typing vacuolating cytotoxin alleles of Helicobacter pylori.
J. Clin. Microbiol.
37:2979-2982[Abstract/Free Full Text].
|
| 7.
|
Atherton, J. C.,
P. M. Sharp,
T. L. Cover,
G. Gonzalez-Valencia,
R. M. Peek, Jr.,
S. A. Thompson,
C. J. Hawkey, and M. J. Blaser.
1999.
Vacuolating cytotoxin (vacA) alleles of Helicobacter pylori comprise two geographically widespread types, m1 and m2, and have evolved through limited recombination.
Curr. Microbiol.
39:211-218[CrossRef][Medline].
|
| 8.
|
Copass, M.,
G. Grandi, and R. Rappuoli.
1997.
Introduction of unmarked mutations in the Helicobacter pylori vacA gene with a sucrose sensitivity marker.
Infect. Immun.
65:1949-1952[Abstract/Free Full Text].
|
| 9.
|
Cover, T. L.
1996.
The vacuolating cytotoxin of Helicobacter pylori.
Mol. Microbiol.
20:241-246[CrossRef][Medline].
|
| 10.
|
Cover, T. L.,
D. E. Berg,
M. J. Blaser, and H. L. T. Mobley.
2001.
Helicobacter pylori pathogenesis, p. 509-558.
In
E. Groisman (ed.), Principles of bacterial pathogenesis. Academic Press, New York, N.Y.
|
| 11.
|
Cover, T. L., and M. J. Blaser.
1992.
Purification and characterization of the vacuolating toxin from Helicobacter pylori.
J. Biol. Chem.
267:10570-10575[Abstract/Free Full Text].
|
| 12.
|
Cover, T. L.,
P. Cao,
C. D. Lind,
K. T. Tham, and M. J. Blaser.
1993.
Correlation between vacuolating cytotoxin production by Helicobacter pylori isolates in vitro and in vivo.
Infect. Immun.
61:5008-5012[Abstract/Free Full Text].
|
| 13.
|
Cover, T. L.,
P. Cao,
U. K. Murthy,
M. S. Sipple, and M. J. Blaser.
1992.
Serum neutralizing antibody response to the vacuolating cytotoxin of Helicobacter pylori.
J. Clin. Investig.
90:913-918.
|
| 14.
|
Cover, T. L.,
P. I. Hanson, and J. E. Heuser.
1997.
Acid-induced dissociation of VacA, the Helicobacter pylori vacuolating cytotoxin, reveals its pattern of assembly.
J. Cell Biol.
138:759-769[Abstract/Free Full Text].
|
| 15.
|
Cover, T. L.,
W. Puryear,
G. I. Pérez-Pérez, and M. J. Blaser.
1991.
Effect of urease on HeLa cell vacuolation induced by Helicobacter pylori cytotoxin.
Infect. Immun.
59:1264-1270[Abstract/Free Full Text].
|
| 16.
|
Cover, T. L.,
M. K. R. Tummuru,
P. Cao,
S. A. Thompson, and M. J. Blaser.
1994.
Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains.
J. Biol. Chem.
269:10566-10573[Abstract/Free Full Text].
|
| 17.
|
Czajkowsky, D. M.,
H. Iwamoto,
T. L. Cover, and Z. Shao.
1999.
The vacuolating toxin from Helicobacter pylori forms hexameric pores in lipid bilayers at low pH.
Proc. Natl. Acad. Sci. USA
96:2001-2006[Abstract/Free Full Text].
|
| 18.
|
de Bernard, M.,
D. Burroni,
E. Papini,
R. Rappuoli,
J. Telford, and C. Montecucco.
1998.
Identification of the Helicobacter pylori VacA toxin domain active in the cell cytosol.
Infect. Immun.
66:6014-6016[Abstract/Free Full Text].
|
| 19.
|
de Bernard, M.,
E. Papini,
V. de Filippis,
E. Gottardi,
J. Telford,
R. Manetti,
A. Fontana,
R. Rappuoli, and C. Montecucco.
1995.
Low pH activates the vacuolating toxin of Helicobacter pylori, which becomes acid and pepsin resistant.
J. Biol. Chem.
270:23937-23940[Abstract/Free Full Text].
|
| 20.
|
Dunn, B. E.,
H. Cohen, and M. J. Blaser.
1997.
Helicobacter pylori.
Clin. Microbiol. Rev.
10:720-741[Abstract/Free Full Text].
|
| 21.
|
Forsyth, M. H.,
J. C. Atherton,
M. J. Blaser, and T. L. Cover.
1998.
Heterogeneity in levels of vacuolating cytotoxin gene (vacA) transcription among Helicobacter pylori strains.
Infect. Immun.
66:3088-3094[Abstract/Free Full Text].
|
| 22.
|
Garner, J. A., and T. L. Cover.
1995.
Analysis of genetic diversity in cytotoxin-producing and non-cytotoxin-producing Helicobacter pylori strains.
J. Infect. Dis.
172:290-293[Medline].
|
| 23.
|
Garner, J. A., and T. L. Cover.
1996.
Binding and internalization of the Helicobacter pylori vacuolating cytotoxin by epithelial cells.
Infect. Immun.
64:4197-4203[Abstract/Free Full Text].
|
| 24.
|
Gerhard, M.,
N. Lehn,
N. Neumayer,
T. Boren,
R. Rad,
W. Schepp,
S. Miehlke,
M. Classen, and C. Prinz.
1999.
Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin.
Proc. Natl. Acad. Sci. USA
96:12778-12783[Abstract/Free Full Text].
|
| 25.
|
Göttke, M. U.,
C. A. Fallone,
A. N. Barkun,
K. Vogt,
V. Loo,
M. Trautmann,
J. Z. Tong,
T. N. Nguyen,
T. Fainsilber,
H. H. Hahn,
J. Korber,
A. Lowe, and R. N. Beech.
2000.
Genetic variability determinants of Helicobacter pylori: influence of clinical background and geographic origin of isolates.
J. Infect. Dis.
181:1674-1681[CrossRef][Medline].
|
| 26.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 27.
|
Ito, Y.,
T. Azuma,
S. Ito,
H. Miyaji,
M. Hirai,
Y. Yamazaki,
F. Sato,
T. Kato,
Y. Kohli, and M. Kuriyama.
1997.
Analysis and typing of the vacA gene from cagA-positive strains of Helicobacter pylori isolated in Japan.
J. Clin. Microbiol.
35:1710-1714[Abstract/Free Full Text].
|
| 28.
|
Ito, Y.,
T. Azuma,
S. Ito,
H. Suto,
H. Miyaji,
Y. Yamazaki,
Y. Kohli, and M. Kuriyama.
1998.
Full-length sequence analysis of the vacA gene from cytotoxic and noncytotoxic Helicobacter pylori.
J. Infect. Dis.
178:1391-1398[CrossRef][Medline].
|
| 29.
|
Iwamoto, H.,
D. M. Czajkowsky,
T. L. Cover,
G. Szabo, and Z. Shao.
1999.
VacA from Helicobacter pylori: a hexameric chloride channel.
FEBS Lett.
450:101-104[CrossRef][Medline].
|
| 30.
|
Ji, X.,
T. Fernandez,
D. Burroni,
C. Pagliaccia,
J. C. Atherton,
J. M. Reyrat,
R. Rappuoli, and J. L. Telford.
2000.
Cell specificity of Helicobacter pylori cytotoxin is determined by a short region in the polymorphic midregion.
Infect. Immun.
68:3754-3757[Abstract/Free Full Text].
|
| 31.
|
Kersulyte, D.,
A. K. Mukhopadhyay,
B. Velapatino,
W. Su,
Z. Pan,
C. Garcia,
V. Hernandez,
Y. Valdez,
R. S. Mistry,
R. H. Gilman,
Y. Yuan,
H. Gao,
T. Alarcon,
M. Lopez-Brea,
G. Balakrish Nair,
A. Chowdhury,
S. Datta,
M. Shirai,
T. Nakazawa,
R. Ally,
I. Segal,
B. C. Wong,
S. K. Lam,
F. O. Olfat,
T. Boren,
L. Engstrand,
O. Torres,
R. Schneider,
J. E. Thomas,
S. Czinn, and D. E. Berg.
2000.
Differences in genotypes of Helicobacter pylori from different human populations.
J. Bacteriol.
182:3210-3218[Abstract/Free Full Text].
|
| 32.
|
Lupetti, P.,
J. E. Heuser,
R. Manetti,
P. Massari,
S. Lanzavecchia,
P. L. Bellon,
R. Dallai,
R. Rappuoli, and J. L. Telford.
1996.
Oligomeric and subunit structure of the Helicobacter pylori vacuolating cytotoxin.
J. Cell Biol.
133:801-807[Abstract/Free Full Text].
|
| 33.
|
Manetti, R.,
P. Massari,
D. Burroni,
M. de Bernard,
A. Marchini,
R. Olivieri,
E. Papini,
C. Montecucco,
R. Rappuoli, and J. L. Telford.
1995.
Helicobacter pylori cytotoxin: importance of native conformation for induction of neutralizing antibodies.
Infect. Immun.
63:4476-4780[Abstract/Free Full Text].
|
| 34.
|
Marchetti, M.,
B. Aricò,
D. Burroni,
N. Figura,
R. Rappuoli, and P. Ghiara.
1995.
Development of a mouse model of Helicobacter pylori infection that mimics human disease.
Science
267:1655-1658[Abstract/Free Full Text].
|
| 35.
|
Marchetti, M.,
M. Rossi,
V. Giannelli,
M. M. Giuliani,
M. Pizza,
S. Censini,
A. Covacci,
P. Massari,
C. Pagliaccia,
R. Manetti,
J. L. Telford,
G. Douce,
G. Dougan,
R. Rappuoli, and P. Ghiara.
1998.
Protection against Helicobacter pylori infection in mice by intragastric vaccination with Helicobacter pylori antigens is achieved using a non-toxic mutant of Escherichia coli heat-labile enterotoxin (LT) as adjuvant.
Vaccine
16:33-37[CrossRef][Medline].
|
| 36.
|
Marshall, D. G.,
W. G. Dundon,
S. M. Beesley, and C. J. Smyth.
1998.
Helicobacter pylori a conundrum of genetic diversity.
Microbiology
144:2925-2939[Free Full Text].
|
| 37.
|
McClain, M. S.,
W. Schraw,
V. Ricci,
P. Boquet, and T. L. Cover.
2000.
Acid-activation of Helicobacter pylori vacuolating cytotoxin (VacA) results in toxin internalization by eukaryotic cells.
Mol. Microbiol.
37:433-442[CrossRef][Medline].
|
| 38.
|
Molinari, M.,
C. Galli,
M. de Bernard,
N. Norais,
J. M. Ruysschaert,
R. Rappuoli, and C. Montecucco.
1998.
The acid activation of Helicobacter pylori toxin VacA: structural and membrane binding studies.
Biochem. Biophys. Res. Commun.
248:334-340[CrossRef][Medline].
|
| 39.
|
Molinari, M.,
M. Salio,
C. Galli,
N. Norais,
R. Rappuoli,
A. Lanzavecchia, and C. Montecucco.
1998.
Selective inhibition of Ii-dependent antigen presentation by Helicobacter pylori toxin VacA.
J. Exp. Med.
187:135-140[Abstract/Free Full Text].
|
| 40.
|
Montecucco, C.,
E. Papini,
M. de Bernard,
J. L. Telford, and R. Rappuoli.
1999.
Helicobacter pylori vacuolating cytotoxin and associated pathogenic factors., p. 264-286.
In
J. E. Alouf, and J. H. Freer (ed.), The comprehensive sourcebook of bacterial protein toxins. Academic Press, London, United Kingdom.
|
| 41.
|
Nguyen, V. Q.,
R. M. Caprioli, and T. L. Cover.
2001.
Carboxy-terminal proteolytic processing of Helicobacter pylori vacuolating toxin.
Infect. Immun.
69:543-546[Abstract/Free Full Text].
|
| 42.
|
Pagliaccia, C.,
M. de Bernard,
P. Lupetti,
X. Ji,
D. Burroni,
T. L. Cover,
E. Papini,
R. Rappuoli,
J. L. Telford, and J. M. Reyrat.
1998.
The m2 form of the Helicobacter pylori cytotoxin has cell type-specific vacuolating activity.
Proc. Natl. Acad. Sci USA
95:10212-10217[Abstract/Free Full Text].
|
| 43.
|
Pan, Z. J.,
D. E. Berg,
R. W. van der Hulst,
W. W. Su,
A. Raudonikiene,
S. D. Xiao,
J. Dankert,
G. N. Tytgat, and A. van der Ende.
1998.
Prevalence of vacuolating cytotoxin production and distribution of distinct vacA alleles in Helicobacter pylori from China.
J. Infect. Dis.
178:220-226[Medline].
|
| 44.
|
Perez-Perez, G. I.,
R. M. Peek, Jr.,
J. C. Atherton,
M. J. Blaser, and T. L. Cover.
1999.
Detection of anti-VacA antibody responses in serum and gastric juice samples using type s1/m1 and s2/m2 Helicobacter pylori VacA antigens.
Clin. Diagn. Lab. Immunol.
6:489-493[Abstract/Free Full Text].
|
| 45.
|
Perrin, S., and G. Gilliland.
1990.
Site-specific mutagenesis using asymmetric polymerase chain reaction and a single mutant primer.
Nucleic Acids Res.
18:7433-7438[Abstract/Free Full Text].
|
| 46.
|
Reyrat, J. M.,
M. Charrel,
C. Pagliaccia,
D. Burroni,
P. Lupetti,
M. de Bernard,
X. Ji,
N. Norais,
E. Papini,
R. Dallai,
R. Rappuoli, and J. L. Telford.
1998.
Characterisation of a monoclonal antibody and its use to purify the cytotoxin of Helicobacter pylori.
FEMS Microbiol. Lett.
165:79-84[CrossRef][Medline].
|
| 47.
|
Rudi, J.,
C. Kolb,
M. Maiwald,
D. Kuck,
A. Sieg,
P. R. Galle, and W. Stremmel.
1998.
Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases.
J. Clin. Microbiol.
36:944-948[Abstract/Free Full Text].
|
| 48.
|
Satin, B.,
N. Norais,
J. Telford,
R. Rappuoli,
M. Murgia,
C. Montecucco, and E. Papini.
1997.
Effect of Helicobacter pylori vacuolating toxin on maturation and extracellular release of procathepsin D and on epidermal growth factor degradation.
J. Biol. Chem.
272:25022-25028[Abstract/Free Full Text].
|
| 49.
|
Strobel, S.,
S. Bereswill,
P. Balig,
P. Allgaier,
H. G. Sonntag, and M. Kist.
1998.
Identification and analysis of a new vacA genotype variant of Helicobacter pylori in different patient groups in Germany.
J. Clin. Microbiol.
36:1285-1289[Abstract/Free Full Text].
|
| 50.
|
Suerbaum, S.,
J. M. Smith,
K. Bapumia,
G. Morelli,
N. H. Smith,
E. Kunstmann,
I. Dyrek, and M. Achtman.
1998.
Free recombination within Helicobacter pylori.
Proc. Natl. Acad. Sci. USA
95:12619-12624[Abstract/Free Full Text].
|
| 51.
|
Szabo, I.,
S. Brutsche,
F. Tombola,
M. Moschioni,
B. Satin,
J. L. Telford,
R. Rappuoli,
C. Montecucco,
E. Papini, and M. Zoratti.
1999.
Formation of anion-selective channels in the cell plasma membrane by the toxin VacA of Helicobacter pylori is required for its biological activity.
EMBO J.
18:5517-5527[CrossRef][Medline].
|
| 52.
|
Tombola, F.,
C. Carlesso,
I. Szabo,
M. de Bernard,
J. M. Reyrat,
J. L. Telford,
R. Rappuoli,
C. Montecucco,
E. Papini, and M. Zoratti.
1999.
Helicobacter pylori vacuolating toxin forms anion-selective channels in planar lipid bilayers: possible implications for the mechanism of cellular vacuolation.
Biophys. J.
76:1401-1409[Medline].
|
| 53.
|
Van Doorn, L. J.,
C. Figueiredo,
F. Megraud,
S. Pena,
P. Midolo,
D. M. Queiroz,
F. Carneiro,
B. Vanderborght,
M. D. Pegado,
R. Sanna,
W. De Boer,
P. M. Schneeberger,
P. Correa,
E. K. Ng,
J. Atherton,
M. J. Blaser, and W. G. Quint.
1999.
Geographic distribution of vacA allelic types of Helicobacter pylori.
Gastroenterology
116:823-830[CrossRef][Medline].
|
| 54.
|
van Doorn, L. J.,
C. Figueiredo,
R. Rossau,
G. Jannes,
M. van Asbroek,
J. C. Sousa,
F. Carneiro, and W. G. Quint.
1998.
Typing of Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization.
J. Clin. Microbiol.
36:1271-1276[Abstract/Free Full Text].
|
| 55.
|
van Doorn, L. J.,
C. Figueiredo,
R. Sanna,
S. Pena,
P. Midolo,
E. K. Ng,
J. C. Atherton,
M. J. Blaser, and W. G. Quint.
1998.
Expanding allelic diversity of Helicobacter pylori vacA.
J. Clin. Microbiol.
36:2597-2603[Abstract/Free Full Text].
|
| 56.
|
Vinion-Dubiel, A. D.,
M. S. McClain,
D. M. Czajkowsky,
H. Iwamoto,
D. Ye,
P. Cao,
W. Schraw,
G. Szabo,
S. R. Blanke,
Z. Shao, and T. L. Cover.
1999.
A dominant negative mutant of Helicobacter pylori vacuolating toxin (VacA) inhibits VacA-induced cell vacuolation.
J. Biol. Chem.
274:37736-37742[Abstract/Free Full Text].
|
| 57.
|
Wang, H. J., and W. C. Wang.
2000.
Expression and binding analysis of GST-VacA fusions reveals that the C-terminal approximately 100-residue segment of exotoxin is crucial for binding in HeLa cells.
Biochem. Biophys. Res. Commun.
278:449-454[CrossRef][Medline].
|
| 58.
|
Yahiro, K.,
T. Niidome,
M. Kimura,
T. Hatakeyama,
H. Aoyagi,
H. Kurazono,
K. Imagawa,
A. Wada,
J. Moss, and T. Hirayama.
1999.
Activation of Helicobacter pylori VacA toxin by alkaline or acid conditions increases its binding to a 250-kDa receptor protein-tyrosine phosphatase beta.
J. Biol. Chem.
274:36693-36699[Abstract/Free Full Text].
|
| 59.
|
Ye, D.,
D. C. Willhite, and S. R. Blanke.
1999.
Identification of the minimal intracellular vacuolating domain of the Helicobacter pylori vacuolating toxin.
J. Biol. Chem.
274:9277-9282[Abstract/Free Full Text].
|
Infection and Immunity, July 2001, p. 4329-4336, Vol. 69, No. 7
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.7.4329-4336.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
KI, M.-R., HONG, I.-H., PARK, J.-K., HONG, K.-S., HWANG, O.-K., HAN, J.-Y., JI, A.-R., PARK, S.-I., LEE, S.-K., YOO, S.-E., JEONG, K.-S.
(2009). Potent Neutralization of Vacuolating Cytotoxin (VacA) of Helicobacter pylori by Immunoglobulins Against the Soluble Recombinant VacA. Anticancer Res
29: 2393-2402
[Abstract]
[Full Text]
-
McClain, M. S., Czajkowsky, D. M., Torres, V. J., Szabo, G., Shao, Z., Cover, T. L.
(2006). Random Mutagenesis of Helicobacter pylori vacA To Identify Amino Acids Essential for Vacuolating Cytotoxic Activity. Infect. Immun.
74: 6188-6195
[Abstract]
[Full Text]
-
Li, Y., Wandinger-Ness, A., Goldenring, J. R., Cover, T. L.
(2004). Clustering and Redistribution of Late Endocytic Compartments in Response to Helicobacter pylori Vacuolating Toxin. Mol. Biol. Cell
15: 1946-1959
[Abstract]
[Full Text]
-
Schraw, W., Li, Y., McClain, M. S., van der Goot, F. G., Cover, T. L.
(2002). Association of Helicobacter pylori Vacuolating Toxin (VacA) with Lipid Rafts. J. Biol. Chem.
277: 34642-34650
[Abstract]
[Full Text]