Infection and Immunity, July 2001, p. 4465-4472, Vol. 69, No. 7
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.7.4465-4472.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
andDepartment of Microbiology, University of Texas Health Science Center at San Antonio, San Antonio, Texas 78229
Received 10 January 2001/Returned for modification 26 February 2001/Accepted 5 April 2001
| |
ABSTRACT |
|---|
|
|
|---|
Treponema denticola does not appear to produce siderophores, so it must acquire iron by other pathways. Indeed, T. denticola has been shown to have an iron-regulated 44-kDa outer membrane protein (HbpA) with hemin binding ability. To characterize the HbpA protein, its gene was cloned from genomic DNA libraries of T. denticola. Sequence analysis of the hbpA open reading frame indicated that it encoded a 42.8-kDa protein with a 23-amino-acid signal peptide. HbpA has no significant homology to any proteins in the databases. Southern blot analysis demonstrated that hbpA is present in several T. denticola ATCC strains and clinical isolates, but not in Treponema pectinovorum, Treponema socranskii, or Escherichia coli. HbpA, expressed as a recombinant protein in E. coli and purified by antibody affinity chromatography, has hemin binding activity as determined by lithium dodecyl sulfate-polyacrylamide gel electrophoresis with tetramethylbenzidine staining. Northern blot analysis showed that there were two hbpA-containing transcripts, of approximately 1.3 and 2.6 kb, and that the RNA levels were low-iron induced. Interestingly, the 2.6-kb mRNA also encoded a second protein with significant homology to hbpA. This downstream gene, called hbpB, was cloned and sequenced and its product was expressed as a fusion protein in E. coli. The hbpB gene product is 49% identical to HbpA and binds hemin. Thus, T. denticola has two novel hemin binding proteins which may be part of a previously unrecognized iron acquisition pathway.
| |
INTRODUCTION |
|---|
|
|
|---|
There is mounting evidence for the roles of several oral anaerobic spirochetes in periodontal disease, with the best characterized species being Treponema denticola. This organism is frequently found in high numbers at periodontally diseased sites (2, 48), and its presence is strongly associated with the pathogenesis of human periodontal disease (32, 48). This organism is also considered a putative pathogen because it can produce a variety of virulence factors (9), including proteolytic enzymes (8, 33, 55), a hemolysin (5, 14), and immunosuppressive factors (46). These virulence activities are presumed to be important for establishing T. denticola in the periodontal pocket and possibly for causing some of the tissue destruction seen in periodontal disease.
Iron is an essential nutrient for the growth and metabolism of most bacteria (15, 31, 57). In order to survive in vivo, pathogenic bacteria have developed several mechanisms for acquiring iron in the host environment. Most bacteria secrete iron-chelating siderophores (37), which remove iron from host iron-binding proteins and then interact with bacterial membrane receptors to transport iron into the bacterium. In addition, some organisms have low-iron-inducible outer membrane proteins (OMPs) that bind host iron-binding proteins, such as transferrin or lactoferrin, and remove the iron (39, 43). Finally, some gram-negative human pathogens acquire iron from heme compounds. In these systems, a bacterial hemin-binding protein serves as a surface receptor to bind heme protein, and then the hemin is transported into the cells by a protein complex containing the inner membrane TonB protein (40, 58). The ability to utilize hemin and hemin-containing compounds for nutritional iron uptake has been documented for numerous pathogenic bacteria, including the periodontal pathogen Porphyromonas gingivalis (19, 38, 58).
T. denticola does not appear to produce siderophores (45), so it must have other mechanisms for iron acquisition. Indeed, T. denticola can bind lactoferrin (50) and hemin (7, 44). In addition, T. denticola produces a hemolysin (6), which could lyse erythrocytes in vivo and provide heme compounds for the bacterium. Previous studies have shown that T. denticola contains at least two hemin binding molecules: a 47-kDa constitutively produced hemin binding protein from strain ATCC 35405 (45) and a 44-kDa hemin binding protein (HbpA), which is up-regulated under iron-restricted growth, that is found in strains GM-1, MS-25, ATCC 33520, and ATCC 33404 (7). However, the role of these proteins in iron acquisition is unproven and the mechanism of binding and iron transport by these proteins has not been characterized. The 44-kDa HbpA has been purified and its amino-terminal sequence has been determined (7). The limited sequence had no homology with other proteins involved in iron uptake, suggesting that T. denticola may use a novel system to acquire iron. In order to understand the mechanism of this T. denticola iron uptake system and eventually determine its role in pathogenesis, the gene (hbpA) for the 44-kDa hemin binding protein from T. denticola ATCC 35404 was cloned, sequenced, and characterized, as was a downstream homologue called hbpB. The protein products of these genes are shown to bind hemin. Thus they may contribute to hemin utilization by T. denticola.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and culture conditions. T. denticola ATCC 35404 (TD-4) was used as the source of genomic DNA and in the RNA studies. T. denticola strains GM-1 and MS25 were originally isolated from human periodontal pockets (56). Strain SW-1 is a clinical isolate recovered by Steve Walker from a patient with periodontal disease. Treponema socranskii and Treponema pectinovorum are ATCC strains 35536 and 33768, respectively. The cells were grown anaerobically (5% CO2, 10% H2, 85% N2) at 37°C in GM-1 medium (56). To grow cells in iron-restrictive conditions, 2,2'-bipyridyl (BPD) was added to a final concentration of 200 µM.
Plasmids pUC18 and pBluescript II KS were used as vectors for cloning. Escherichia coli strains DH5
and DH10b were used as host
strains for plasmids and were routinely grown in Luria-Bertani broth or
on Luria-Bertani agar plates supplemented with ampicillin (50 µg/ml)
when appropriate.
Chromosomal DNA isolation and Southern blot analysis.
T. denticola chromosomal DNA was isolated using a
detergent-proteinase K lysis procedure that included treatment with
cetyltrimethylammonium bromide to remove polysaccharides and cell wall
debris (3). For Southern blot analyses, chromosomal DNAs
were digested with the indicated restriction endonucleases, separated
on 0.7% agarose gels, and transferred to nylon membranes.
Hybridization of the membranes was carried out in 6× SSC (1× SSC is
0.15 M NaCl plus 0.015 M sodium citrate) overnight at 56°C and the
filters were washed three times with 6× SSC at 56°C. DNA fragments
used as hybridization probes were isolated from plasmid or amplified by PCR and then isolated from agarose gels by a freeze-thaw-phenol extraction procedure (47). DNA probes were labeled with
[
-32P]dATP using a random primer DNA labeling system
(Life Technologies, Gaithersburg, Md.) or, if oligonucleotides were
used, end labeled with [
-32P]ATP by T4 polynucleotide kinase.
Oligonucleotides and DNA amplification by PCR. For amplification of the DNA fragment encoding the amino terminus of the hbpA gene, a degenerate, 29-base oligonucleotide (5' AARACIATGCCIGCIGCIAARGAYAAYAA 3', where I = inosine, R = A or G, and Y = C or T) was synthesized based upon the previously determined amino acid sequence of the N terminus of HbpA (7). T. denticola genomic DNA was digested by PstI and EcoRI, and the resulting fragments were ligated into the PstI/EcoRI sites of pUC18. The ligation mixture served as the template in a PCR synthesis. The hbpA 29-mer oligonucleotide and the M13 forward primer were used as primers in the PCR. An initial denaturation step (5 min, 94°C) was followed by 40 cycles of amplification (1 min at 94°C, 1 min at 48°C, and 3 min at 72°C) in a model PTC-100 thermocycler from MJ Research.
Construction and screening of partial libraries of T. denticola genomic DNA.
T. denticola genomic DNA
(80 µg) was digested with the appropriate restriction endonucleases
and electrophoresed on a 0.7% agarose gel. A region of the gel
containing DNA fragments corresponding in size to the hybridizing DNA
fragment, as determined by preliminary Southern blotting, was excised
and the DNA was extracted using a Qiaex kit (Qiagen Inc., Chatsworth,
Calif.). These size-separated DNA fragments were ligated into either
pBluescript or pUC18 and transformed into E. coli DH5
.
Colonies from these partial libraries were transferred onto nylon
membranes and screened for the correct insert by colony blot
hybridization. The hybridization and washing conditions were the same
as those described above for Southern blot analysis.
DNA sequencing. Segments of various clones were sequenced in the Center for Advanced DNA Technology at the University of Texas Health Science Center at San Antonio using an Applied Biosystems model 373A sequencing system. All sequences were determined independently from both strands. The deduced amino acid sequences were compared to the nonredundant, combined protein databases at the National Center for Biotechnology Information using the BLAST algorithm (1) and the PROSITE program.
Expression and purification of rHbpA.
To express HbpA in
E. coli, the 1.6-kb PstI-BamHI
fragment from pSH4, which encodes the carboxy end of hbpA,
was first ligated into pBluescript. The resulting plasmid was cleaved
with HincII and PstI, and a 245-bp
HincII-PstI fragment from pSH3, which encodes the
amino portion of hbpA, was ligated in. This reconstructed the entire hbpA gene in one plasmid (pSH5). The plasmid was
transformed into E. coli DH5
and the expression of
recombinant HbpA (rHbpA) was assessed by Western blot analysis. To
purify rHbpA, growth supernatant from E. coli/pSH5 cells was
applied to an anti-HbpA affinity column. The affinity column was made
from anti-HbpA rabbit serum (7), which had been absorbed
against E. coli DH5
cells, purified by salt
precipitation, and cross-linked to Affi-Gel 10 (Bio-Rad Laboratories,
Richmond, Calif.). After washing of the column with pH 9.0 Tris buffer
and pH 6.3 phosphate-buffered saline, the protein was eluted with pH
2.5 glycine-HCl buffer. The eluate was neutralized immediately with pH
8.0 Tris buffer. The combined eluate was put into dialysis tubing,
concentrated by placement in polyethylene glycol until the volume was
reduced to 0.5 to 1.0 ml, and then dialyzed against pH 8.0 Tris buffer.
Expression of rHbpB as a fusion protein.
The coding region,
without the signal peptide, of the hbpB gene was amplified
by PCR with T. denticola genomic DNA as the template. The
primers (AACTGCAGATGTAAGTCGATGCCTAAC and
CGGAATTCTCTCCTATAAAAAG) used in the PCR contained a
PstI or an EcoRI site, one on either primer, that
was not encoded by the hbpB gene. The PCR product was
digested with PstI and EcoRI and ligated, in
frame, into the expression vector pRsetA (Invitrogen, San Diego,
Calif.). The recombinant plasmid was transformed into E. coli BL21(DE3). The expression of rHbpB was induced by the
addition of isopropyl-
-D-thiogalactopyranoside to cells
containing the expression plasmid.
SDS-PAGE and Western blot analysis.
The discontinuous gel
system of Laemmli (25) was used for sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The resolving
gel consisted of 12% acrylamide in 0.125 M Tris (pH 8.8), and the
stacking gel contained 4% acrylamide in 0.125 M Tris (pH 6.8). Total
E. coli proteins were prepared by pelleting 5 ml of
stationary cells, suspending the pellet in 1 ml of 1× sample buffer
(2% SDS, 10% glycerol, 5%
-mercaptoethanol, 1 mM bromophenol
blue), and heating to 100°C for 5 min. The OMPs of T. denticola were isolated by the freeze-thaw method
(34). After electrophoresis, the gels were either stained
with Coomassie brilliant blue R250 or transferred onto Immobilon-P
membranes (Millipore Corp., Bedford, Mass.) for Western blotting
(54). For Western blotting, the membrane was blocked with
3% bovine serum albumin in Tris-buffered saline (20 mM Tris, 0.5 M
NaCl [pH 7.5]) and then incubated with anti-HbpA antibodies followed
by alkaline phosphatase-conjugated secondary antibodies at the
appropriate dilution. The rabbit anti-HbpA serum was a generous gift of
L. Chu and was prepared from a rabbit immunized with purified HbpA from
T. denticola (7). The membranes were developed
with a 5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium
colorimetric system. Bio-Rad prestained molecular weight standards were
used to estimate the molecular masses of the proteins.
LDS-PAGE and TMBZ staining. Lithium dodecyl sulfate (LDS)-PAGE (Sigma, St. Louis, Mo.) and tetramethylbenzidine (TMBZ) (Sigma) staining were employed to assess the hemin binding ability of proteins (53). The resolving gel consisted of 12% acrylamide in 0.375 M Tris buffer (pH 8.8) containing 0.1% LDS. The stacking gel contained 4% acrylamide and 0.1% LDS. Where indicated, the protein samples, consisting of 250 ng of purified recombinant protein or 10 µg of T. denticola OMP, were incubated with hemin (20 µg/ml) at 37°C for 30 min and diluted 4:1 with sample loading buffer before loading onto the gel. The proteins were electrophoresed at a constant 220 V in the dark at 4°C. Detection of hemin-protein complexes was accomplished by staining the gel with TMBZ, a chromogen that is turned blue by proteins with hemin-associated peroxidase activity. The gel was fixed in 0.25 M sodium acetate (pH 5.0) and stained in TMBZ solution, and the color was developed by adding 30 mM hydrogen peroxide to the staining solution. The gel then was washed in 0.25 M sodium acetate-isopropanol (8:2) and dried immediately.
Northern blot analysis. Total RNA of T. denticola was isolated using the Ultraspec RNA isolation system (Biotecx Laboratories Inc., Houston, Tex.). RNA was extracted from 30 ml of T. denticola cells which had been growing for 2 days in GM-1 with or without BPD after being inoculated with 3 ml of a 3-day-old culture of T. denticola cells. Cells were harvested and suspended in 1 ml of Ultraspec RNA solution for cell lysis. After the addition of 0.2 ml of chloroform and centrifugation, the RNA in the aqueous phase was precipitated with an equal volume of isopropanol and washed twice with 75% ethanol. The RNA pellet was dissolved in 50 µl of diethyl pyrocarbonate-treated water. The yield of RNA was determined by absorbance spectrophotometry at 260 nm. The indicated amount of RNA were electrophoresed in 1% agarose formaldehyde gels and transferred to a nylon membrane by capillary transfer. Probes were prepared and hybridizations were done as described above for Southern blotting.
Nucleotide sequence accession numbers. The nucleotide sequences reported here have been deposited in GenBank with accession numbers AF196837 and AF332358.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the hemin binding protein gene (hbpA). Based on the previously determined amino-terminal amino acid sequence of HbpA (7), a degenerate 29-base oligonucleotide (29-mer) potentially encoding amino acids 2 to 11 of HbpA was synthesized. Samples of T. denticola genomic DNA were digested with various restriction enzymes and the resulting collections of fragments were ligated into appropriately digested pUC18. These ligation mixtures served as templates in PCR amplifications with the 29-mer oligonucleotide and either M13 forward or M13 reverse primers. The PstI-EcoRI ligation mixture gave a 167-bp PCR product with the 29-mer and M13 forward primers (data not shown). Sequence analysis of the PCR fragment indicated that a 107-bp region in the fragment could encode a 46-amino-acid-long polypeptide whose first 20 amino acids matched the previously determined amino-terminal sequence of the 44-kDa protein.
A 107-bp HindIII/PstI fragment from this PCR product corresponding to amino acids 20 to 46 of HbpA was used as a hybridization probe in colony blot hybridization against various T. denticola genomic DNA libraries. No stable positive colonies were found. Since it has been reported that overexpression of some T. denticola membrane proteins may be toxic to E. coli (10), we decided to clone the rest of the hbpA gene in several fragments. The 107-bp HindIII/PstI fragment was used as hybridization probe to clone a 333-bp HindIII fragment from a size-limited T. denticola genomic library (Fig. 1, pSH2). The insert from pSH2 was then used as a hybridization probe against another T. denticola genomic library to clone the 3' half of the hbpA gene on a 1.6-kb PstI/BamHI fragment (Fig. 1, pSH4). Cloning of the upstream region of hbpA proved to be more difficult; E. coli cells with plasmids containing the beginning of the hbpA gene and some upstream DNA grew much more slowly, as if the plasmid or its product was toxic to E. coli. However, we were able to clone the 5' end of the hbpA gene as a 1.1-kb Sau3AI/PstI DNA fragment (Fig. 1, pSH3) by screening a Sau3AI/PstI genomic DNA library, using the insert from pSH2 as a hybridization probe.
|
The HbpA gene encodes a novel protein with a secretion signal.
Analysis of the 2,703-bp sequence contained in pSH2, pSH3, and pSH4
revealed one complete open reading frame (ORF) in the middle and two
incomplete ORFs at either end (Fig. 1). All three ORFs were in the same
orientation and they were 283 bp (orf1 to hbpA)
and 90 bp (hbpA to hbpB) apart. The G+C content
of the sequenced DNA was 38.8%, which is similar to the T. denticola overall G+C content of 37 to 38% (49),
suggesting that hbpA is not part of a pathogenicity island.
The promoter prediction program NNPP (41) indicates that
there is a possible bacterial
70-like promoter between
nucleotides 811 and 841, just upstream of the HbpA start codon (Fig.
2A). However, these data must be interpreted cautiously since the consensus promoter sequence is based
upon E. coli promoters, although several T. denticola promoters have been characterized (13, 16, 24,
30). A potential ribosome binding site (Shine-Dalgarno) is
located 7 bp upstream of the HbpA start codon. Finally, an inverted
repeat is found in the region between hbpA and
hbpB (Fig. 2A). This could encode a rho-independent
transcription termination site.
|
The hbpA gene is present in various T. denticola strains, but not in T. pectinovorum, T. socranskii, or E. coli. Since Scott et al. (45) detected a 47-kDa hemin binding protein, but not a 44-kDa protein, in another strain of T. denticola, it was of interest to determine if the hbpA gene was present in various strains of T. denticola or in other oral spirochetes. Therefore, Southern blot analysis was performed on genomic DNA isolated from six different T. denticola strains, including ATCC 35405, which is the strain that was used by Scott et al. (45), and ATCC 33520, which is the strain being sequenced by The Institute for Genomic Research. In addition, DNAs from the oral treponemes T. pectinovorum and T. socranskii were examined. Using a probe from the first third of the hbpA gene, all of the T. denticola strains gave a 333-bp band when cut with HindIII (data not shown). This is the size expected from the sequence analysis of strain ATCC 35404. The T. pectinovorum, T. socranskii, and E. coli DNAs did not hybridize to the hbpA probe. To see if the gene organization around hbpA was also conserved among the T. denticola strains, the same filter was hybridized with orf1- and hbpB-specific probes. All of the T. denticola strains had a 2.9-kb band with the orf1 probe and a 2.3-kb band with the hbpB probe, while T. pectinovorum, T. socranskii, and E. coli gave no signal with either probe (data not shown). These results indicate that all of the strains of T. denticola tested, including the one used by Scott et al. in identifying a 47-kDa hemin binding protein, have the hbpA gene and that the gene organization around hbpA is identical in all T. denticola strains. This conclusion was reinforced by a search of the preliminary T. denticola genome sequence at The Institute for Genomic Research. One contig contained most of hbpA and all of hbpB, and the sequence from strain ATCC 33520 differed from our sequence at five bases in hbpA and four bases in hbpB. These base changes led to only two amino acid changes in HbpA and two in HbpB.
The hbpA gene has two transcripts which are low-iron
induced.
Bacterial genes are often organized in operons that are
involved in the same metabolic or regulatory pathways. To see if
hbpA is part of an operon, especially with hbpB,
RNA from T. denticola was analyzed by Northern blotting.
Total RNA was isolated from bacteria growing either in GM-1 medium or
in GM-1 medium with 200 µM BPD to see if the hbpA RNA,
like the protein, was induced under iron-restrictive growth conditions.
Two hbpA transcripts were seen: a 1.3-kb band and a less
intense 2.6-kb RNA species (Fig. 3B).
Both transcripts must be from the hbpA gene, since Southern
blot analyses with multiple restriction endonucleases and the same
hybridization probe demonstrated that hbpA is a single-copy gene (data not shown). The 1.3-kb RNA was only 100 bases larger than
the size of the hbpA ORF, thus indicating that the major hbpA transcript is monocistronic. However, the presence of
the less intense 2.6-kb transcript indicated that hbpA was
also cotranscribed with another gene(s). To determine which adjacent
gene, orf1 or hbpB, was part of the
hbpA operon, Northern blots were also hybridized with
hbpB and orf1 probes. The orf1 probe
did not hybridize with a 2.6-kb transcript (data not shown). However,
the hbpB probe did hybridize with a 2.6-kb band (Fig. 3C),
indicating that hbpA is cotranscribed with hbpB.
Since bacterial RNA is relatively unstable, the Northern blotting
results were confirmed by reverse transcription-PCR using
oligonucleotide pairs that would produce PCR products if an RNA were
transcribed across the orf1-hbpA, hbpA-hbpB, or hbpB-orf4
coding region junctions. Only the hbpA-hbpB oligonucleotide pair gave a product in the reverse transcription-PCRs (data not shown), demonstrating that only hbpA and
hbpB are cotranscribed. The hbpB probe also
hybridized with a 1.8-kb RNA species in Northern blot analyses (Fig.
3C), suggesting that it too can be transcribed monocistronically.
Interestingly, all three hbpA and hbpB RNA species are induced at least 10-fold in RNA from cells grown under iron-restrictive conditions. This strongly suggests that the iron regulation of the 44-kDa HbpA protein and the HbpB protein is at the
level of transcription or RNA stability.
|
Purified rHbpA shows hemin binding ability in LDS-PAGE with TMBZ
staining.
To facilitate the purification and characterization of
the HbpA protein, the entire hbpA gene was reconstructed in
one plasmid, pSH5 (Fig. 1). E. coli transformants carrying
pSH5 grew more slowly than E. coli with vector alone,
suggesting that production of the HbpA protein was somewhat toxic to
E. coli. Consistent with this finding, HbpA did not appear
to be overproduced in E. coli; when proteins from E. coli cells carrying pSH5 were compared to proteins from E. coli with vector alone on stained gels, rHbpA was not detected
(data not shown). However, the HbpA protein is made in E. coli, since Western blot analysis of total protein from
pSH5-containing cells had a protein band with the same size as native
HbpA (Fig. 4A, lane 3). Mature rHbpA was
also found in culture supernatants of pSH5-containing E. coli cells (data not shown). Finally, there was also a faint band
at 27 kDa in the pSH5 sample. This could be a breakdown product of the
HbpA in E. coli or it could arise from mistranslation from
an internal ATG, of which there are several. Our results cannot
distinguish between these possibilities.
|
Fusion HbpB protein is expressed in E. coli and shows
hemin binding ability.
In order to determine if HbpB could bind
hemin, it was expressed as a fusion protein in E. coli. The
portion of the hbpB gene encoding the mature HbpB protein
was ligated into the expression vector pRsetA to generate plasmid pSH9
(Fig. 1) This construct should express a protein with a 36-amino-acid
polyhistidine-containing peptide fused to the amino terminus of the
HbpB protein. Indeed, pSH9 expressed a protein of the expected size as
determined by Western blot analysis with anti-His tag antibody (data
not shown). The HbpB protein also showed cross-reactivity with
anti-HbpA antibody in Western blotting because of the similarity of the
two proteins (Fig. 5A, lane 1). To assess
the hemin binding ability of HbpB, the cytosolic proteins from E. coli cells containing pSH9 and pRsetA were analyzed by LDS-PAGE
and TMBZ staining. The result shows that recombinant fusion HbpB can
bind hemin (Fig. 5B, lane 2).
|
| |
DISCUSSION |
|---|
|
|
|---|
The 44-kDa hemin binding protein (HbpA) from T. denticola has some properties in common with hemin binding receptors from other gram-negative bacteria. It is located in the outer membrane of the bacterium, it appears to have a signal peptide, and its expression is increased under iron-restricted growth conditions. However, the T. denticola HbpA is not homologous to any other hemin binding protein, nor does it share stretches of significant sequence identity with iron acquisition proteins from other bacteria. The inability to find a "hemin binding motif" in HbpA is not surprising, since no such motif has been identified in hemin binding proteins from other bacteria, despite the fact that most of the hemin binding proteins from other bacteria do show homology with each other. Thus, the 44-kDa OMP is a novel hemin binding protein, which is likely to serve as a hemin receptor for T. denticola.
Previous studies have shown that the hemin binding receptors in Yersinia enterocolitica, Haemophilus influenzae, and Shigella dysenteriae have a TonB box sequence at the amino terminus of the hemin receptor protein (21, 35, 36, 51). This protein motif is critical for the interaction of certain outer membrane receptors with the inner membrane protein TonB that provides the energy needed to carry out the uptake of specific substrates into the periplasmic space. Interestingly, there was no TonB sequence motif in either HbpA or HbpB from T. denticola. Thus, the mechanism used by HbpA and HbpB to get iron and hemin into the cell may be different. One possibility is that HbpA, HbpB, or both serve as the initial hemin receptor, which then passes off the molecule to another receptor which is TonB dependent. This second hemin receptor could be the previously identified 47-kDa OMP from T. denticola. Such a mechanism has been found in neisseria, where HpuA and HpuB are both hemoglobin receptors which act in a complex to internalize hemoglobin. In this case, only HpuB has a TonB box motif (28). Another possibility is that the hemin uptake system in T. denticola is unique and uses a non-TonB mechanism to provide the energy needed to internalize hemin and iron.
In bacteria, functionally related genes are often part of an operon. Sequence analysis of the region around the T. denticola hbpA gene revealed three adjacent ORFs, orf1, hbpB, and orf4. By Northern blot analysis, hbpB was shown to be part of an operon with hbpA, thus leading us to hypothesize that the HbpB protein has a role in hemin uptake by T. denticola. Indeed, HbpB binds hemin. Some other bacterial hemin uptake systems are encoded in operons. For example, in Y. enterocolitica, the hemin uptake operon contains four proteins: HemP, HemR, HemS, and HemT. HemR is the hemin receptor and its expression is regulated by iron. It has been proposed that HemT is involved in the transport of hemin into the cytoplasm, where it is degraded by HemS (52). However, hemin binding protein genes can also be transcribed monocistronically. For example, P. gingivalis hemR transcription is monocistronic (23). Finally, the cotranscribed hpuA and hpuB genes of Neisseria meningitidis are required as a coreceptor in the acquisition of iron from hemoglobin (27, 28). Mutant analysis is necessary to see if the T. denticola HbpA and HbpB proteins function in the same or parallel pathways in iron acquisition from hemin.
Some bacterial OMPs, such as the major OMP of T. denticola (10, 11), are toxic when overexpressed in E. coli and therefore their genes can be difficult to clone in certain vectors. For membrane proteins such as the major OMP from T. denticola, the toxic portion is usually the 5' region of gene, which encodes the signal peptide and N-terminal region of the protein; the toxicity may be due to the blockage of general protein transport. Apparently, the amino terminus of HbpA is also somewhat toxic when expressed in E. coli. The two clones, pSH3 and pSH5, that contained the amino terminus of HbpA only formed small colonies. The toxicity appears to be due to the amino terminus of HbpA, since it is the only common element in pSH3 and pSH5.
The transcription start sites have been determined for four genes in
T. denticola (13, 16, 24, 30), two of which
appear to use a
70-like promoter and two of which seem
to use a
28-like promoter. In the hbpA gene,
promoter prediction by the NNPP program indicates that there is a
possible
70-like promoter between nucleotides 811 and
841, about 18 nucleotides upstream of the HbpA translation start codon.
Sequence examination reveals a good
10 match in that region but a
poor match to the E. coli
35 consensus sequence. This is
very similar to the results for the T. denticola dmcA gene
promoter (24), although other T. denticola
promoter regions do have sequences that are very similar to both
components of the E. coli
70-like promoter
consensus (10, 12). At the other end of the hbpA gene, there is a stem-loop structure located 9 nucleotides downstream of the hbpA translation stop codon.
This structure fits the criteria for a rho-independent transcription
termination site (42). However, either the hbpA
transcription termination site is an inefficient site or there is an
antitermination mechanism in T. denticola, since the major
hbpA transcript also contains the downstream hbpB
gene. Finally, the hbpA and hbpB RNAs are induced
in cells growing under iron restriction. The low-iron induction of
transcription of hemin binding protein genes has been described in
several other systems (26, 35, 59, 60). In some cases,
transcriptional regulation by iron is due to Fur or DtxR proteins,
which act as iron-responsive DNA-binding repressor proteins (4,
17, 18, 27). Although the transcription of hbpA is
regulated by iron, we did not find any matches to the Fur or DtxR
consensus binding sequences in the hbpA promoter region. Thus, the mechanism for iron regulation of hbpA
transcription needs further study.
Different strains of T. denticola have different OMP profiles. The msp gene, which encodes the major OMP of T. denticola, differs between strains, although there are regions of strong identity among the msp genes from the different strains (11); by Southern blot analysis, there are at least two restriction fragment length polymorphism patterns around the msp gene among strains. The restriction fragment length polymorphism pattern around the hemolysin gene from T. denticola ATCC 35404 is different from that of the hemolysin gene from a clinical isolate, GM-1 (22). Similarly, Southern blot analyses revealed that the flanking regions of the aspartate carbamoyltransferase gene and cystalysin gene differ between strains (20) (L. Chu, unpublished data). All of these results indicate that the genomes of different strains of T. denticola often vary. Interestingly, the gene organization around the hbpA gene appears to be conserved among the T. denticola strains tested: all six strains tested hybridized to the exact same size of HindIII fragments containing orf1, hbpA, and hbpB. All of these results indicate that this cluster of genes is conserved in T. denticola and thus may have an important role in the cell. The functions of each of these three genes can now be examined by the gene disruption methodology developed by Li and Kuramitsu (29).
| |
ACKNOWLEDGMENTS |
|---|
We thank A. Burgum for technical assistance and J. Ebersole and L. Chu for helpful discussions.
This work was supported by grants DE11368 and DE11771 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Dr., San Antonio, TX 78229. Phone: (210) 567-3967. Fax: (210) 567-6612. E-mail: KOLODRUBETZ{at}uthscsa.edu.
Present address: Department of Periodontology, The Forsyth
Institute, Boston, MA 02115.
Editor: J. M. Mansfield
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[CrossRef][Medline]. |
| 2. | Armitage, G. C., W. R. Dickinson, R. S. Jenderseck, S. M. Levine, and D. W. Chambers. 1982. Relationship between the percentage of subgingival spirochetes and the severity of periodontal disease. J. Periodontal. 53:550-556. |
| 3. | Ausubel, F. M., R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology. Wiley Interscience, New York, N.Y. |
| 4. |
Bagg, A., and J. B. Neilands.
1987.
Molecular mechanism of regulation of siderophore-mediated iron assimilation.
Microbiol. Rev.
51:509-518 |
| 5. | Chu, L., A. Burgum, D. Kolodrubetz, and S. C. Holt. 1995. The 46-kilodalton-hemolysin gene from Treponema denticola encodes a novel hemolysin homologous to aminotransferases. Infect. Immun. 63:4448-4455[Abstract]. |
| 6. | Chu, L., and S. C. Holt. 1994. Purification and characterization of a 45 kDa hemolysin from Treponema denticola ATCC 35404. Microb. Pathog. 16:197-212[CrossRef][Medline]. |
| 7. | Chu, L., M. Song, and S. C. Holt. 1994. Effect of iron regulation on expression and hemin-binding function of outer-sheath proteins from Treponema denticola. Microb. Pathog. 16:321-335[CrossRef][Medline]. |
| 8. |
Fenno, J. C.,
P. M. Hannam,
W. K. Leung,
M. Tamura,
V. J. Uitto, and B. C. McBride.
1998.
Cytopathic effects of the major surface protein and the chymotrypsinlike protease of Treponema denticola.
Infect. Immun.
66:1869-1877 |
| 9. | Fenno, J. C., and B. C. McBride. 1998. Virulence factors of oral treponemes. Anaerobe 4:1-17. |
| 10. |
Fenno, J. C.,
K. H. Muller, and B. C. McBride.
1996.
Sequence analysis, expression, and binding activity of recombinant major outer sheath protein (Msp) of Treponema denticola.
J. Bacteriol.
178:2489-2497 |
| 11. |
Fenno, J. C.,
G. W. Wong,
P. M. Hannam,
K. H. Muller,
W. K. Leung, and B. C. McBride.
1997.
Conservation of msp, the gene encoding the major outer membrane protein of oral Treponema spp.
J. Bacteriol.
179:1082-1089 |
| 12. | Greene, S. R., and L. V. Stamm. 1997. Identification, sequence, and expression of Treponema denticola mcpA, a putative chemoreceptor gene. FEMS Microbiol. Lett. 157:245-249[CrossRef][Medline]. |
| 13. | Greene, S. R., and L. V. Stamm. 1999. Molecular characterization of a chemotaxis operon in the oral spirochete, Treponema denticola. Gene 232:59-68[CrossRef][Medline]. |
| 14. | Grenier, D. 1991. Characteristics of hemolytic and hemagglutinating activities of Treponema denticola. Oral Microbiol. Immunol. 6:246-249[Medline]. |
| 15. |
Griffiths, E.
1991.
Iron and bacterial virulence a brief overview.
Biol. Methods
4:7-13.
|
| 16. | Heinzerling, H. F., M. Olivares, and R. A. Burne. 1997. Genetic and transcriptional analysis of flgB flagellar operon constituents in the oral spirochete Treponema denticola and their heterologous expression in enteric bacteria. Infect. Immun. 65:2041-2051[Abstract]. |
| 17. | Hennecke, H. 1990. Regulation of bacterial gene expression by metal-protein complexes. Mol. Microbiol. 4:1621-1628[CrossRef][Medline]. |
| 18. | Holmes, R. K. 2000. Biology and molecular epidemiology of diphtheria toxin and the tox gene. J. Infect. Dis. 181(Suppl. 1):S156-S167. |
| 19. | Holt, S. C., L. Kesavalu, S. Walker, and C. A. Genco. 1999. Virulence factors of Porphyromonas gingivalis. Periodontol. 2000 20:168-238[Medline]. |
| 20. |
Ishihara, K.,
M. Ishihara,
I. Takazoe, and K. Okuda.
1992.
Cloning and expression of the aspartate carbamoyltransferase gene from Treponema denticola.
Appl. Environ. Microbiol.
58:3399-3403 |
| 21. |
Jarosik, G. P.,
J. D. Sanders,
L. D. Cope,
U. Muller-Eberhard, and E. J. Hansen.
1994.
A functional tonB gene is required for both utilization of heme and virulence expression by Haemophilus influenzae type b.
Infect. Immun.
62:2470-2477 |
| 22. | Karunakaran, T., and S. C. Holt. 1994. Cloning and expression of hemolysin genes from Treponema denticola strains ATCC 35404 (TD-4) and human clinical isolate GM-1 in Escherichia coli. Microb. Pathog. 16:337-348[CrossRef][Medline]. |
| 23. |
Karunakaran, T.,
T. Madden, and H. Kuramitsu.
1997.
Isolation and characterization of a hemin-regulated gene, hemR, from Porphyromonas gingivalis.
J. Bacteriol.
179:1898-1908 |
| 24. | Kataoka, M., H. Li, S. Arakawa, and H. Kuramitsu. 1997. Characterization of a methyl-accepting chemotaxis protein gene, dmcA, from the oral spirochete Treponema denticola. Infect. Immun. 65:4011-4016[Abstract]. |
| 25. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[CrossRef][Medline]. |
| 26. |
Lee, B. C.
1992.
Isolation of an outer membrane hemin-binding protein of Haemophilus influenzae type b.
Infect. Immun.
60:810-816 |
| 27. | Lewis, L. A., M. Gipson, K. Hartman, T. Ownbey, J. Vaughn, and D. W. Dyer. 1999. Phase variation of HpuAB and HmbR, two distinct haemoglobin receptors of Neisseria meningitidis DNM2. Mol. Microbiol. 32:977-989[CrossRef][Medline]. |
| 28. | Lewis, L. A., E. Gray, Y. P. Wang, B. A. Roe, and D. W. Dyer. 1997. Molecular characterization of hpuAB, the haemoglobin-haptoglobin-utilization operon of Neisseria meningitidis. Mol. Microbiol. 23:737-749[CrossRef][Medline]. |
| 29. | Li, H., and H. K. Kuramitsu. 1996. Development of a gene transfer system in Treponema denticola by electroporation. Oral Microbiol. Immunol. 11:161-165[Medline]. |
| 30. |
Limberger, R. J.,
L. L. Slivienski,
J. Izard, and W. A. Samsonoff.
1999.
Insertional inactivation of Treponema denticola tap1 results in a nonmotile mutant with elongated flagellar hooks.
J. Bacteriol.
181:3743-3750 |
| 31. |
Litwin, C. M., and S. B. Calderwood.
1993.
Role of iron in regulation of virulence genes.
Clin. Microbiol. Rev.
6:137-149 |
| 32. | Loesche, W. J. 1988. The role of spirochetes in periodontal disease. Adv. Dent. Res. 2:275-283[Abstract]. |
| 33. | Makinen, K. K., C. Y. Chen, and P. L. Makinen. 1996. Proline iminopeptidase from the outer cell envelope of the human oral spirochete Treponema denticola ATCC 35405. Infect. Immun. 64:702-708[Abstract]. |
| 34. |
Masuda, K., and T. Kawata.
1982.
Isolation, properties, and reassembly of outer sheath carrying a polygonal array from an oral treponeme.
J. Bacteriol.
150:1405-1413 |
| 35. |
Mills, M., and S. M. Payne.
1995.
Genetics and regulation of heme iron transport in Shigella dysenteriae and detection of an analogous system in Escherichia coli O157:H7.
J. Bacteriol.
177:3004-3009 |
| 36. | Mills, M., and S. M. Payne. 1997. Identification of shuA, the gene encoding the heme receptor of Shigella dysenteriae, and analysis of invasion and intracellular multiplication of a shuA mutant. Infect. Immun. 65:5358-5363[Abstract]. |
| 37. | Moeck, G. S., and J. W. Coulton. 1998. TonB-dependent iron acquisition: mechanisms of siderophore-mediated active transport. Mol. Microbiol. 28:675-681[CrossRef][Medline]. |
| 38. | Otto, B. R., A. M. Verweij-van Vught, and D. M. MacLaren. 1992. Transferrins and heme-compounds as iron sources for pathogenic bacteria. Crit. Rev. Microbiol. 18:217-233[Medline]. |
| 39. | Pettersson, A., J. T. Poolman, L. P. van der, and J. Tommassen. 1997. Response of Neisseria meningitidis to iron limitation. Antonie Leeuwenhoek 71:129-136[CrossRef][Medline]. |
| 40. |
Pidcock, K. A.,
J. A. Wooten,
B. A. Daley, and T. L. Stull.
1988.
Iron acquisition by Haemophilus influenzae.
Infect. Immun.
56:721-725 |
| 41. | Reese, M. G., N. L. Harris, and F. H. Eechman. 1996. Large scale sequencing specific neural networks for promoter and splice site recognition. In L. Hunter, and T. Klein (ed.), Proceedings of the Pacific Symposium on Biocomputing, 1996. Klein, Kona, Hawaii. |
| 42. | Richardson, J. P., and J. Greenblatt. 1996. Control of RNA chain elongation and termination, p. 822-843. In F. C. Neidhardt (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, D.C. |
| 43. | Schryvers, A. B., and I. Stojiljkovic. 1999. Iron acquisition systems in the pathogenic Neisseria. Mol. Microbiol. 32:1117-1123[CrossRef][Medline]. |
| 44. | Scott, D., E. C. Chan, and R. Siboo. 1996. Iron acquisition by oral hemolytic spirochetes: isolation of a hemin-binding protein and identification of iron reductase activity. Can. J. Microbiol. 42:1072-1079[Medline]. |
| 45. | Scott, D., I. R. Siboo, E. C. Chan, A. Klitorinos, and R. Siboo. 1993. Binding of hemin and Congo red by oral hemolytic spirochetes. Oral Microbiol. Immunol. 8:245-250[Medline]. |
| 46. | Shenker, B. J., M. A. Listgarten, and N. S. Taichman. 1984. Suppression of human lymphocyte responses by oral spirochetes: a monocyte-dependent phenomenon. J. Immunol. 132:2039-2045[Abstract]. |
| 47. | Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 48. |
Simonson, L. G.,
C. H. Goodman,
J. J. Bial, and H. E. Morton.
1988.
Quantitative relationship of Treponema denticola to severity of periodontal disease.
Infect. Immun.
56:726-728 |
| 49. | Smibert, R. M. 1984. Order I. Spirochaetales, p. 49-57. In N. R. Krieg, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 1. The Williams & Wilkins Co., Baltimore, Md. |
| 50. | Staggs, T. M., M. K. Greer, J. B. Baseman, S. C. Holt, and V. V. Tryon. 1994. Identification of lactoferrin-binding proteins from Treponema pallidum subspecies pallidum and Treponema denticola. Mol. Microbiol. 12:613-619[CrossRef][Medline]. |
| 51. | Stojiljkovic, I., and K. Hantke. 1992. Hemin uptake system of Yersinia enterocolitica: similarities with other TonB-dependent systems in gram-negative bacteria. EMBO J. 11:4359-4367[Medline]. |
| 52. | Stojiljkovic, I., and K. Hantke. 1994. Transport of haemin across the cytoplasmic membrane through a haemin-specific periplasmic binding-protein-dependent transport system in Yersinia enterocolitica. Mol. Microbiol. 13:719-732[Medline]. |
| 53. |
Stugard, C. E.,
P. A. Daskaleros, and S. M. Payne.
1989.
A 101-kilodalton heme-binding protein associated with Congo red binding and virulence of Shigella flexneri and enteroinvasive Escherichia coli strains.
Infect. Immun.
57:3534-3539 |
| 54. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 55. | Uitto, V. J., Y. M. Pan, W. K. Leung, H. Larjava, R. P. Ellen, B. B. Finlay, and B. C. McBride. 1995. Cytopathic effects of Treponema denticola chymotrypsin-like proteinase on migrating and stratified epithelial cells. Infect. Immun. 63:3401-3410[Abstract]. |
| 56. |
Weinberg, A., and S. C. Holt.
1990.
Interaction of Treponema denticola TD-4, GM-1, and MS25 with human gingival fibroblasts.
Infect. Immun.
58:1720-1729 |
| 57. |
Weinberg, E. D.
1978.
Iron and infection.
Microbiol. Rev.
42:45-66 |
| 58. | Wooldridge, K. G., and P. H. Williams. 1993. Iron uptake mechanisms of pathogenic bacteria. FEMS Microbiol. Rev. 12:325-348[CrossRef][Medline]. |
| 59. | Worst, D. J., B. R. Otto, and J. de Graaff. 1995. Iron-repressible outer membrane proteins of Helicobacter pylori involved in heme uptake. Infect. Immun. 63:4161-4165[Abstract]. |
| 60. | Yamamoto, S., Y. Hara, K. Tomochika, and S. Shinoda. 1995. Utilization of hemin and hemoglobin as iron sources by Vibrio parahaemolyticus and identification of an iron-repressible hemin-binding protein. FEMS Microbiol. Lett. 128:195-200[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|