Previous Article | Next Article ![]()
Infection and Immunity, August 2001, p. 4874-4883, Vol. 69, No. 8
Department of Medical Microbiology and
Immunology, Texas A&M University System Health Science Center,
College Station, Texas 77843-1114
Received 1 February 2001/Returned for modification 21 March
2001/Accepted 16 May 2001
Coxiella burnetii is an obligate intracellular
bacterium that resides in an acidified phagolysosome and has a
remarkable ability to persist in the extracellular environment.
C. burnetii has evolved a developmental cycle
that includes at least two morphologic forms, designated large
cell variants (LCV) and small cell variants (SCV). Based on
differential protein expression, distinct ultrastructures, and
different metabolic activities, we speculated that LCV and SCV are
similar to typical logarithmic- and stationary-phase growth stages. We
hypothesized that the alternate sigma factor, RpoS, a global regulator
of genes expressed under stationary-phase, starvation, and stress
conditions in many bacteria, regulates differential expression in life
cycle variants of C. burnetii. To test this
hypothesis, we cloned and characterized the major sigma factor, encoded
by an rpoD homologue, and the stress response sigma factor, encoded by an rpoS homologue. The
rpoS gene was cloned by complementation of an
Escherichia coli rpoS null mutant containing an
RpoS-dependent lacZ fusion
(osmY::lacZ). Expression of
C. burnetii rpoS was regulated by growth phase in
E. coli (induced upon entry into stationary phase).
A glutathione S-transferase-RpoS fusion protein was
used to develop polyclonal antiserum against C.
burnetii RpoS. Western blot analysis detected abundant RpoS in
LCV but not in SCV. These results suggest that LCV and SCV are not
comparable to logarithmic and stationary phases of growth and may
represent a novel adaptation for survival in both the phagolysosome and
the extracellular environment.
Coxiella burnetii is an
obligate intracellular bacterium that has developed a unique strategy
to permit multiplication and survival in the phagolysosome of
eukaryotic host cells. The life cycle of C. burnetii is
incompletely characterized, but it has at least two morphologically and
physiologically distinct participants, large-cell variants (LCV) and
small-cell variants (SCV) (7, 14, 28, 31, 38). These two
cell populations can be purified to near homogeneity by equilibrium
centrifugation in 32% cesium chloride (14, 50). LCV
appear to be similar to typical gram-negative bacteria, as they appear
during exponential phase of growth, with a clearly distinguishable
outer membrane, periplasmic space, cytoplasmic membrane, and
diffuse nucleoid, attaining lengths exceeding 1 µm. In contrast,
SCV are 0.2 to 0.5 µm in diameter, with electron-dense, condensed
chromatin and condensed cytoplasm. SCV are resistant to osmotic shock,
oxidative stress, heat shock, sonication, and pressure, unlike the more
fragile LCV (1, 2, 13, 30). Differences in resistance to
breakage by osmotic and pressure stress were employed to suggest that
LCV have greater metabolic activity than SCV based on their ability to
transport and evolve labeled carbon dioxide from
[14C]glucose and
[14C]glutamate when incubated in axenic media
(30). These two cell variants have also been shown to
differentially express several proteins. The histone-like protein Hq-1
(14), and a small (~4.5-kDa) basic peptide, ScvA
(R. A. Heinzen, R. A., D. Howe, L. P. Mallavia, and T. Hackstadt, presented at the 11th Sesqui-Annual Meeting of the American Society for Rickettsiology and Rickettsial Diseases, St. Simons Island, Georgia, 1994), were detected only in SCV. Elongation factor Tu (EF-Tu) was detected only in LCV, while EF-Ts (45) and the major outer membrane protein P1
(29) were both dramatically upregulated in LCV.
These observations were the basis for recently proposed models of
C. burnetii development (15, 40). In these
models, we speculated that LCV and SCV function like logarithmic-phase
and stationary-phase bacteria, respectively (40). In
Escherichia coli, the transition to an altered physiological
state is mediated by a global regulator of gene expression,
Media and chemicals.
Luria-Bertani (LB) medium was purchased
from Difco Laboratories (Detroit, Mich.), and M9 minimal medium was
prepared according to a laboratory manual (39).
Antibiotics were incorporated into media at the following
concentrations to maintain plasmids in E. coli:
ampicillin at 100 µg ml Bacteria and plasmids.
Bacterial isolates (C. burnetii, E. coli, and Legionella
pneumophila) and plasmids used in this study are listed in Table 1. E. coli DH5
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.8.4874-4883.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Characterization of a Stress-Induced Alternate Sigma Factor,
RpoS, of Coxiella burnetii and Its Expression during the
Development Cycle
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
s (or RpoS), encoded by the
rpoS gene. RpoS is a sigma subunit that confers promoter
specific transcriptional initiation by RNA polymerase to genes that are
expressed during stationary phase. Although associated with the onset
of stationary phase, RpoS is also upregulated in response to various
stress conditions. RpoS is present at very low levels in exponentially
growing cells, but in response to various stress and other conditions
(acid stress, oxidative stress, osmotic stress, heat shock, cold shock,
nutrient starvation, near-UV light, stringent response, and
density sensing) it is strongly upregulated and activates over 60 genes, resulting in multistress resistance and other observed
morphologic and physiological alterations (20, 23, 27).
Based on our model, we predicted that SCV express an RpoS that
regulates protein expression specific for that stage. To test this
hypothesis, we identified rpoS and rpoD (as a
control for constitutively expressed sigma factor) and evaluated their
expression by LCV and SCV. Identification of a prototypic
rpoS gene in C. burnetii is intriguing,
since recent genomic studies with two obligate intracellular
pathogens, Rickettsia prowazekii (3) and
Chlamydia trachomatis (21), indicated that
the genomes of these organisms do not encode such a sigma
factor. Our studies demonstrate that, in contrast to the prediction of
our model, SCV do not contain significant RpoS while LCV express
abundant RpoS, suggesting that LCV and SCV life cycle variants may not
be the functional equivalent forms of logarithmic- and stationary-phase bacteria.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1 and kanamycin at 50 µg ml
1, tetracycline at 12.5 µg
ml
1, and chloramphenicol at 20 µg
ml
1.
5-Bromo-4-chloro-3-indolyl-
-D-galactoside
(X-Gal), isopropyl-
-D-thiogalactopyranoside (IPTG),
o-nitrophenyl-
-D-galactopyranoside
(ONPG), and a 30% (wt/wt) solution of hydrogen peroxide were purchased
from Sigma Chemical Co. (St. Louis, Mo.).
cultures were grown in
LB medium at 37°C in a shaking water bath; E. coli
XL1-MRF' cells were infected with bacteriophage
ZapII cloning vector
(Stratagene, La Jolla, Calif.) and grown in top agar on
NZY-agar plates. C. burnetii was grown in
embryonated yolk sacs and purified as previously described (42). The rpoS gene from C. burnetii was cloned in frame into a prokaryotic glutathione
S-transferase (GST) fusion expression vector in a two-step
cloning strategy. Primers designated Cox-rpoS-For (5' XhoI
site) and Cox-rpoS-Rev amplified the entire 1,059-bp region of the
rpoS gene from C. burnetii template DNA.
This PCR product was cloned into the pCR2.1-TOPO cloning vector
(Invitrogen, Carlsbad, Calif.). This plasmid, designated pR0S105, was
double-digested with XhoI and EcoRI and cloned
into comparably digested pGEX-4T-1.
TABLE 1.
Bacterial strains and plasmids used in this study
Genomic library construction.
C. burnetii
genomic DNA libraries were constructed with
HindIII-digested chromosomal DNA fragments ligated with
HindIII-digested
ZapII as described in the Stratagene
ZapII cloning kit manual. Bacteriophage
ZapII was mixed with
E. coli strain XL1-MRF' and incubated on NZY-agar
plates to yield approximately 500 plaques per plate. Bacteriophage
plaques were removed with sterile Pasteur pipettes and transferred to
phage dilution SM buffer, and plasmids were excised as
described in the Stratagene
ZapII/EcoRI/CIAP cloning kit
instruction manual (Stratagene). A plasmid bank was constructed by
ligating 1.5- to 2-kb EcoRI-digested fragments with a
multicopy vector, pSKII(
), that had been digested with EcoRI and treated with alkaline phosphatase (Boehringer
Mannheim, Indianapolis, Ind.). The ligation mixture was transformed
into competent library efficiency E. coli strain
DH5
(Gibco-BRL, Gaithersburg, Md.).
Preparation of antibodies. C. burnetii rpoS was PCR amplified and cloned into pCR2.1 cloning vector (Invitrogen). It was subsequently subcloned by in-frame ligation with pGEX-4T-1 GST fusion vector (Amersham-Pharmacia Biotech, Piscataway, N.J.), and the resultant fusion protein was overexpressed and purified as described in the manufacturer's protocol. Fusion protein GST-RpoS was subsequently used to immunize rabbits combined with the adjuvant Titermax (Sigma). Polyclonal immune rabbit serum (IRS) obtained in this manner was additionally preadsorbed against E. coli LM5005 cell lysates to eliminate any cross-reactivity to irrelevant E. coli proteins.
Catalase test. Cultures were grown overnight in LB medium, centrifuged, resuspended in 5 ml of fresh LB medium at pH 2.0 (adjusted with HCl), and incubated at room temperature under aerobic growth conditions for 1 to 2 h (200 rpm). Various dilutions were plated overnight, and individual colonies were tested the next day for catalase activity by addition of 30% hydrogen peroxide. Colonies that evolved oxygen effervesced, which was indicative of a catalase-positive phenotype.
-Galactosidase activity.
-Galactosidase activity was
assayed qualitatively on various M9 plates containing limiting amounts
of carbon (0.04% glucose; carbon starvation) and 50 µg of X-Gal/ml.
-Galactosidase activity was assessed quantitatively for bacterial
cultures as described by Miller (32). Specific activity is
presented in micromoles per minute per milligram of protein. The
substrate for LacZ hydrolysis in this assay was ONPG.
SDS-PAGE and immunoblot analysis.
Cells of C. burnetii purified from infected tissue culture cells or of
E. coli (grown logarithmically or in stationary phase) expressing cloned C. burnetii proteins were resuspended
in sample buffer (4% sodium dodecyl sulfate [SDS], 10%
-mercaptomethanol, 20% glycerol, and 0.25 M Tris, pH 8) and boiled
for 10 min, and the solubilized protein was separated by SDS-12%
polyacrylamide gel electrophoresis (PAGE). Bacterial densities were
determined using a spectrophotometer. After electrophoresis, proteins
were directly electroblotted onto nitrocellulose transfer membranes (Micron Separations Inc., Westboro, Mass.) as previously described (47). Nitrocellulose membranes used for immunoblotting
were blocked for 1 h with 10% nonfat powdered milk and 0.2%
Tween-20 in Tris-buffered saline, pH 7.4. Blots were then incubated
with rabbit antiserum to C. burnetii RpoS or
E. coli RpoS (
38) (kind gift
from A. Ishihama, National Institute of Genetics, Shizuoka, Japan)
followed by incubation with an anti-rabbit immunoglobulin antibody
conjugated to horseradish peroxidase. The blots were developed using
enhanced chemiluminescence system with luminol substrate
(Amersham-Pharmacia Biotech).
Functional complementation.
The C. burnetii
HindIII recombinant library in pSKII(
) was introduced into an
E. coli rpoS null strain designated LM5005 (12) (Table 1) by transformation. Transformants were
plated on M9 plates with appropriate antibiotics and X-Gal and
contained either 0.4% or 0.04% glucose as a carbon source.
-Galactosidase activity was then assessed visually by the ability of
individual colonies to form a dark blue colony on indicator plates
under carbon starvation conditions. Plasmids from these putative
positive colonies were isolated and additionally verified by Southern
blotting for hybridization against L. pneumophila rpoS.
Those that hybridized were subjected to dideoxynucleotide sequencing.
Isolation of chromosomal and plasmid DNAs. C. burnetii Nine Mile phase I chromosomal DNA was extracted using a thermolysin-SDS procedure (41). Plasmid minipreps were prepared by the alkaline lysis procedure using a plasmid purification kits (Qiagen, Valencia, Calif.).
Separation of LCV and SCV.
LCV and SCV were separated
essentially as described previously (14, 50). Nine Mile
phase I bacteria were purified from infected yolk sacs and then
resuspended in 32% cesium chloride. The resulting C. burnetii-CsCl suspension was centrifuged at 27,000 rpm
overnight, and the separated upper (SCV) and lower (LCV) bands were
removed and pelleted by centrifugation. Both forms were resuspended in
sucrose phosphate (0.25 M sucrose, 53.9 mM
Na2HPO4, 12.8 mM KH2PO4, 72.6 mM NaCl)
buffer and stored at
80°C until use.
PCR amplification. All PCRs were carried out in a DNA thermocycler (Biometra, Tampa, Fla.) using a GenAmp kit (Perkin Elmer, Branchburg, N.J.). One-hundred-microliter reactions were carried out with Taq DNA polymerase (Perkin Elmer). Degenerate primers were purchased from Genosys Biotechnologies Inc. (The Woodlands, Tex.). Primers were designated as indicated below and used at a final concentration of 0.5 µmol per 100-µl reaction volume. The amplification procedure consisted of 30 cycles of 1 min at 95°C, 1 min at 45°C, and 1 min at 72°C. PCR products were separated in a 1% agarose gel and purified using a Geneclean kit (Bio 101, Vista, Calif.). Desired PCR products were subsequently cloned into PCR cloning vector pCR2.1-TOPO-TA (Invitrogen). Primers were as follows. For L. pneumophila rpoS cloning, primers LprpoS-F1 (5'TGAGCCAGATGATGAATCTCTG3') and LprpoS-B13 (5'TGTGTTAGTCCAACCCGCTC3') were used. For C. burnetii rpoD cloning, degenerate primers were based upon the conserved regions 2.4 and 4.2 of rpoD genes: rpo2.4.1 (5'ACNTAYGCNACNTGGTG G3'), rpo2.4.2 (5'GCNATHATGAAYCARAC3'), rpo4.2.1 (5'CCYTCNACYTGDATYTG3'), rpoD2.2 (5'GCNAARAARTAYACNAA3'), and rpoD4.2 (5'YTGYTTNCCNACYTCYTC3'). For C. burnetii RpoS-GST fusion construction, a clone of the entire CbrpoS gene was cloned by PCR into pGEX-T4 using primers Cox-rpoS-For (5'ATGAAAACAAAAACCAC3') and Cox-rpoS-Rev (5'CTCGAGTCAATCTTCCACTTCTTC3') (the underlined sequence is a XhoI restriction site). International Union of Biochemistry group codes are used to designate redundancies: R = A + G; Y = C + T; H = A + T + C; D = G + A + T; N = A + G + C + T.
Southern blotting.
Genomic DNA from C. burnetii was digested with restriction enzyme according to the
manufacturer's protocol (Boehringer Mannheim). DNAs were then
electrophoresed through 0.8% agarose gels and transferred to a
nitrocellulose membrane (39). Labeling of a DNA probe with [
-32P]dCTP was carried out using a Decaprime
II random DNA labeling kit (Ambion, Austin, Tex.). Blots were incubated
with the radiolabeled probe overnight at 65°C and then washed four
times at high stringency for 30 min each at 65°C with 0.1× SSC (1×
SSC is 0.15 M NaCl plus 0.015 M sodium citrate) containing 0.1% SDS.
Blots were analyzed for hybridization patterns using a PhosphorImager
and appropriate software (model SF; Molecular Dynamics, Sunnyvale,
Calif.).
DNA sequence analysis. All DNAs were sequenced at Gene Technologies Laboratories, Biology Department, at Texas A&M University. Sequence homologies were compared using MacVector and BLAST programs. The Baylor College of Medicine search launcher program was used to predict putative promoter regions (http://searchlauncher.bcm.tmc.edu).
Nucleotide sequence accession numbers. GenBank accession numbers for C. burnetii rpoS and rpoD are AF 244357 and AF273254, respectively.
| |
RESULTS |
|---|
|
|
|---|
Cloning of C. burnetii rpoD homologue.
There is a high degree of conservation among sigma factors. Alignment
of sigma factors from bacteria has revealed regions of strongest
conservation (24). Degenerate oligonucleotide primers based on these conserved regions (rpoD2.2 and rpoD4.2) were able to PCR
amplify a 553-bp internal region of the rpoD gene from C. burnetii, as determined by sequence analysis and
comparison with other homologues. This internal region was used as a
probe to screen a C. burnetii gene bank to identify a
clone encompassing the entire rpoD gene. Restriction mapping
by Southern hybridization of the 553-bp internal rpoD probe
with C. burnetii chromosomal digests localized the gene
to an approximately 1.9-kb EcoRI fragment (Fig.
1A, lane 1). L. pneumophila rpoD was PCR
amplified as a control (based upon 16S RNA sequence, C. burnetii has been placed in the order
"Legionellales" [10]), and this
product also hybridized to a 1.9-kb EcoRI fragment of
C. burnetii chromosomal DNA (Fig. 1B, lane 1). A
size-restricted plasmid bank was subsequently prepared by ligating 1.5- to 2.0-kb EcoRI digested C. burnetii
chromosomal DNA fragments to pSKII(
). The PCR amplified internal
rpoD region was used as a probe to screen this plasmid bank,
and a single clone was identified via colony lift hybridization. The
presence of C. burnetii rpoD was confirmed by DNA
sequencing and BLAST analysis. The C. burnetii RpoD
homologue predicts an ~70-kDa peptide (GenBank accession number
AF273254) and showed 61% identity and 74% similarity to E. coli RpoD.
|
Cloning of C. burnetii rpoS homologue.
Attempts to clone a putative rpoS homologue of C. burnetii by PCR amplification with degenerate oligonucleotide
primers were unsuccessful. To determine if C. burnetii
encodes an rpoS stationary-phase sigma factor, the
L. pneumophila rpoS gene was PCR amplified using specific primers. The L. pneumophila rpoS sequence was
generously provided by personal communication from H. A. Shuman,
Columbia University (12). This PCR fragment was cloned and
then used as a probe against C. burnetii chromosomal
DNA digested with HindIII in a Southern blot under
low-stringency conditions. Using this approach, a putative
rpoS homologue was localized to a 4-kb
HindIII fragment (Fig. 2, lane 1).
Screening a
ZapII/HindIII bacteriophage library using
the L. pneumophila rpoS as probe yielded no
rpoS-bearing clones. As an alternate approach, we opted to
attempt complementation of an E. coli rpoS null mutant
(LM5005) with a C. burnetii genomic library.
Strain LM5005, reconstructed from an original clone reported by
Weichart and colleagues (49), was obtained from H. A. Shuman (12). This strain contains an
rpoS-dependent lacZ fusion reporter (csi5::lacZ) to test for complementation of
the rpoS null phenotype with rpoS genes from
other bacterial genomes. A C. burnetii HindIII genomic library in the plasmid vector pSKII(
) was constructed and transformed into LM5005 and control strains LM5003 and LM5004 (Table 1). Putative complemented mutants were evaluated qualitatively for RpoS-induced
-galactosidase activity (due to increased
transcription of csi5::lacZ) by identifying
dark blue colonies under carbon starvation conditions.
pLM507, a plasmid bearing L. pneumophila rpoS
(12), was transformed into LM5005 to serve as positive control and, as predicted, developed dark blue colonies on M9 indicator
plates with 0.04% glucose. This was in contrast to the light blue
colonies observed when LM5005/pLM507 is grown with 0.4% glucose
(nonstarving conditions). When LM5005 was transformed with the
C. burnetii gene bank, putative
rpoS-complemented mutants were indistinguishable from
uncomplemented mutants, possibly due to the limitation of this
qualitative approach for assessing LacZ activity.
|
Catalase activity. We then added a strategy to enrich for rpoS-complemented E. coli. This involved incubation of transformants containing putative rpoS clones (after overnight recovery) in LB medium adjusted to pH 2.0 (37). Only cells complemented with rpoS homologues were predicted to survive the incubation in low-pH medium due to a requirement for an RpoS-dependent acid tolerance phenotype (43). Clones were subjected to two 45-min exposures to LB medium adjusted to pH 2.0 to enrich for clones bearing C. burnetii rpoS. Surviving clones were then screened indirectly for restored or complementing RpoS activity by assessing expression of RpoS-regulated catalase-dependent conversion of H2O2 to O2 and H2O by adding 30% hydrogen peroxide. Positive colonies evolved oxygen and hydrogen gas. This enrichment yielded 12 putative rpoS clones that demonstrated both catalase activity and acid tolerance. These clones were further analyzed by Southern blotting to determine whether the cloned inserts hybridized with the L. pneumophila rpoS, thereby identifying putative C. burnetii rpoS homologues (data not shown). Plasmids from five of the twelve putative clones hybridized to the probe, and one of these was selected for nucleotide sequencing.
Demonstration of
-galactosidase activity.
The
csi5 locus is induced during carbon starvation conditions
(49). Therefore, strains LM5005, LM5004, and LM5003 (Table 1) were cultured in minimal M9 medium supplemented with both low
(0.04%; carbon starvation) and high (0.4%; carbon source replete) glucose concentrations. To confirm complementation by C. burnetii RpoS,
-galactosidase activity was assessed
quantitatively (32) (Fig. 3). The putative
complemented strain containing C. burnetii rpoS(pR0S003) showed approximately a fivefold increase in
-galactosidase activity in comparison to an uncomplemented
rpoS null mutant (LM5005) under inducing conditions. As a
positive control, L. pneumophila rpoS, on pLM507
(H. A. Shuman [12]), was also transformed into LM5005 and demonstrated >10-fold activity under carbon
starvation.
|
DNA sequence analysis.
DNA sequence was obtained, and
subsequent BLAST comparison of the National Center for Biotechnology
Information database indicated that the C. burnetii
putative rpoS (GenBank accession number AF 244357) was
closely related to other rpoS loci. As in L. pneumophila and E. coli, homologues of the
surE and nlpD genes were found directly upstream
of rpoS (Fig. 4). However, in E. coli, surE and nlpD are separated by
pcm, which encodes protein carboxyl methyl transferase. The
promoter driving rpoS transcription is located within the
open reading frame (ORF) for nlpD, designated prpoSP1, in E. coli and is believed to be
utilized in a growth phase-dependent manner (22). This is
in addition to two nlpD promoters that contribute to a
low-level expression of rpoS in a growth phase-independent
manner. The nucleotide sequence of Coxiella rpoS revealed
potential
10 and
35 regions of the putative
70 RNA polymerase-dependent promoters
predicted by the Baylor College of Medicine search launcher program
(data not shown). The C. burnetii RpoS deduced amino
acid sequence was 47% identical and 56% similar to that of
E. coli RpoS (35) and 50% identical and
67% similar to that of L. pneumophila RpoS
(12) by ClustalW alignment (Fig. 5).
L. pneumophila RpoS showed 59.5% identity and 78.4%
similarity to that of E. coli.
|
|
Regulation of C. burnetii RpoS levels in
E. coli.
Polyclonal antibodies against
E. coli
38 and
70 were obtained from A. Ishihama (National
Institute of Genetics) (20) to evaluate expression of
recombinant C. burnetii RpoS and RpoD in E. coli. The RpoS-specific antibody did cross-react on Western blots
with an approximately 40-kDa antigen in the complemented mutant
(LM5005/pR0S003). In contrast, there was no reactivity observed with
the uncomplemented mutant (LM5005/pSKII(
)) or with the
L. pneumophila rpoS complemented mutant
(LM5005/ pLM507) (Fig. 6). The sequence
analysis suggested that C. burnetii RpoS may be
susceptible to the transcriptional and posttranscriptional regulatory
mechanisms described for E. coli RpoS. To examine
C. burnetii RpoS levels in E. coli,
culture lysates prepared from mutant strains cultured for different
time periods to represent stages of growth from early log to stationary phase were compared (adjusted to an optical density of 600 nm of 0.3)
with E. coli wild-type strains. Western blot analysis with an anti-E. coli
38
polyclonal indicated that a stable C. burnetii RpoS was
expressed at 8 h of growth (Fig. 7), and in
overnight cell culture lysates (data not shown), i.e., at the onset of
stationary phase, a pattern similar to the
38
induction pattern was observed in wild-type E. coli culture lysates and was also comparable to the regulation
seen in L. pneumophila log- and stationary-phase
cultures (12, 20).
|
|
Examination of RpoS level in C. burnetii
lysates.
Polyclonal antibody against E. coli
70 cross-reacted with a 70-kDa antigen in
C. burnetii cell lysates (data not shown). The polyclonal antibody against E. coli
38 cross-reacted with a 40-kDa antigen in
C. burnetii cell lysates, but in an inconsistent
manner. To obtain a more sensitive and reliable C. burnetii-specific antibody, the rpoS gene from
C. burnetii was cloned in frame into a prokaryotic GST
fusion expression vector in a two-step cloning strategy. To
verify construction and expression of the GST-RpoS fusion,
E. coli BL21(DE3) containing this plasmid (pR0S106) and
suitable negative controls (alternative out-of-frame clones, pR0S107
and pR0S108) were IPTG induced, and culture lysates were separated by
SDS-PAGE, Western blotted, and probed with an anti-GST antibody (data
not shown). This analysis confirmed that a fusion protein of the
predicted size (~70 kDa) was being expressed by pR0S106 and not by
the negative controls that expressed GST alone (30 kDa).
|
|
Differential expression of RpoS.
To determine differential
expression of RpoS, C. burnetii was purified from
infected J774 mouse macrophages. SCV and LCV were then
separated by 32% cesium chloride isopycnic gradient centrifugation. Whole-cell lysates of each form were then separated by SDS-PAGE and
subsequently analyzed by immunoblot using serum specific for C. burnetii RpoS (anti-GST-CbRpoS serum). The amounts
of total protein of LCV and SCV applied to each lane were comparable,
and several other antigens were detected by specific antiserum as controls, including ScvA (SCV specific) (16) (Fig.
10C), Com-1 (not differentially expressed) (data not
shown), and RpoD (predicted to be not differentially expressed)
(Fig. 10A). RpoS level was found to be dramatically upregulated in the
LCV and barely detectable in the SCV (Fig. 10B). This result strongly
suggested that LCV and SCV are not representative of bacterial forms in
logarithmic and stationary phases of growth.
|
| |
DISCUSSION |
|---|
|
|
|---|
LCV and SCV differentially express proteins that appear specific for a unique role for each form in a developmental life cycle of C. burnetii. A description of these differentially expressed proteins should provide evidence for a more accurate model of this life cycle. A reverse genetic approach was used to identify two LCV-specific or upregulated translation factors, EF-Tu and EF-Ts (45). A comparison of DNA-binding proteins demonstrated that the histone-like protein Hq-1 was SCV specific (14). These findings led to the hypothesis that LCV and SCV are similar to log- and stationary-phase growth forms, respectively (15, 40). Earlier comparisons of metabolic activity and morphology are also consistent with this hypothesis (28, 30). To test this hypothesis, we identified and characterized a homologue of the stationary-phase transcription factor, RpoS. Western blot comparison of SCV and LCV demonstrated that SCV do not contain significant amount of RpoS, while abundant RpoS was detected in LCV.
We initially attempted to PCR amplify sigma factor homologues of
C. burnetii by comparing alignment of sigma factors
from other bacteria and designing degenerate primers from regions of strong conservation. An internal region of a C. burnetii
rpoD homologue was cloned by PCR amplification with degenerate
primers (24). Cloning of an rpoS homologue
based on degenerate oligonucleotide PCR was not successful. As an
alternate strategy, the L. pneumophila (the
phylogenetically closest pathogen to C. burnetii)
rpoS gene was PCR amplified and shown to hybridize with a
4-kb HindIII fragment of C. burnetii
chromosomal DNA, suggesting that C. burnetii may possess an rpoS. An L. pneumophila rpoS
homologue has recently been cloned by complementation of an
E. coli rpoS null mutation in a strain that has an
rpoS-dependent csi5::lacZ fusion
(12). We obtained this rpoS null strain and
adopted a similar strategy to attempt cloning of a C. burnetii rpoS gene. One potential problem in the application of
this strategy was that partial complementation by C. burnetii RpoS could render
-galactosidase activity due to
restored RpoS function indistinguishable from background
-galactosidase activity in a qualitative assay. To overcome this
problem, an enrichment step was added where transformed mutants able to
survive acid stress were selected and then screened for RpoS-dependent catalase activity. LM5005 (the E. coli rpoS null
strain), when complemented with L. pneumophila
rpoS(pLM507) (Table 1), did exhibit a distinctive dark blue color,
in contrast to an uncomplemented mutant, under carbon starvation
conditions. This observation was consistent with results from
experiments examining
-galactosidase activity quantitatively. The
specific activity of the L. pneumophila rpoS-complemented mutant showed a 10-fold induction, compared with
only a 5-fold induction in the C. burnetii
rpoS-complemented mutant. We speculate that the stronger
functional complementation by L. pneumophila rpoS
relative to C. burnetii may be due to (i) closer
sequence similarity between L. pneumophila and
E. coli RpoS (60% identity and 78% similarity)
compared with C. burnetii RpoS (only 47% identity and
56% similarity with E. coli RpoS) or (ii) the
C. burnetii RpoS lysine-rich N terminus.
Our current model of sigma factor regulation comes from studies
performed with several organisms, including E. coli and
Salmonella spp. These studies demonstrated that the
expression of sigma factor (
s) protein encoded
by rpoS was extremely low in rapid exponential growth but
increased markedly upon entry into stationary phase and was required
for the induction of more than 30 genes (20, 27). A recent
study suggested that sigma factors compete for a limiting amount of RNA
polymerase during stationary phase (9). An extensive and
complex set of mechanisms for regulating expression of RpoS levels
under different conditions exist (5, 18, 25, 26, 33, 36, 48,
51). C. burnetii RpoS levels increased in
response to entry into stationary phase in the E. coli
null mutant, indicating susceptibility to E. coli
regulatory mechanisms and indirectly suggesting that similar pathways
in C. burnetii for regulating intracellular RpoS levels
exist. The major level of regulation in E. coli appears
to be posttranscriptional. Some stationary-phase-induced genes also
require RpoD for their induction. Sequence analysis of mRNA control
elements in C. burnetii rpoS suggests that it may
possess some of the same regulatory signals as in E. coli. In E. coli, DsrA RNA regulates the
translation of RpoS message by an antiantisense mechanism
(25). The sequence of the first stem-loop of DsrA
RNA is complementary to the upstream leader of rpoS
mRNA and helps to free the translation initiation region from the
cis-acting antisense RNA, thereby allowing translation to
occur. A region of the DsrA RNA corresponding to the first stem-loop
shows complementarity to a region in the rpoS ORF from C. burnetii (data not shown). RpoS proteolysis after
translation is also important for maintaining very low levels in
exponentially growing bacteria. This regulated degradation mediated by
ClpXP protease is facilitated by a response regulator, RssB. RssB
interacts with a turnover element recently characterized around a
crucial amino acid, lysine-173 (6). This
proteolysis-promoting motif was found to be conserved in the predicted
amino acid sequence for C. burnetii RpoS.
A unique aspect of the C. burnetii RpoS was its highly basic pI of 9.6 (in contrast to 4.6 for E. coli RpoS). C. burnetii RpoD also has an unusually high pI. Observations in our laboratory of protein profiles of C. burnetii cell lysates separated on two-dimensional gels show a predominance of proteins with high pI (K. Kiss, personal communication). We speculate that because of the low pH (~4.8) of the environment in which C. burnetii resides, many of the cytoplasmic proteins have been adapted to provide a proton "sink" for buffering protons that passively enter the cell. Hackstadt showed that the cytoplasm of C. burnetii was neutral and a significant proton motive force was maintained (11).
Contrary to our expectations, C. burnetii RpoS expression was upregulated by the LCV rather than the SCV, suggesting that this alternate sigma factor may have no role in regulating the transition from LCV to SCV cell type or in regulating expression of SCV-specific genes. It is possible that an additional alternate sigma factor could control SCV-specific genes. Western blot analysis with antibody against several sigma factors reacted only with RpoD, RpoS, a potential 54-kDa sigma factor (not cloned), and a 28-kDa sigma factor (RpoH) (J. Seshu, personal communication), but other sigma factors may remain undetected.
What is the function of the C. burnetii RpoS? Genomic studies with R. prowazekii and Chlamydia spp. demonstrated that these obligate organisms do not carry typical rpoS genes and have lost extensive coding capacity through gene deletion and mutation for functions common to extracellular bacteria. C. burnetii has adapted to thrive in a unique intracellular niche distinct from other intracellular bacteria. RpoS roles have been known to vary among organisms. L. pneumophila RpoS was recently shown to not be required for stationary-phase-dependent resistance to stress (12). These data suggested that L. pneumophila RpoS regulates genes required for survival in a protozoan host, quite different from what has been reported for E. coli RpoS. In Salmonella, KatF (same as RpoS) mutants had significantly reduced virulence in mice (8), and KatF is implicated in the initial invasion and colonization of the gut. Yersinia enterocolitica RpoS is required for the expression of a heat-stable enterotoxin yet has no role in promoting virulence in mice (4, 19). Vibrio cholerae rpoS mutants are stress sensitive and show reduced expression of hemagglutinin and protease, but the mutation has no effect on the ability of V. cholerae to colonize mice (52). Perhaps the C. burnetii RpoS plays a role in mediating transition from SCV to LCV (instead of LCV to SCV) in response to signals perceived in the phagolysosomal compartment, although this seems counterintuitive considering the apparent resemblance between these forms and log- and stationary-phase organisms. Alternatively, this sigma factor may solely regulate genes involved in surviving stresses in metabolically active LCV. Identification and confirmation of RpoS-regulated genes from C. burnetii using an E. coli strain expressing C. burnetii RpoS would provide insight into the role of inducible genes in intracellular survival.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant AI37744 from the National Institute of Allergy and Infectious Diseases.
We thank Howard A. Shuman (Columbia University) for his generous gift of L. pneumophila rpoS sequence and strains, Akira Ishihama (National Institute of Genetics) for E. coli anti-Rpo antibodies, and Larry Harris-Haller (Gene Technology Labs, Texas A&M University) for sequence analysis. We thank Jon Skare for critical review of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Medical Microbiology and Immunology, 407 Reynolds Medical Building, Texas A&M University System Health Sciences Center, College Station, TX 77843-1114. Phone: (979) 862-1684. Fax: (979) 845-3479. E-mail: jsamuel{at}tamu.edu.
Editor: B. B. Finlay
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Amano, K., and J. C. Williams.
1984.
Sensitivity of Coxiella burnetii peptidoglycan to lysosome hydrolysis and correlation of sacculus rigidity with peptidoglycan-associated proteins.
J. Bacteriol.
160:989-993 |
| 2. |
Amano, K.,
J. C. Williams,
T. E. McCaul, and M. G. Peacock.
1984.
Biochemical and immunological properties of Coxiella burnetii cell wall and peptidoglycan-protein complex fractions.
J. Bacteriol.
160:982-988 |
| 3. | Andersson, A., A. Zomorodipour, and J. Andersson. 1999. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 247:713-719. |
| 4. |
Badger, J., and V. I. Miller.
1995.
Role of RpoS in survival of Yersinia enterocolitica to a variety of environmental stresses.
J. Bacteriol.
177:5370-5373 |
| 5. |
Barth, M.,
C. Marshall,
A. Muffler,
S. Fischer, and R. Hengge-Aronis.
1995.
Role for the histone-like protein H-NS in growth phase-dependent and osmotic regulation of s and many s-dependent genes in Escherichia coli.
J. Bacteriol.
177:3455-3464 |
| 6. |
Becker, G.,
E. Klauck, and R. Hengge-Aronis.
1999.
Regulation of RpoS proteolysis in Escherichia coli: the response regulator RssB is a recognition factor that interacts with the turnover element in RpoS.
Proc. Natl. Acad. Sci. USA
96:6439-6444 |
| 7. | Davis, G. E., and H. R. Cox. 1938. A filter-passing infectious agent isolated from ticks. I. Isolation from Dermacentor andersonii, reactions in animals, and filtration. Public Health Rep. 53:2259. |
| 8. |
Fang, F. C.,
S. J. Libby,
N. A. Buchmeier,
P. C. Loewen,
J. Switala,
J. Harwood, and D. G. Guiney.
1992.
The alternate factor KatF (RpoS) regulates Salmonella virulence.
Proc. Natl. Acad. Sci. USA
89:11978-11982 |
| 9. | Farewell, A., K. Kvint, and T. Nystrom. 1998. Negative regulation by RpoS: a case of sigma factor competition. Mol. Microbiol. 29:1039-1051[CrossRef][Medline]. |
| 10. | Garrity, G. M. (ed.). Bergey's manual of systematic bacteriology, 2nd ed., vol. 2, in press. Springer-Verlag, New York, N.Y. |
| 11. |
Hackstadt, T.
1983.
Estimation of the cytoplasmic pH of Coxiella burnetii and effect of substrate oxidation on proton motive force.
J. Bacteriol.
154:591-597 |
| 12. |
Hales, L. M., and H. A. Shuman.
1999.
The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii.
J. Bacteriol.
181:4879-4889 |
| 13. | Heinzen, R. A. 1997. Intracellular development of Coxiella burnetii, p. 99-129. In B. Anderson, M. Bendinelli, and H. Friedman (ed.), Rickettsial infection and immunity. Plenum Press, New York, N.Y. |
| 14. |
Heinzen, R. A., and T. Hackstadt.
1996.
A developmental stage-specific histone H1 homolog of Coxiella burnetii.
J. Bacteriol.
178:5049-5052 |
| 15. | Heinzen, R. A., T. Hackstadt, and J. E. Samuel. 1999. Developmental biology of Coxiella burnetii. Trends Microbiol. Sci. 7:149-154. |
| 16. | Heinzen, R. A., D. Howe, L. P. Mallavia, D. D. Rockey, and T. Hackstadt. 1996. Developmentally regulated synthesis of an unusually small, basic peptide by Coxiella burnetii. Mol. Microbiol. 22:9-19[CrossRef][Medline]. |
| 17. |
Hengge-Aronis, R.
1993.
Back to log phase: s as a global regulator in the osmotic control of gene expression in Escherichia coli.
Mol. Microbiol.
21:887-893.
|
| 18. | Hengge-Aronis, R. 1996. Regulation of gene expression during entry into stationary phase, p. 1497-1512. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 19. | Iriarte, M., I. Stainier, and G. R. Cornelis. 1995. The rpoS gene from Yersinia enterocolitica and its influence on expression of virulence factors. Infect. Immun. 63:1840-1847[Abstract]. |
| 20. |
Jishage, M., and A. Ishihama.
1995.
Regulation of RNA polymerase sigma subunit synthesis in Escherichia coli: intracellular levels of 70 and 38.
J. Bacteriol.
177:6832-6835 |
| 21. | Kalman, S., W. Mitchell, R. Marathe, C. Lammel, J. Fan, R. W. Hyman, L. Olinger, J. Grimwood, R. Davis, and R. S. Stephens. 1999. Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nat. Genet. 21:385-389[CrossRef][Medline]. |
| 22. |
Lange, R.,
D. Fischer, and R. Hengge-Aronis.
1995.
Identification of transcriptional start sites and the role of ppGpp in the expression of rpoS, the structural gene for the s subunit of RNA polymerase in Escherichia coli.
J. Bacteriol.
177:4676-4680 |
| 23. | Loewen, P. C., H. Bei, J. Strutinsky, and R. Sparling. 1998. Regulation in the rpoS regulon of Escherichia coli. Can. J. Microbiol. 44:707-717[CrossRef][Medline]. |
| 24. |
Lonetto, M.,
M. Gribskov, and C. A. Gross.
1992.
The 70 family: sequence conservation and evolutionary relationships.
J. Bacteriol.
174:3843-3849 |
| 25. |
Majdalani, N.,
C. Cunning,
D. Sledjeski,
T. Elliott, and S. Gottesman.
1998.
DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription.
Proc. Natl. Acad. Sci. USA
95:12462-12467 |
| 26. |
McCann, M. P.,
C. D. Fraley, and A. Matin.
1993.
The putative factor KatF is regulated posttranscriptionally during carbon starvation.
J. Bacteriol.
175:2143-2149 |
| 27. |
McCann, M. P.,
J. P. Kidwell, and A. Matin.
1991.
The putative factor KatF has a central role in development of starvation-mediated general resistance in Escherichia coli.
J. Bacteriol.
173:4188-4194 |
| 28. | McCaul, T. F. 1991. The developmental cycle of Coxiella burnetii, p. 223-258. In J. C. Williams, and H. A. Thompson (ed.), Q fever: the biology of Coxiella burnetii. CRC Press, Boca Raton, Fla. |
| 29. |
McCaul, T. F.,
N. Banerjee-Bhatnagar, and J. C. Williams.
1991.
Antigenic differences between Coxiella burnetii cells revealed by postembedding immunoelectron microscopy and immunoblotting.
Infect. Immun.
59:3243-3253 |
| 30. | McCaul, T. F., T. Hackstadt, and J. C. Williams. 1981. Ultrastructural and biological aspects of Coxiella burnetii under physical disruptions, p. 267. In W. Burgdorfer, and R. L. Anacker (ed.), Rickettsiae and rickettsial diseases. Academic Press, New York, N.Y. |
| 31. |
McCaul, T. F., and J. C. Williams.
1981.
Developmental cycle of Coxiella burnetii: structure and morphogenesis of vegetative and sporogenic differentiations.
J. Bacteriol.
147:1063-1076 |
| 32. | Miller, J. H. 1972. Experiments in molecular biology. Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y. |
| 33. |
Muffler, A.,
D. Fischer, and R. Hengge-Aronis.
1996.
The RNA-binding protein HF-I, known as a host factor for phage Q RNA replication, is essential for rpoS translation in Escherichia coli.
Gene Dev.
10:1143-1151 |
| 34. |
Muffler, A.,
D. D. Traulsen,
S. Altuvia,
G. Storz, and R. Hengge-Aronis.
1996.
The response regulator RssB controls stability of the s subunit of RNA polymerase in Escherichia coli.
Mol. Microbiol.
15:1333-1339.
|
| 35. |
Mulvey, M. R., and P. C. Loewen.
1989.
Nucleotide sequence of katF of Escherichia coli suggest KatF protein is a novel transcription factor.
Nucleic Acids Res.
17:9979-9991 |
| 36. |
Paesold, G., and M. Krause.
1999.
Analysis of rpoS mRNA in Salmonella dublin: identification of multiple transcripts with growth-phase-dependent variation in transcript stability.
J. Bacteriol.
181:1264-1268 |
| 37. | Prince, R. W., Y. S. Xu, S. J. Libby, and F. C. Fang. 1994. Cloning and sequencing of the gene encoding the RpoS sigma factor from Salmonella typhimurium 14028s. Biochim. Biophys. Acta 1219:198-200[Medline]. |
| 38. | Rosenberg, M., and N. Kordova. 1960. Study of intracellular forms of Coxiella burnetii in the electron microscope. Acta Virol. 4:52-61[Medline]. |
| 39. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 40. | Samuel, J. E. 2000. Development of Coxiella, p. 427-440. In Y. V. Brun, and L. J. Skimkets (ed.), Prokaryotic development. ASM Press, Washington, D.C. |
| 41. |
Samuel, J. E.,
M. E. Frazier,
M. L. Kahn,
L. S. Thomashow, and L. P. Mallavia.
1983.
Isolation and characterization of a plasmid from phase I Coxiella burnetii.
Infect. Immun.
41:488-493 |
| 42. |
Samuel, J. E.,
M. E. Frazier, and L. P. Mallavia.
1985.
Correlation of plasmid type and disease caused by Coxiella burnetii.
Infect. Immun.
49:775-779 |
| 43. |
Schellhorn, H. E.,
J. P. Audia,
L. I. C. Wei, and L. Chang.
1998.
Identification of conserved, RpoS-dependent stationary-phase genes of Escherichia coli.
J. Bacteriol.
180:6283-6291 |
| 44. |
Schweder, T.,
K. Lee,
O. Lomovskaya, and A. Matin.
1996.
Regulation of Escherichia coli starvation sigma factor ( s) by ClpXP protease.
J. Bacteriol.
178:470-476 |
| 45. |
Seshadri, R.,
L. R. Hendrix, and J. E. Samuel.
1999.
Differential expression of translational elements by life cycle variants of Coxiella burnetii.
Infect. Immun.
67:6026-6033 |
| 46. | Silhavy, T. J., M. J. Berman, and L. W. Enquist. 1984. Experiments with gene fusions, p. 107-112. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 47. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 48. | Webb, C., M. Moreno, M. Wilmes-Riesenberg, R. Curtiss, III., and J. W. Foster. 1999. Effects of DksA and ClpP protease on sigma S production and virulence in Salmonella typhimurium. Mol. Microbiol. 34:112-123[CrossRef][Medline]. |
| 49. | Weichart, D., R. Lange, N. Henneberg, and R. Hengge-Aronis. 1993. Identification and characterization of stationary phase-inducible genes in Escherichia coli. Mol. Microbiol. 10:407-420[CrossRef][Medline]. |
| 50. |
Wiebe, M. E.,
P. R. Burton, and D. M. Shankel.
1972.
Isolation and characterization of two cell types of Coxiella burnetii.
J. Bacteriol.
110:368-377 |
| 51. |
Yamashino, T.,
C. Ueguchi, and T. Mizuno.
1995.
Quantitative control of the stationary phase-specific sigma factor, s, in Escherichia coli: involvement of the nucleoid protein H-NS.
EMBO
14:594-602[Medline].
|
| 52. | Yildiz, F. H., and G. K. Schoolnik. 1998. Role of rpoS in stress survival and virulence of Vibrio cholerae. J. Bacteriol. 18:773-784. |
This article has been cited by other articles:
| ||||||||||||||||||||||||