Previous Article | Next Article 
Infection and Immunity, July 2001, p. 4627-4638, Vol. 69, No. 7
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.7.4627-4638.2001
Complete DNA Sequence of Yersinia
enterocolitica Serotype 0:8 Low-Calcium-Response Plasmid
Reveals a New Virulence Plasmid-Associated Replicon
Norma J.
Snellings,*
Michael
Popek, and
Luther E.
Lindler
Department of Bacterial Diseases, Division of
Communicable Diseases and Immunology, Walter Reed Army Institute of
Research, Silver Spring, Maryland 20910-7500
Received 28 December 2000/Returned for modification 14 March
2001/Accepted 18 April 2001
 |
ABSTRACT |
The complete nucleotide sequence and organization of the
Yersinia enterocolitica serotype 0:8
low-calcium-response (LCR) plasmid, pYVe8081, were determined. The
67,720-bp plasmid encoded all the genes known to be part of the LCR
stimulon except for ylpA. Eight of 13 intact open
reading frames of unknown function identified in pYVe8081 had
homologues in Yersinia pestis plasmid pCD1 or in
Y. enterocolitica serotype 0:9 plasmid pYVe227.
A region of approximately 17 kbp showed no DNA identity to pCD1 or
pYVe227 and contained six potential new genes, a possible new replicon, and two intact insertion sequence (IS) elements. One intact IS element,
ISYen1, was a new IS belonging to the
IS256 family. Several vestigial IS elements appeared
different from the IS distribution seen in the other LCR plasmids. The
RepA proteins encoded by Y. enterocolitica
serotype 0:8 pYVeWA and pYVe8081 were identical. The putative
pYVe8081 replicon showed significant homology to the IncL/M replicon of
pMU407.1 but was only distantly related to the replicons of pCD1 and
pYVe227. In contrast, the putative partitioning genes of pYVe8081
showed 97% DNA identity to the spy/sopABC loci
of pCD1 and pYVe227. Sequence analysis suggests that
Yersinia LCR plasmids are from a common ancestor but
that Y. enterocolitica serotype 0:8 plasmid replicons
may have evolved independently via cointegrate formation following a
transposition event. The change in replicon structure is predicted to
change the incompatibility properties of Y.
enterocolitica serotype 0:8 plasmids from those of Y.
enterocolitica serotype 0:9 and Y. pestis LCR plasmids.
 |
INTRODUCTION |
Pathogenic Yersinia
enterocolitica is a well-established food-borne pathogen
(29). Infection usually results in a self-limiting gastroenteritis, but in immunocompromised individuals septicemia and hepatic abscesses may occur. Postinfection complications include arthritis and erythema nodosum (8). Y. enterocolitica is a serologically diverse species that includes
saprophytes as well as pathogens. Certain serotypes are consistently
associated with human infection (30). Serotypes 0:3
and 0:9 are most frequently isolated in Europe, Japan, and
Canada, while serotype 0:8 causes most infections in the United
States. Serotype 0:8 is also associated with more severe invasive
disease (3, 5). So far, only one phenotypic trait has been
identified in Y. enterocolitica 0:8 to account for these
observed differences in pathogenicity (37).
Essential virulence genes are carried on a ca.-70-kb plasmid in
Y. enterocolitica, Yersinia pestis, and
Yersinia pseudotuberculosis (42, 43). The
virulence plasmid encodes virulence proteins called Yops
(Yersinia outer proteins), a type III secretion system, the
V antigen, and regulatory proteins. The virulence plasmid encodes the
low-calcium response (LCR) (53), which refers to a complex
response to in vitro growth conditions of temperature (37°C) and
extracellular calcium concentration (less than 2.5 mM
Ca2+). Under these conditions, pathogenic
Yersinia shifts from vegetative growth to the production and
secretion of virulence proteins. In vitro conditions probably mimic a
signal in the mammalian host where the LCR results in paralysis of
defenses at the site of infection and extreme suppression of
cell-mediated immunity (6). Collectively, plasmid genes
turned on by the LCR comprise the LCR stimulon (38, 52).
The LCR plasmids in Yersinia spp. are structurally, as well
as functionally, related. Yop secretion involves 28 genes at four adjacent loci, virA, virB, virG, and virC. The
virA locus consists of seven genes: yopN, tyeA, sycN,
yscXY, lcrD/yscV, and lcrR. The virB operon
is comprised of eight genes (yscN to yscU), and the virC operon contains 13 genes, yscA to
yscM. virG (yscW in Y. pestis
[39]) is a small monocistronic gene located between virB and the transcriptional regulator virF.
Contiguous with virA is the lcrGVsycDyopBD
operon, which is involved in translocation of Yops (21).
The lcrV gene in this operon encodes the V antigen that is
required for virulence. These genes form a contiguous cluster in all
Yersinia LCR plasmids. Other effector genes (yopM, yopT, yopQ, yopP, yopO, yopE, and yopH) and their
corresponding chaperones (sycT, sycE, and sycH)
flank the main cluster.
Only virF, sycE, yopE, and yadA have been
sequenced from Y. enterocolitica 8081 serotype 0:8. The
predicted products of yopE, sycE, and virF are at
least 95% identical to homologous proteins produced by the other
pathogenic Yersinia strains. However, YadA encoded by
Y. enterocolitica 8081 shows only 81% identity to YadA encoded by Y. enterocolitica serotype 0:9. Based on the
results of DNA cross-hybridization studies, plasmids from Y. enterocolitica serogroups 0:9, 0:3, and 0:5 show 90% nucleotide
identity with one another but share only 75% DNA identity with
plasmids from Y. enterocolitica serogroup 0:8
(19). Plasmids from Y. enterocolitica serotype
0:8 show 55% nucleotide identity with the virulence plasmids from
Y. pestis and Y. pseudotuberculosis
(43). Taken together, these facts suggest that the LCR
stimulon evolved as a cluster but that other parts of the LCR plasmid
were able to evolve independently.
Recently, the LCR plasmids from Y. pestis (designated
pCD1) and Y. enterocolitica serotype 0:9 (designated
pYVe227) have been sequenced and analyzed. These comparative studies
have provided useful clues to the evolution of these plasmids that are
critical for virulence of members of the genus Yersinia and
as well have aided in the identification of potential new virulence
determinants (20, 21, 39). In this paper, we describe the
nucleotide sequence of Y. enterocolitica serotype 0:8 LCR
plasmid pYVe8081 and its relationship to the other known
Yersinia LCR plasmids. Our analysis has revealed a potential
new replicon and has increased our knowledge pertaining to the
evolution of this important virulence determinant.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
Y. enterocolitica
8081 (serotype 0:8) was used for the isolation of the pYVe8081 plasmid.
Y. enterocolitica WA (serotype 0:8) was obtained from Peter
Feng, Food and Drug Administration, Washington, D.C. Y. enterocolitica 8081 was obtained from two sources, Virginia Miller
at Washington University, St. Louis, Mo., and Peter Feng.
Library construction, sequencing, and PCR.
Plasmid DNA was
prepared from bacteria using a plasmid isolation kit (Qiagen, Santa
Clarita, Calif.) according to the manufacturer's specifications.
Y. enterocolitica was cultured in brain heart infusion broth
(BD Biosciences, San Jose, Calif.) at 30°C. Plasmid DNA was extracted
from Escherichia coli containing libraries of cloned
pYVe8081 restriction fragments after the strains were grown overnight
at 37°C in Luria broth (47). Separate libraries were prepared from ApoI-, BamHI-,
HindIII-, and EcoRI-digested pYVe8081 DNA in
vector pSK+ (Stratagene, La Jolla, Calif.) as described elsewhere
(47). DNA templates were purified from random library clones and sequenced using Prism dye terminator (FS) labeled
fluorescent cycle sequencing kits (Applied Biosystems, Foster City,
Calif.) and an ABI 377XL automated sequencer (Applied Biosystems).
Sequences were edited and assembled using Sequencher 3.0 software (Gene Codes Corp., Ann Arbor, Mich.). Gaps between contiguous sequences were
amplified by PCR using the original plasmid DNA as template followed by
sequencing of the PCR products. PCRs were performed with Hot Tub DNA
polymerase (Amersham Corp., Arlington Heights, Ill.) following
optimization of PCR conditions using the PCR Optimizer kit (Invitrogen,
Carlsbad, Calif.). A ca.-10.5-kbp DNA segment located between
yadA and yopO (see Fig. 1) was PCR amplified
using the Expand Long Template PCR system (Roche Molecular
Biochemicals, Indianapolis, Ind.) and sequenced by Fred Blattner's
group (University of Wisconsin, Madison). Sequencing of the
ca.-10.5-kbp PCR fragment was performed by random shearing and cloning
as previously described (4, 26). In all cases,
disagreements between our results and those of other laboratories were
analyzed by PCR amplification and sequencing of the resultant products.
Final assembly was confirmed by PCR amplification and restriction
enzyme digestion of pYVe8081 to ensure accuracy of our assembly. The
putative repA gene in Y. enterocolitica WA
(serotype 0:8) was PCR amplified using forward primer
CCGCCCAAAATGAGTGTG, located upstream from repA in
pYVe8081, and reverse primer GGTTAGGAATACTTTGCGGC, located
downstream from repA in pYVe8081. The PCR product was
purified with QIAquick PCR purification columns (Qiagen) to remove the
primers and then sequenced, as described above.
Sequence analysis.
Open reading frames (ORFs) capable of
encoding peptides at least 50 amino acids long were identified using
Sequencher 3.0, DNAStar (Lasergene, Madison, Wis.), and ORF Finder from
the National Center for Biotechnology Information
(www.ncbi.nlm.nih.gov/gorf/gorf.html). In the absence of a significant
homologue included in GenBank, the start codon giving the longest ORF
was used. Putative ORFs were then selected by a combination of GenBank
matches using BLASTX (1) and the presence of a potential
ribosome-binding site (59). We searched for protein
function identification using the ISREC Profile Scan Server
(www.isrec.isb-sib.ch/software/PFSCAN_form.html) and eMOTIF Search
(dna.Stanford.EDU/identify/).
Nucleotide sequence accession number.
The annotated sequence
was deposited in GenBank under accession no. AF336309, AY026194, and
AY026195.
 |
RESULTS AND DISCUSSION |
Molecular arrangement of pYVe8081.
The entire circular DNA
sequence of pYVe8081 was 67,720 bp in length and was similar to the
previously determined size of 66,000 bp (41). Significant
ORFs, sites, and insertion sequence (IS) elements are shown in Fig.
1 and summarized in Table
1. All of the previously identified
virulence-associated genes were present in pYVe8081 except for
ylpA, which is expressed only in pYVe227 (20, 21,
39). The virABC loci and the lcrGVH-yopBD operon showed 98 to 99% nucleotide identity to these loci in pCD1 and
pYVe227; virG and virF were 97 to 98% identical
in all three plasmids.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 1.
Map of pYVe8081 showing significant genes, IS elements,
and replication and partition regions. The direction of transcription
is clockwise for genes shown inside the circle and counterclockwise for
genes shown outside the circle. Green boxes indicate genes comprising
the LCR stimulon, and a purple box indicates yadA.
Yellow boxes indicate genes with replication and partition functions.
Pink boxes indicate previously identified genes of unknown function,
and potential new genes are indicated by light blue boxes. IS elements
are indicated by dark blue boxes. IS remnants shown in this figure are
discussed in the text. IS-like indicates IS element remnants with less
than 90% DNA identity to the GenBank match. ISYen-p is
a truncated homologue of ISYen1. The positions of the
virB operon (yscN to yscU)
and the virC operon (yscA to
yscM1) are noted in boldface on the outside of the
circle. The inner circle shows the scale in kilobase pairs.
|
|
A comparison of the plasmid maps of pCD1, pYVe227, and pYVe8081
revealed a similar organization of shared genes (Fig.
2).
The following differences between
pYVe227 and pYVe8081 are notable.
yscM2 is located between
yadA and the partition region (
spyABC)
in pYVe227
but was located upstream from
yopP in pYVe8081. A block
of
inserted DNA containing putative replication genes flanked
by IS-like
elements in pYVe8081 interrupted the sequence between
yopP
and
yopQ encoded by pYVe227. This inserted DNA replaced the
ylpA gene encoded by pYVe227. Also, the orientation of the
yomA/
yadA genes and the
yopM gene was
reversed in pYVe8081.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of LCR plasmid maps of pYVe8081, pYVe227, and
pCD1. Only representative genes are shown, to facilitate orientation.
The maps of pYVe227 (21) and pCD1 (39) are
redrawn. Arrows outside the circles indicate the direction of
transcription. YadA' indicates the yadA pseudogene in
pCD1, and Tn2502 is the arsenic resistance transposon in
pYVe227. Regions in pCD1 involved in the inversions referred to in the
text are shown in gray and numbered. The dots represent GTATT direct
repeats in pYVe8081, pYVe227, and pCD1.
|
|
Gross differences in the organization of pCD1 and the other two
plasmids result from the inversion of at least two regions
(
20,
21,
39). One region in pCD1 extends from the beginning
of
sopA to the end of
sycH (shown as region III on
the pCD1 map
in Fig.
2). The other inverted region in pCD1 starts with
the
ylpA pseudogene and continues to the beginning of
yopH (regions
II and I in Fig.
2). The absence of mobile
genetic elements near
the
yopH end of the
ylpA-to-
yopH region makes it difficult to
explain
how this segment may have inverted (
21). Our comparison
of
LCR plasmid sequences suggests the possibility of a third inversion
(region I in Fig.
2) that could explain the current orientation
of the
Yop gene cluster found on the
Y. enterocolitica
plasmids.
Inversion of region I in pCD1 could have resulted from
IS-promoted
recombination near the
yopH region.
Specifically, Perry et al.
(
39) found a copy of
IS
100 near
yopH on pCD1. As a consequence
of this
possible inversion,
yopH and
yscM would be next
to each
other and oriented in the same direction. If this event was
followed
by the inversion of the segment encompassing regions I and II,
the orientation of the Yop gene cluster in pCD1 would be similar
to
that seen now in the
Y. enterocolitica plasmids. As further
support of mobile gene activity in this region, we found short
direct
repeats (GTATT) that may be vestiges of illegitimate recombination
events in the ancestral LCR plasmid. In pCD1, two copies of this
repeat
are located just upstream of
yopH and downstream of
yscM (shown as dots flanking region I in Fig.
2). In
contrast,
Y. enterocolitica pYVe8081 and pYVe227 each have a
single copy of the identical
sequence between
yopH and
yscM. Although we cannot be certain
of the molecular events
that led to the current architecture seen
in these three LCR plasmids,
it is obvious from DNA sequence analysis
that multiple mobile genetic
events have participated in the construction
of this virulence gene
cluster.
The molecular arrangement of pYVe8081 in the region between
sycT and
yopD was significantly different from
that of both pYVe227
and pCD1 (Fig.
3).
The
sycT-to-
yopD region was located on the
opposite side of the Yop gene cluster in both
Y. enterocolitica plasmids compared to the
Y. pestis
plasmid (Fig.
2) (
21,
39).
The
yopM locus was
transcribed in the same direction in pYVe8081,
pCD1, and
Y. pseudotuberculosis plasmid pIB1 but transcribed in
the
opposite direction in pYVe227. In addition, homologues of
pCD1
(
39) and pYVe227 (
21) genes encoded by
pYVe8081 were
disrupted by these rearrangements. Specifically, pYVe8081
contained
only remnants of the intact IS
1636 located in the
sycT-to-
yopD region of pYVe227, as well as
remnants of
orf54,
orf60, and
orf61 identified in the same region on pCD1 (Fig.
3). These genetic
rearrangements have resulted in size variation of the
sycT-to-
yopD region in all three plasmids.
Iriarte and Cornelis noted rearrangements
in this region between pCD1
and pYVe227 (
21). They proposed
that homologous exchange
between long repeats could account for
these differences. Despite these
changes, the
sycT-to-
yopD region
of pYVe8081
retained approximately 95% nucleotide identity with
the homologous
segments encoded by pCD1 and pYVe227.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of the sycT-yopD region in
pYVe8081 to corresponding regions in pYVe227 and pCD1. The different
colors represent different DNA segments. White segments are not present
in pYVe8081. Arrows under the plasmid maps show the orientation of DNA
segments. Numbers indicate nucleotide positions in base pairs for
each plasmid. Sequences of pYVe227 and pCD1 are from the GenBank
database (accession no. AF102990 and AF074612,
respectively). Remnants orf61*,
orf60*, and orf54* are truncated ORFs in
pYVe8081 that show homology to intact genes (orf61,
orf60, and orf54) in pCD1. Genes encoding YopM
and ORF91B are also labeled. Arrows within genes show the direction of
transcription. White arrows indicate the positions of the long repeated
sequences R1, R2, and R3, referred to in the text. Only intact IS
elements are shown.
|
|
In contrast, two regions of pYVe8081 showed no DNA homology to either
pCD1 or pYVe227. One region of approximately 7 kbp extended
upstream
from
yadA to
orf155, and the other region of
approximately
10 kbp extended downstream from
yscM2 to
yopQ. These two areas
contained six potential new genes, a
possible new replicon, two
intact IS elements, and a number of
vestigial IS elements (Fig.
1).
The translated products of most virulence-associated genes in pYVe8081
showed at least 92% identity to corresponding proteins
encoded by
pCD1, pIB1, and pYVe227. However, the pYVe8081-encoded
yscP
gene product was only 78% identical to its homologue from
pYVe227.
YscP encoded by pYVe8081 was 60 amino acids shorter (
51).
The absent amino acids form a tandem duplication of amino acid
residues
261 to 320 in the
Y. enterocolitica 0:9 YscP protein.
The
duplicated amino acids are also missing from the predicted
YscP
proteins produced by
Y. pseudotuberculosis and
Y. pestis (
36). Thus, YscP encoded by pYVe8081 was more
closely related
to those of
Y. pestis and
Y. pseudotuberculosis than to that of
Y. enterocolitica
0:9. The only other identity less than 92% that
we noted between the
predicted protein sequences of any of the
LCR stimulon-encoded proteins
was within YopM. The difference
in YopM was due in part to a difference
in the number of internal
leucine-rich repeats (LRR). YopM from both
pYVe8081 and pYVe227
is 367 amino acids long and contains 13 LRRs
compared to the 15
LRRs encoded by the pCD1 allele. As a result, the
Y. pestis protein
is 409 amino acids long and shows 81%
identity with pYVe8081
YopM.
Putative ORFs of unknown function in pYVe8081.
Consistent with
the strong relatedness shown by the Yop stimulon genes, putative ORFs
of unknown function located between yopQ and yadA
in pYVe8081 had homologues in pCD1 or pYVe227 (Fig. 1; Table
2). Outside this region,
orf155 (bp 55745 to 57934) was homologous to previously
identified potential syc genes located upstream from
yopO in pIB1, pCD1, and pYVe227 (15, 21, 39). Located between IS remnants downstream from yscM2,
orf106 encoded a putative inner membrane protein which
belongs to the phospholipase D superfamily (40). ORF106
was 43% identical (63% similar) over a 123-amino-acid span with a
162-amino-acid-long putative endonuclease in Y. pestis pMT1
(24) and 41% identical over an 82-amino-acid span with a
180-amino-acid-long endonuclease in pYVe227 (21). ORF181,
ORF91A, ORF156, and PprA, previously identified in pYVe227 (21), were not encoded by pYVe8081. ORF5, ORF84, and
ORF85, previously identified in pCD1 (39), were not
encoded by pYVe8081.
The region between
yadA and
yopO contained five
potential genes not found in pCD1 or pYVe227 (Fig.
1; Table
2). The
translated
product of the largest gene,
orf81 (bp 52048 to
52782), was 244
amino acids long and was 50% identical over 99% of a
probable
site-specific recombinase encoded by the F plasmid (accession
no.
AP001918). A search of the pFam database revealed that
ORF81
belongs to the phage integrase family of recombinases. Members
include
bacteriophage enzymes responsible for the integration
of linear DNA
into a host genome (
18,
23).
orf79 could encode
a 211-amino-acid-long partition protein, since it was 26% identical
over the entire length of an
Actinobacillus
actinomycetemcomitans partition protein. The
Actinobacillus protein is a Walker-type
ATPase from a type
1B partition locus. Type 1B partition loci
are found in gram-positive
and gram-negative bacteria (
16).
The finding of a remnant
of a broad-host-range plasmid, specifically
a protein associated with
partitioning, suggests that pYVe8081
may have been generated by
cointegration of distinct plasmids
during its
evolution.
IS elements.
Whole or partial IS elements, which represented
seven IS element families (25), occupied 16% of the
pYVe8081 plasmid (Table 3). In pCD1 and
pYVe227, intact IS elements and most remnants belong to the
IS3 family (21, 39). We considered IS-like
sequences to be identical to previously identified IS elements if they
showed greater than 90% nucleic acid identity or greater than 95%
transposase (Tpase) amino acid identity according to the classification
scheme of Mahillon and Chandler (25). The remaining
remnants were named after the Tpase giving the highest GenBank match at
the amino acid level.
Two IS elements in pYVe8081 were intact and therefore likely to be
functional. We located an intact copy of IS
1541C adjacent
to
the replication region (bp 65189 to 65896) in pYVe8081. The
IS
1541C element on the pYVe8081 plasmid was identical in
size
and sequence to IS
1541C recently described but not
mapped in
Y. enterocolitica 8081 (
12).
IS
1541C shows 94% DNA sequence identity
to
IS
1541 located on the
Y. pestis chromosome
and on plasmid pMT1
and to isoforms IS
1541A and
IS
1541B from
Y. pseudotuberculosis,
but only 85%
DNA sequence identity to IS
1541D from
Y. enterocolitica 8081. We predict that IS
1541D is located
on the
Y. enterocolitica chromosome, since no copies of it
were found on
Y. enterocolitica plasmids sequenced so
far.
IS
Yen1 was a new 1,295-bp IS element located between
yadA and
yopO at bp 49547 to 50841. We designated
this new element IS
Yen1 according to the nomenclature
proposed by Mahillon and Chandler
(
25). We found
32-bp-long imperfect inverted repeats at both
ends of
IS
Yen1. The element was also flanked by 9-bp direct repeats
that could have resulted from duplication of a target sequence
at the
site of insertion during transposition. We found a potential
Shine-Dalgarno sequence and start codon,
AGGAN
7ATG, and a single
ORF capable of
encoding a 400-amino-acid long Tpase. The putative
Tpase is a member of
the transpo-mutator family of proteins, which
includes the mutator
element from maize (
13). Tpases of the
transpo-mutator
protein family belong to the IS
256 IS family
(
25).
The IS
Yen1 Tpase showed 48% amino acid
sequence identity over
92% of a Tpase from
Y. pestis pMT1
(
24) and 45% identity over
98% of IS
Rm3 from
Rhizobium meliloti (
61). The family shows
an
overall amino acid similarity of 22 to 44% across dissimilar
genera,
suggesting a common ancestor (
25). However, members
have
also adapted to the G+C contents of their host species with
a
corresponding loss of nucleotide homology among family members.
The
group is of interest from an evolutionary standpoint because
some of
its members are highly mobile and therefore likely contributors
to
genome structure and evolution. Support for a common ancestor
of these
elements was also found in the sequence of the terminal
inverted
repeats in IS
Yen1, which were 53 to 63% identical to
terminal repeats from IS
285 (
46),
IS
Rm3, IS
1132 (accession no.
P35879), and
IS
1356 (
57).
Evidence for the mobile nature of IS
Yen1 was obtained
through sequence analysis. We found two disrupted elements homologous
to IS
Yen1 on the plasmid. One remnant, located downstream
from
yscM2 (bp 61626 to 61012), was identical in nucleotide
sequence
to IS
Yen1 beginning with 8 bp of the direct repeat
and including
the left inverted repeat and the first 558 bp of the
Tpase. The
other remnant (bp 7042 to 7717) was 676 bp long and showed
82%
nucleotide identity to IS
Yen1. Other IS elements in
pYVe8081 are
not likely to function, since their DNA sequences were
either
truncated at one or both ends or interrupted by the insertion
of
other IS elements or by deletions. The presence of many IS
elements in
a state of evolutionary decay in pYVe8081 suggests
a history of gene
transfer between this plasmid and plasmids from
other strains and
species as well as the chromosome. For example,
a tandem duplication of
IS
4-like elements occupied 2.2 kbp upstream
from
IS
1541C and showed 83% nucleotide identity over the entire
length of IS
4 (
22). The presence of
IS
4-like elements is unique
to pYVe8081 among LCR plasmids.
Although the mobile genetic events
that led to the accumulation of
these remnants of IS elements
cannot be determined, it is interesting
that similar regions have
been identified on other virulence plasmids
(
24).
We found a reverse transcriptase-like gene (bp 40239 to 40799) with
93% nucleotide identity over 37% of the enteropathogenic
E. coli intA gene (
56) and 92% nucleotide
identity over 24%
of the
Shigella flexneri sfiA gene
(
55). Both
intA and
sfiA are group
II intron-like sequences that encode reverse transcriptase-like
proteins found within the introns of plants, fungi, and bacteria
(
45,
56). The enteropathogenic
E. coli
intA is found on the
adherence factor plasmid (pB171), and
sfiA is found in the
she pathogenicity island in
S. flexneri. The
Y. pestis plasmid pMT1
also
carries a homologous gene remnant (
24). Retron-like
elements
are predicted to be involved in gene
transfer.
Plasmid replication and partitioning.
Incompatibility, defined
as the inability of two plasmids to coexist in the same cell in the
absence of external selection (33), is an indicator of
relatedness that has been used to classify plasmids (7).
Thus, plasmids in the same incompatibility (Inc) group share one or
more elements of their replication or partition systems. Replicons from
a number of different incompatibility groups have been sequenced, and
their mechanisms of replication and replication control have been
explained. Based on DNA and protein homologies as well as the shared
use of countertranscript RNA (ctRNA) to control replication, the
replicons of IncL/M, IncB, IncI
, and IncK
plasmids have been grouped together to form the I complex
(44). The current classification scheme is based on the
translated products of their essential replication initiator genes,
termed RepA (10, 11, 48).
orf125 (bp 66548 to 67570) was the only gene found on
plasmid pYVe8081 that could encode a protein with homology to
replication
initiation proteins. The predicted 340-amino-acid-long
protein
was 54% identical over 96% of its length to RepA of pMU407.1,
a naturally occurring conjugative plasmid belonging to the IncL/M
group
and the I-complex replicon group (
9). ORF125 was 46%
identical over 89% of its length to the replication initiator
proteins
from Col1b-P9 (IncI

) and pMu720 (IncB), which
also
belong to the I-complex replicon group. This putative protein
had
a molecular mass of 40,011 Da and an overall net positive
charge, which are characteristic of DNA binding proteins
(
2).
These findings support our designation of ORF125 as
the pYVe8081
RepA homologue. Surprisingly, we found no homology in the
GenBank
database to the RepA proteins of pCD1, pIB1, or pYVe227. To
confirm
and extend our finding that pYVe8081 encoded a replication
apparatus
significantly different from that of other previously
sequenced
Yersinia LCR plasmids, we used PCR to amplify
homologous sequences
from a second plasmid pYVe8081 isolate (obtained
from Virginia
Miller) and from another serotype 0:8
Y. enterocolitica plasmid,
pYVeWA. The DNA sequence of the amplified
repA gene from the second
pYVe8081 isolate was identical to
our original sequence of plasmid
pYVe8081 obtained from Peter Feng. The
homologous DNA segment
amplified from pYVeWA encoded
repA
with two silent nucleotide
changes from our pYVe8081 sequence.
Accordingly, the sequence
of pYVe8081
repA that we obtained
was not isolate specific and
appears to be representative of
Y. enterocolitica serotype 0:8
plasmids.
Upstream from
repA in pYVe8081, we identified other
essential elements found in I-complex replicons (Fig.
4). Homologues of
RNAI in I-complex
replicons encode ctRNAs that are the major incompatibility
determinants
and negative regulators of
repA expression (
2).
Our pYVe8081 RNAI was 76% identical over 92% of its length to
the
antisense RNAI of IncL/M (
2). RNAI from pYVe8081 was
predicted
to fold into a secondary structure (
27,
62)
composed of a
minor stem-loop at its 5' end, a major stem-loop
containing a
GC-rich region, and a short 3' tail (Fig.
5). These features are
also found in the
stem-loop structures of the antisense molecules
of IncL/M (Fig.
5). In
addition, the loop sequence, CGCCAA, found
in our RNAI
transcript is conserved in the ctRNAs of previously
sequenced I-complex
replicons (
34).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Nucleotide sequence of the putative replication region
in pYVe8081. The numbers correspond to base pair positions in pYVe8081.
The sequence shown is single stranded, with the deduced amino acid
sequences given in single-letter amino acid code. The deduced amino
acid sequence of RepB is shown above its nucleotide sequence. Possible
start codons are shown in boldface, and an arrowhead following the gene
name indicates the direction of transcription. An asterisk in the amino
acid sequence depicts a nonsense codon. Possible Shine-Dalgarno
sequences have a single line underneath them. Dots depict nucleotides
that are identical in pYVe8081 and the pMU407 replicon. The possible
10 and 35 sequences for the antisense RNA (RNAI) are boxed. RNAI is
underlined in boldface with an arrow that indicates the direction of
transcription. Facing arrows indicate possible stem-loop structures in
RNAI and repB. The double line under bp 1 to 9 denotes a
possible DnaA protein-binding site. Arrows labeled R1, R2, and R3
indicate direct repeats within the AT-rich region.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of the sequences of the stem-loop structures
predicted for RNAI molecules of pYVe8081, IncL/M (2), and
IncB (49) plasmids based on the computer program of Zuker
(27, 62). The conserved loop sequence (CGCCAA)
and the GC-rich region in the major stem-loop are shown in boldface.
|
|
A second characteristic of I-complex replicons is the presence of
repB homologues that encode small leader peptides involved
in the regulation of
repA expression. We found a putative
repB upstream of
repA (Fig.
4). In pYVe8081,
repB was 55% identical
over 94% of its length to
repB from IncL/M plasmid pMU407.1. The
repB
nonsense codon (TAA) overlapped the
repA start codon,
suggesting
translational coupling of these two genes, as has been
observed
previously for IncL/M plasmids (
2).
Upstream from RNAI, we found an ORF whose product showed homology to
the product of the
repC gene, which is located in the
corresponding position in the pMU407.1 replicon. However, ORF123
was
only 36% identical over 78% of its length to RepC encoded
by pMU407.
ORF123 was also 36% identical over 74% of its length
to RepB from
both pCD1 and pYVe227. Both RepB and RepC appear
to be involved in the
control of
repA expression in their respective
replication
systems (
2,
39,
60). We designated the gene
encoding
ORF123
repC because of its location in the putative replicon
of pYVe8081 and because its translated product was homologous
to RepC
from pMU407.1.
Members of the extended RepFIIA replicon family possess theta-type
replicons with characteristic origins of replication (
11).
The theta-type origin of replication contains specific sequences
that
interact with the replication initiator protein. Additional
features
found at the origins of theta-replicating plasmids are
an adjacent
AT-rich region containing repeated sequences and a
dnaA box,
where the host DnaA protein binds. A potential
dnaA box
(TTACCCACA) almost identical to the
dnaA box
(TTATCCACA) of
E. coli (
14) was
discovered approximately 150 bp downstream
from the end of
repA in pYVe8081 (Fig.
4). Since we could not
find a
sequence that matched the RepA binding site (
17) in
pYVe8081,
we designated the first base of our
dnaA box as
the start of the
possible
oriR. The presence of repeated
sequences (Fig.
4) and
a 70% adenosine-plus-thymidine content in this
region of pYVe8081
further suggest that this is the replication
origin.
In contrast to the putative replication region, the partitioning loci
encoded by pYVe8081 appear to be alleles of the analogous
regions on
Y. pestis pCD1 (
39) and
Y. enterocolitica pYVe227
(
21). A possible partitioning
(
par) locus at bp 42557 to 45058
(Fig.
1; Table
1) showed
98% nucleotide identity to the
sopABC locus in pCD1 and
approximately 97% nucleotide identity to the
spyABC locus
in pYVe227. The locus consisted of two
trans-acting
proteins
and a
cis-acting site, which had a genetic organization
identical to that of the
sop/par loci of low-copy-number
plasmids
F and P1 (
16). The high DNA homology of the LCR
plasmid partition
systems is further evidence that they have a common
evolutionary
origin and suggests that these systems have not diverged
appreciably
since they were
acquired.
Evolutionary aspects.
An unrooted phylogenetic tree based on
the deduced protein sequences encoded by repA genes showed
that the putative RepA from pYVe8081 and pYVeWA belonged to an extended
replicon family which consisted of four distinct subgroups (Fig.
6). RepA from pYVe8081 and pYVeWA
clustered with IncL/M RepA, while the other I-complex replicons
(RepFIC, IncB, IncK, and IncI
) formed a
separate subgroup. This is in agreement with the rooted tree
constructed by Osborn et al., who proposed extending the RepFIIA family
to include the I-complex replicons (34). Only 16%
of pYVe8081 RepA residues matched with those in pCD1 and pYVe227,
while the RepA proteins of pCD1 and pYVe227 differ from each other by
only a single amino acid residue. The finding that pYVe8081 and pYVeWA replicons were only distantly related to the replicons of pCD1 and
pYVe227 suggests that Y. enterocolitica serotype 0:8 plasmid replicons originated independently during the evolution of these plasmids. A model for replicon evolution involving cointegrate formation by two compatible plasmids has recently been described (54).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Unrooted phylogenetic tree of the translated products of
repA genes from the extended RepFIIA family. Alignments
were generated using the CLUSTAL program (DNAStar). Incompatibility
groups are shown in parentheses. The replication initiator protein from
rolling-circle replicating plasmid pT181 (31, 32) is
included as an unrelated protein for a control. Buchnera
aphidicola plasmids (50, 58) and their RepA
(GenBank) accession numbers are as follows: pBPp1, CAA07300; pBTs1,
CAA72701; and pBTc1, CAA72709. Other plasmids and their RepA (GenBank)
accession numbers are as follows: pCD1, AAC69762; pYVe227, AF102990;
pNR1, CAA26168; pSU316, AAA98204; pCol1b-P9, AAA23191;
pMU707, AAA98176; pMU407.1, AAA87028; pR387, AAA98310; pYVe8081,
AY026194; pYVeWA, AY026195; and p307, AAB17112.
|
|
The putative pYVe8081
oriR was similar to replication
origins in the other RepFIIA family members since it lacked iterons
and
consisted instead of a
dnaA box and an adjacent AT-rich
region.
The putative replication region in pYVe8081 also shared copy
number
control elements found in RepFIIA replicons: a small ctRNA and
a
small translated peptide encoded in the leader region of the
repA mRNA. The presence of these elements suggests that
pYVe8081
uses a mechanism of copy number control similar to that found
in other RepFIIA family members. Based on recent analysis of RepFIIA
replicons, it has been proposed elsewhere that the entire family
consists of mosaic replicons that arose as a result of recombination
events (
35,
44). The likely site of recombination is at
the
junction of the sequence encoding the leader peptide and the
repA gene.
In contrast to the divergence shown by the LCR plasmid replicons, the
phenotypic traits exhibited by these plasmids are highly
conserved. The
segment that includes the
virABC loci,
virG,
virF, and the
GVH-yopBD operon in pYVe8081 showed
at least 97% nucleotide
identity with the corresponding region in pCD1
and pYVe227. This
segment was part of a contiguous region, from
yopQ to
yadA, covering
68% of the pYVe8081
plasmid that has DNA homology to pCD1 and
pYVe227 (Fig.
2). In
addition, the region encoding ORF155, YopO,
and YopP in pYVe8081 was
97% identical to the corresponding region
in pCD1 and pYVe227
(Fig.
1). The conservation of virulence-related
genes demonstrates the
strong selective pressure that these genes
are under due to the
advantage that they confer on the host
Yersinia.
Although
large regions of pYVe8081, pCD1, and pYVe227 are related,
each plasmid
has undergone considerable change in structure since
it diverged,
because deletions, insertions, and rearrangements
of DNA sequences are
required to explain differences in gene order
and plasmid
content.
The
Yersinia LCR plasmids are nonconjugative, but remnants
of transfer (
tra) genes homologous to the
tra
locus of the F plasmid
are found in pYVe227 and pCD1 (
21,
39). We found no evidence
of an ancestral
tra locus
in pYVe8081, but we did find the gene
for a putative endonuclease
(
orf106) that was homologous to the
Nuc protein at the end
of the
tra gene cluster in pYVe227. The
presence of a
vestigial
tra locus on other LCR plasmids suggests
that the
ancestral
Yersinia LCR plasmid had the ability to colonize
other bacterial
species.
Constructing evolutionary relationships among plasmids is challenging
due to their mosaic nature, which results from the acquisition
of genes
by horizontal transfer. The sequence of pYVe8081 reveals
a backbone
with replication features that are clearly divergent
from those
previously reported for pCD1 and pYVe227 while the
maintenance features
in all three plasmids are nearly identical.
Although analysis of our
data in relation to those of others (
21,
39) is not
definitive, we suggest that the LCR plasmids arose
from a common
ancestor but that the replicons on
Y. enterocolitica serotype 0:8 plasmids evolved independently through nonselective
divergence following cointegrate formation. Regardless of the
molecular events that led to the present structure of pYVe8081,
our
data strongly suggest that it should belong to a new incompatibility
group. Confirmation of this possibility will await further
testing.
 |
ACKNOWLEDGMENTS |
We thank Peter Feng and Virginia Miller for providing bacterial
strains. We also thank Fred Blattner's group (University of Wisconsin,
Madison), Karla Atkins, Emily Clements, Stuart Cohen, R. Lee Collins,
and Nazma Jahan for technical support.
This research was supported by Research Area Director IV, which is part
of the Medical Research and Materiel Command of the United
States Army.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Bacterial Diseases, WRAIR, Room 3A08, 503 Robert Grant Ave., Silver
Spring, MD 20910-7500. Phone: (301) 319-9825. Fax: (301) 319-9123. E-mail: norma.snellings{at}na.amedd.army.mil.
Editor:
A. D. O'Brien
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 2.
|
Athanasopoulos, V.,
J. Praszkier, and A. J. Pittard.
1995.
The replication of an IncL/M plasmid is subject to antisense control.
J. Bacteriol.
177:4730-4741[Abstract/Free Full Text].
|
| 3.
|
Brubaker, R. R.
1991.
Factors promoting acute and chronic diseases caused by yersiniae.
Clin. Microbiol. Rev.
4:309-324[Abstract/Free Full Text].
|
| 4.
|
Burland, V.,
D. L. Daniels,
G. D. Plunkett, and F. R. Blattner.
1993.
Genome sequencing on both strands: the Janus strategy.
Nucleic Acids Res.
21:3385-3390[Abstract/Free Full Text].
|
| 5.
|
Cornelis, G.,
Y. Laroche,
G. Balligand,
M. P. Sory, and G. Wauters.
1987.
Yersinia enterocolitica, a primary model for bacterial invasiveness.
Rev. Infect. Dis.
9:64-87[Medline].
|
| 6.
|
Cornelis, G. R.,
A. Boland,
A. P. Boyd,
C. Geuijen,
M. Iriarte,
C. Neyt,
M. P. Sory, and I. Stainier.
1998.
The virulence plasmid of Yersinia, an antihost genome.
Microbiol. Mol. Biol. Rev.
62:1315-1352[Abstract/Free Full Text].
|
| 7.
|
Couturier, M.,
F. Bex,
P. L. Bergquist, and W. K. Maas.
1988.
Identification and classification of bacterial plasmids.
Microbiol. Rev.
52:375-395[Free Full Text].
|
| 8.
|
Cover, T. L., and R. C. Aber.
1989.
Yersinia enterocolitica.
N. Engl. J. Med.
321:16-24[Medline].
|
| 9.
|
Davey, R. B.,
P. I. Bird,
S. M. Nikoletti,
J. Praszkier, and J. Pittard.
1984.
The use of mini-Gal plasmids for rapid incompatibility grouping of conjugative R plasmids.
Plasmid
11:234-242[CrossRef][Medline].
|
| 10.
|
del Solar, G., and M. Espinosa.
2000.
Plasmid copy number control: an ever-growing story.
Mol. Microbiol.
37:492-500[CrossRef][Medline].
|
| 11.
|
del Solar, G.,
R. Giraldo,
M. J. Ruiz-Echevarria,
M. Espinosa, and R. Diaz-Orejas.
1998.
Replication and control of circular bacterial plasmids.
Microbiol. Mol. Biol. Rev.
62:434-464[Abstract/Free Full Text].
|
| 12.
|
Devalckenaere, A.,
M. Odaert,
P. Trieu-Cuot, and M. Simonet.
1999.
Characterization of IS1541-like elements in Yersinia enterocolitica and Yersinia pseudotuberculosis.
FEMS Microbiol. Lett.
176:229-233[CrossRef][Medline].
|
| 13.
|
Eisen, J. A.,
M. I. Benito, and V. Walbot.
1994.
Sequence similarity of putative transposases links the maize Mutator autonomous element and a group of bacterial insertion sequences.
Nucleic Acids Res.
22:2634-2636[Abstract/Free Full Text].
|
| 14.
|
Fuller, R. S., and A. Kornberg.
1983.
Purified DnaA protein in initiation of replication at the Escherichia coli chromosomal origin of replication.
Proc. Natl. Acad. Sci. USA
80:5817-5821[Abstract/Free Full Text].
|
| 15.
|
Galyov, E. E.,
S. Hakansson, and H. Wolf-Watz.
1994.
Characterization of the operon encoding the YpkA Ser/Thr protein kinase and the YopJ protein of Yersinia pseudotuberculosis.
J. Bacteriol.
176:4543-4548[Abstract/Free Full Text].
|
| 16.
|
Gerdes, K.,
J. Moller-Jensen, and R. Bugge Jensen.
2000.
Plasmid and chromosome partitioning: surprises from phylogeny.
Mol. Microbiol.
37:455-466[CrossRef][Medline].
|
| 17.
|
Giraldo, R., and R. Diaz.
1992.
Differential binding of wild-type and a mutant RepA protein to oriR sequence suggests a model for the initiation of plasmid R1 replication.
J. Mol. Biol.
228:787-802[CrossRef][Medline].
|
| 18.
|
Guo, F.,
D. N. Gopaul, and G. D. van Duyne.
1997.
Structure of Cre recombinase complexed with DNA in a site-specific recombination synapse.
Nature
389:40-46[CrossRef][Medline].
|
| 19.
|
Heesemann, J.,
C. Keller,
R. Morawa,
N. Schmidt,
H. J. Siemens, and R. Laufs.
1983.
Plasmids of human strains of Yersinia enterocolitica: molecular relatedness and possible importance for pathogenesis.
J. Infect. Dis.
147:107-115[Medline].
|
| 20.
|
Hu, P.,
J. Elliott,
P. McCready,
E. Skowronski,
J. Garnes,
A. Kobayashi,
R. R. Brubaker, and E. Garcia.
1998.
Structural organization of virulence-associated plasmids of Yersinia pestis.
J. Bacteriol.
180:5192-5202[Abstract/Free Full Text].
|
| 21.
|
Iriarte, M., and G. R. Cornelis.
1999.
The 70-kilobase virulence plasmid of Yersiniae, p. 91-127.
In
J. B. Kaper, and J. Hacker (ed.), Pathogenicity islands and other mobile elements. American Society for Microbiology, Washington, D.C.
|
| 22.
|
Klaer, R.,
S. Kuhn,
E. Tillmann,
H. J. Fritz, and P. Starlinger.
1981.
The sequence of IS4.
Mol. Gen. Genet.
181:169-175[CrossRef][Medline].
|
| 23.
|
Kwon, H. J.,
R. Tirumalai,
A. Landy, and T. Ellenberger.
1997.
Flexibility in DNA recombination: structure of the lambda integrase catalytic core.
Science
276:126-131[Abstract/Free Full Text].
|
| 24.
|
Lindler, L. E.,
G. V. Plano,
V. Burland,
G. F. Mayhew, and F. R. Blattner.
1998.
Complete DNA sequence and detailed analysis of the Yersinia pestis KIM5 plasmid encoding murine toxin and capsular antigen.
Infect. Immun.
66:5731-5742[Abstract/Free Full Text].
|
| 25.
|
Mahillon, J., and M. Chandler.
1998.
Insertion sequences.
Microbiol. Mol. Biol. Rev.
62:725-774[Abstract/Free Full Text].
|
| 26.
|
Mahillon, J.,
H. A. Kirkpatrick,
H. L. Kijenski,
C. A. Bloch,
C. K. Rode,
G. F. Mayhew,
D. J. Rose,
G. Plunkett, 3rd,
V. Burland, and F. R. Blattner.
1998.
Subdivision of the Escherichia coli K-12 genome for sequencing: manipulation and DNA sequence of transposable elements introducing unique restriction sites.
Gene
223:47-54[CrossRef][Medline].
|
| 27.
|
Mathews, D. H.,
J. Sabina,
M. Zuker, and D. H. Turner.
1999.
Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure.
J. Mol. Biol.
288:911-940[CrossRef][Medline].
|
| 28.
|
McGhee, G. C., and A. L. Jones.
2000.
Complete nucleotide sequence of ubiquitous plasmid pEA29 from Erwinia amylovora strain Ea88: gene organization and intraspecies variation.
Appl. Environ. Microbiol.
66:4897-4907[Abstract/Free Full Text].
|
| 29.
|
Mead, P. S.,
L. Slutsker,
V. Dietz,
L. F. McCaig,
J. S. Bresee,
C. Shapiro,
P. M. Griffin, and R. V. Tauxe.
1999.
Food-related illness and death in the United States.
Emerg. Infect. Dis.
5:607-625[Medline].
|
| 30.
|
Nilehn, B.
1969.
Studies on Yersinia enterocolitica with special reference to bacterial diagnosis and occurrence in human acute enteric disease.
Acta Pathol. Microbiol. Immunol. Scand.
206(Suppl.):1-48.
|
| 31.
|
Novick, R. P.
1989.
Staphylococcal plasmids and their replication.
Annu. Rev. Microbiol.
43:537-565[CrossRef][Medline]. (Erratum, 44:10, 1990.)
|
| 32.
|
Novick, R. P.,
G. K. Adler,
S. Majumder,
S. A. Khan,
S. Carleton,
W. D. Rosenblum, and S. Iordanescu.
1982.
Coding sequence for the pT181 repC product: a plasmid-coded protein uniquely required for replication.
Proc. Natl. Acad. Sci. USA
79:4108-4112[Abstract/Free Full Text].
|
| 33.
|
Novick, R. P.,
R. C. Clowes,
S. N. Cohen,
R. D. Curtiss,
N. Datta, and S. Falkow.
1976.
Uniform nomenclature for bacterial plasmids: a proposal.
Bacteriol. Rev.
40:168-189[Free Full Text].
|
| 34.
|
Osborn, A. M.,
F. M. da Silva Tatley,
L. M. Steyn,
R. W. Pickup, and J. R. Saunders.
2000.
Mosaic plasmids and mosaic replicons: evolutionary lessons from the analysis of genetic diversity in IncFII-related replicons.
Microbiology
146:2267-2275[Abstract/Free Full Text].
|
| 35.
|
Osborn, M.,
S. Bron,
N. Firth,
S. Holsappel,
A. Huddleston,
R. Kiewiet,
W. Meijer,
J. Seegers,
R. Skurray,
P. Terpstra,
C. M. Thomas,
P. Thorsted,
E. Tietze, and S. L. Turner.
2000.
The evolution of bacterial plasmids, p. 301-350.
In
C. M. Thomas (ed.), The horizontal gene pool. Harwood Academic Publishers, Amsterdam, The Netherlands.
|
| 36.
|
Payne, P. L., and S. C. Straley.
1999.
YscP of Yersinia pestis is a secreted component of the Yop secretion system.
J. Bacteriol.
181:2852-2862[Abstract/Free Full Text].
|
| 37.
|
Perry, R. D.
1993.
Acquisition and storage of inorganic iron and hemin by the Yersiniae.
Trends Microbiol.
1:142-147[CrossRef][Medline].
|
| 38.
|
Perry, R. D., and J. D. Fetherston.
1997.
Yersinia pestis etiologic agent of plague.
Clin. Microbiol. Rev.
10:35-66[Abstract].
|
| 39.
|
Perry, R. D.,
S. C. Straley,
J. D. Fetherston,
D. J. Rose,
J. Gregor, and F. R. Blattner.
1998.
DNA sequencing and analysis of the low-Ca2+-response plasmid pCD1 of Yersinia pestis KIM5.
Infect. Immun.
66:4611-4623[Abstract/Free Full Text].
|
| 40.
|
Ponting, C. P., and I. D. Kerr.
1996.
A novel family of phospholipase D homologues that includes phospholipid synthases and putative endonucleases: identification of duplicated repeats and potential active site residues.
Protein Sci.
5:914-922[Medline].
|
| 41.
|
Portnoy, D. A., and S. Falkow.
1981.
Virulence-associated plasmids from Yersinia enterocolitica and Yersinia pestis.
J. Bacteriol.
148:877-883[Abstract/Free Full Text].
|
| 42.
|
Portnoy, D. A.,
S. L. Moseley, and S. Falkow.
1981.
Characterization of plasmids and plasmid-associated determinants of Yersinia enterocolitica pathogenesis.
Infect. Immun.
31:775-782[Abstract/Free Full Text].
|
| 43.
|
Portnoy, D. A.,
H. Wolf-Watz,
I. Bolin,
A. B. Beeder, and S. Falkow.
1984.
Characterization of common virulence plasmids in Yersinia species and their role in the expression of outer membrane proteins.
Infect. Immun.
43:108-114[Abstract/Free Full Text].
|
| 44.
|
Praszkier, J.,
T. Wei,
K. Siemering, and J. Pittard.
1991.
Comparative analysis of the replication regions of IncB, IncK, and IncZ plasmids.
J. Bacteriol.
173:2393-2397[Abstract/Free Full Text].
|
| 45.
|
Rajakumar, K.,
C. Sasakawa, and B. Adler.
1997.
Use of a novel approach, termed island probing, identifies the Shigella flexneri she pathogenicity island which encodes a homolog of the immunoglobulin A protease-like family of proteins.
Infect. Immun.
65:4606-4614[Abstract].
|
| 46.
|
Rimpilainen, M.,
A. Forsberg, and H. Wolf-Watz.
1992.
A novel protein, LcrQ, involved in the low-calcium response of Yersinia pseudotuberculosis shows extensive homology to YopH.
J. Bacteriol.
174:3355-3363[Abstract/Free Full Text].
|
| 47.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 48.
|
Sesma, A.,
G. W. Sundin, and J. Murillo.
2000.
Phylogeny of the replication regions of pPT23A-like plasmids from Pseudomonas syringae.
Microbiology
146:2375-2384[Abstract/Free Full Text].
|
| 49.
|
Siemering, K. R.,
J. Praszkier, and A. J. Pittard.
1993.
Interaction between the antisense and target RNAs involved in the regulation of IncB plasmid replication.
J. Bacteriol.
175:2895-2906[Abstract/Free Full Text].
|
| 50.
|
Silva, F. J.,
R. C. van Ham,
B. Sabater, and A. Latorre.
1998.
Structure and evolution of the leucine plasmids carried by the endosymbiont (Buchnera aphidicola) from aphids of the family Aphididae.
FEMS Microbiol. Lett.
168:43-49[CrossRef][Medline].
|
| 51.
|
Stainier, I.,
S. Bleves,
C. Josenhans,
L. Karmani,
C. Kerbourch,
I. Lambermont,
S. Totemeyer,
A. Boyd, and G. R. Cornelis.
2000.
YscP, a Yersinia protein required for Yop secretion that is surface exposed, and released in low Ca2+.
Mol. Microbiol.
37:1005-1018[CrossRef][Medline].
|
| 52.
|
Straley, S. C., and W. S. Bowmer.
1986.
Virulence genes regulated at the transcriptional level by Ca2+ in Yersinia pestis include structural genes for outer membrane proteins.
Infect. Immun.
51:445-454[Abstract/Free Full Text].
|
| 53.
|
Straley, S. C.,
G. V. Plano,
E. Skrzypek,
P. L. Haddix, and K. A. Fields.
1993.
Regulation by Ca2+ in the Yersinia low-Ca2+ response.
Mol. Microbiol.
8:1005-1010[CrossRef][Medline].
|
| 54.
|
Sykora, P.
1992.
Macroevolution of plasmids: a model for plasmid speciation.
J. Theor. Biol.
159:53-65[CrossRef][Medline].
|
| 55.
|
Temin, H. M.
1989.
Reverse transcriptases. Retrons in bacteria.
Nature
339:254-255[CrossRef][Medline].
|
| 56.
|
Tobe, T.,
T. Hayashi,
C. G. Han,
G. K. Schoolnik,
E. Ohtsubo, and C. Sasakawa.
1999.
Complete DNA sequence and structural analysis of the enteropathogenic Escherichia coli adherence factor plasmid.
Infect. Immun.
67:5455-5462[Abstract/Free Full Text].
|
| 57.
|
Tyler, S. D.,
K. R. Rozee, and W. M. Johnson.
1996.
Identification of IS1356, a new insertion sequence, and its association with IS402 in epidemic strains of Burkholderia cepacia infecting cystic fibrosis patients.
J. Clin. Microbiol.
34:1610-1616[Abstract].
|
| 58.
|
van Ham, R. C.,
A. Moya, and A. Latorre.
1997.
Putative evolutionary origin of plasmids carrying the genes involved in leucine biosynthesis in Buchnera aphidicola (endosymbiont of aphids).
J. Bacteriol.
179:4768-4777[Abstract/Free Full Text].
|
| 59.
|
van Knippenberg, P. H.
1990.
Aspects of translation initiation in Escherichia coli,, p. 265-274.
In
W. E. Hill, A. Dahlberg, R. A. Garrett, P. B. Moore, D. Schlessinger, and J. R. Warner (ed.), The ribosome: structure, function, and evolution. American Society for Microbiology, Washington, D.C.
|
| 60.
|
Vanooteghem, J. C., and G. R. Cornelis.
1990.
Structural and functional similarities between the replication region of the Yersinia virulence plasmid and the RepFIIA replicons.
J. Bacteriol.
172:3152-3162[Abstract/Free Full Text].
|
| 61.
|
Wheatcroft, R., and S. Laberge.
1991.
Identification and nucleotide sequence of Rhizobium meliloti insertion sequence ISRm3: similarity between the putative transposase encoded by ISRm3 and those encoded by Staphylococcus aureus IS256 and Thiobacillus ferrooxidans IST2.
J. Bacteriol.
173:2530-2538[Abstract/Free Full Text].
|
| 62.
|
Zuker, M.,
D. H. Mathews, and D. H. Turner.
1999.
Algorithms and thermodynamics of RNA secondary structure prediction: a practical guide, p. 11-43.
In
J. Barciszewski, and B. F. C. Clark (ed.), RNA biochemistry and biotechnology. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
Infection and Immunity, July 2001, p. 4627-4638, Vol. 69, No. 7
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.7.4627-4638.2001
This article has been cited by other articles:
-
Dach, K., Zovko, J., Hogardt, M., Koch, I., van Erp, K., Heesemann, J., Hoffmann, R.
(2009). Bacterial Toxins Induce Sustained mRNA Expression of the Silencing Transcription Factor klf2 via Inactivation of RhoA and Rhophilin 1. Infect. Immun.
77: 5583-5592
[Abstract]
[Full Text]
-
Hentschke, M., Trulzsch, K., Heesemann, J., Aepfelbacher, M., Ruckdeschel, K.
(2007). Serogroup-Related Escape of Yersinia enterocolitica YopE from Degradation by the Ubiquitin-Proteasome Pathway. Infect. Immun.
75: 4423-4431
[Abstract]
[Full Text]
-
Falker, S., Schmidt, M. A., Heusipp, G.
(2006). Altered Ca2+ Regulation of Yop Secretion in Yersinia enterocolitica after DNA Adenine Methyltransferase Overproduction Is Mediated by Clp-Dependent Degradation of LcrG.. J. Bacteriol.
188: 7072-7081
[Abstract]
[Full Text]
-
Huang, X.-Z., Nikolich, M. P., Lindler, L. E.
(2006). Current trends in plague research: from genomics to virulence.. Clin Med Res
4: 189-199
[Abstract]
[Full Text]
-
Zauberman, A., Cohen, S., Mamroud, E., Flashner, Y., Tidhar, A., Ber, R., Elhanany, E., Shafferman, A., Velan, B.
(2006). Interaction of Yersinia pestis with Macrophages: Limitations in YopJ-Dependent Apoptosis.. Infect. Immun.
74: 3239-3250
[Abstract]
[Full Text]
-
Sha, J., Pillai, L., Fadl, A. A., Galindo, C. L., Erova, T. E., Chopra, A. K.
(2005). The Type III Secretion System and Cytotoxic Enterotoxin Alter the Virulence of Aeromonas hydrophila. Infect. Immun.
73: 6446-6457
[Abstract]
[Full Text]
-
Schmid, Y., Grassl, G. A., Buhler, O. T., Skurnik, M., Autenrieth, I. B., Bohn, E.
(2004). Yersinia enterocolitica Adhesin A Induces Production of Interleukin-8 in Epithelial Cells. Infect. Immun.
72: 6780-6789
[Abstract]
[Full Text]
-
Ferracci, F., Day, J. B., Ezelle, H. J., Plano, G. V.
(2004). Expression of a Functional Secreted YopN-TyeA Hybrid Protein in Yersinia pestis Is the Result of a +1 Translational Frameshift Event. J. Bacteriol.
186: 5160-5166
[Abstract]
[Full Text]
-
Anisimov, A. P., Lindler, L. E., Pier, G. B.
(2004). Intraspecific Diversity of Yersinia pestis. Clin. Microbiol. Rev.
17: 434-464
[Abstract]
[Full Text]
-
Strauch, E., Goelz, G., Knabner, D., Konietzny, A., Lanka, E., Appel, B.
(2003). A cryptic plasmid of Yersinia enterocolitica encodes a conjugative transfer system related to the regions of CloDF13 Mob and IncX Pil. Microbiology
149: 2829-2845
[Abstract]
[Full Text]
-
Young, B. M., Young, G. M.
(2002). Evidence for Targeting of Yop Effectors by the Chromosomally Encoded Ysa Type III Secretion System of Yersinia enterocolitica. J. Bacteriol.
184: 5563-5571
[Abstract]
[Full Text]
-
Carnoy, C., Floquet, S., Marceau, M., Sebbane, F., Haentjens-Herwegh, S., Devalckenaere, A., Simonet, M.
(2002). The Superantigen Gene ypm Is Located in an Unstable Chromosomal Locus of Yersinia pseudotuberculosis. J. Bacteriol.
184: 4489-4499
[Abstract]
[Full Text]
-
Young, B. M., Young, G. M.
(2002). YplA Is Exported by the Ysc, Ysa, and Flagellar Type III Secretion Systems of Yersinia enterocolitica. J. Bacteriol.
184: 1324-1334
[Abstract]
[Full Text]
-
Ruckdeschel, K., Richter, K., Mannel, O., Heesemann, J.
(2001). Arginine-143 of Yersinia enterocolitica YopP Crucially Determines Isotype-Related NF-kappa B Suppression and Apoptosis Induction in Macrophages. Infect. Immun.
69: 7652-7662
[Abstract]
[Full Text]