Previous Article | Next Article ![]()
Infection and Immunity, August 2001, p. 5037-5045, Vol. 69, No. 8
Channing Laboratory1 and
Division of Infectious Diseases,6
Department of Medicine, and Department of Newborn
Medicine,2 Brigham and Women's Hospital, and
Division of Newborn Medicine, Children's
Hospital,3 Harvard Medical School, and
Department of Biostatistics, Harvard School of Public
Health,5 Boston, Massachusetts, and
Department of Microbiology, University of Alabama, Birmingham,
Alabama4
Received 12 March 2001/Returned for modification 7 May
2001/Accepted 11 May 2001
Group B streptococci (GBS) contain a family of protective surface
proteins characterized by variable numbers of repeating units within
the proteins. The prototype alpha C protein of GBS from the type Ia/C
strain A909 contains a series of nine identical 246-bp tandem repeat
units. We have previously shown that deletions in the tandem repeat
region of the alpha C protein affect both the immunogenicity and
protective efficacy of the protein in animal models, and these
deletions may serve as a virulence mechanism in GBS. The molecular
mechanism of tandem repeat deletion is unknown. To determine whether
RecA-mediated homologous recombination is involved in this process, we
identified, cloned, and sequenced the recA gene
homologue from GBS. A strain of GBS with recA
deleted, A909 Group B Streptococcus
(GBS) is a leading cause of meningitis, pneumonia, and sepsis in
neonates. There is some evidence that heavy maternal colonization by
GBS contributes to premature birth (3, 39). GBS has also
been frequently noted to cause invasive infections in women as a
complication of childbirth and in other adults who are immunologically
impaired by liver disease, diabetes, or malignancy (15,
61). Recent Centers for Disease Control and Prevention
surveillance data demonstrate that although the widespread use of
intrapartum antibiotic prophylaxis has decreased the incidence of
early-onset neonatal GBS disease, this practice has not impacted
late-onset neonatal disease or adult disease. Premature infants and
adults over age 65 continue to show high case fatality rates from GBS
disease (52).
The alpha C protein is a surface protein present in the majority of
non-type III GBS. Similar proteins have recently been identified in
type III and type V strains (30, 31, 54). Antibodies to
these surface proteins have been demonstrated to be protective
against infection in animal models (18). The gene for the alpha C protein (bca) from the prototype type Ia/C
strain A909 includes a series of nine tandem repeats of 246 bp
that are identical at the nucleotide level (40).
The molecular weight of the alpha C protein in clinical isolates has
been shown to vary widely, with the size differences due to different
numbers of tandem repeat units within the protein (35,
36). Significantly, alpha C protein size has been noted to vary
in paired mother/infant isolates (20). Furthermore, we
have demonstrated in a mouse model of infection that in the presence of
antibody to one size of alpha C protein, mutant GBS strains arise that
express smaller-size alpha C proteins on the surface and thus escape
from the immune response. The genes for the smaller proteins have
precise deletions of repeat elements (36). The change in
the number of repeats and in the size of the protein alters the
antigenicity of the alpha C protein and the virulence of the strain in
the presence of antibody (19). Tandem repeat deletion in
the alpha C protein allows antigenic variation and may thus serve as a
virulence mechanism in GBS.
The mechanism by which excision of tandem repeat units in the
bca gene is accomplished is unknown. Identification of the
molecular factors involved in tandem repeat deletion is of broader
interest, since tandem repeat sequences of DNA are found in both
prokaryotic and eukaryotic genomes. Tandem repeat sequences in
eukaryotic genomes are often found in noncoding regions, and variation
in these sequences has been associated with a variety of human
diseases, such as myotonic dystrophy, Huntington's disease, fragile X
syndrome, and colon cancer (58, 59). In prokaryotes,
variation in short sequence tandem repeats, such as those present in
the promoter region of the Haemophilus influenzae hifA/B
fimbriae genes (60), in the 5' coding region of the
H. influenzae lic1 genes (63), which are
involved in lipopolysaccharide synthesis, and in the Neisseria
gonorrhoeae opa gene, which encodes opacity proteins (55), can regulate gene expression. In addition, an
increasing number of bacterial, fungal, and protozoal antigens have
been identified that have larger tandem repeat motifs within the coding regions of the associated genes, such as the alpha-like proteins of GBS
(30, 62), the Esp protein of Enterococcus
faecalis (53), the M proteins of group A
Streptococcus (GAS) (22), the
120-kDa major glycoprotein of Blastomyces dermatitidis
(25), the 190-kDa surface antigen of Rickettsia
rickettsi (4), the ALS proteins of Candida
albicans (24), the P270 protein of Trichomonas vaginalis (43), and the shed proteins of
Trypanosoma cruzi (11).
Variation in short sequence repeats, such as in the CAAT motif found in
the H. influenzae lic gene and in the CTCTT motif found in
the Neisseria meningitidis opa gene, is attributed to a
RecA-independent strand-slippage mechanism (23, 32, 42). Intermolecular crossover events between identical or near-identical longer stretches of DNA in bacteria, however, are highly dependent on
RecA-mediated homologous recombination, and it is possible that tandem
repeat deletion within the alpha C protein takes place by a similar
RecA-mediated intramolecular crossover mechanism. RecA is a highly
conserved ATP-binding protein that mediates pairing of homologous
stretches of DNA and catalyzes the formation of heteroduplex structures
(48). RecA gene homologues have been identified in more
than 60 bacterial species. Although RecA is thought to be essential in
all pathways of bacterial homologous recombination, both RecA-dependent
and RecA-independent tandem repeat deletion has been observed in
Escherichia coli (5, 6, 33, 34).
To begin to understand the mechanism of tandem repeat deletion in GBS,
we identified and cloned the recA homologue in GBS. We
constructed A909 Amplification of a portion of the GBS recA
gene.
To identify the recA gene, degenerate PCR primers
designed to anneal to highly conserved regions of the
recA gene from other bacterial species (14)
were used to amplify a 320-bp fragment from GBS genomic DNA by PCR. The
following primers were used: primer A, 5'
CGTAAGCTTYATHGAYGCNGARCAYGC 3'; primer B, 5'
CTCAAGCTTGRTTDATRAADATNGC 3'. The amplified fragment was
cloned in vector pCR2 (Invitrogen) and sequenced. The fragment was
identified as a portion of the GBS recA gene by sequence
homology with the previously identified recA gene in GAS
(57).
Creation of GBS cosmid library.
Genomic DNA was prepared
from type Ia/C strain A909 as previously described (36).
To create the cosmid library, genomic DNA was partially digested with
Sau3AI at 37°C for 15 min, followed by heating to
inactivate the enzyme. Cosmid vector pHC79 (21) was
digested with BamHI and ligated to the partially digested genomic DNA. The ligation mixture was packaged with a commercial lambda
packing extract (Gigapack III Gold; Stratagene). The cosmid library
titer was 3 × 105/ml.
Isolation of the recA gene from the cosmid
library.
To isolate the recA gene, the library was
plated on 20 Luria-Bertani plates containing 100 µg of
ampicillin/ml at a density of 200 to 500 colonies per plate, and the
colonies were transferred to nylon membranes (Genescreen; Dupont).
Colony blotting was carried out with standard methods
(49), using a rotisserie oven and a hybridization
temperature of 42°C. The 320-bp PCR product was labeled with
[32P]dCTP with a random primer kit (Gibco-BRL)
and added to the hybridization solution at a final concentration of
106 cpm/ml. The membranes were washed once at low
stringency and then twice in 0.1× SSC (1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate)-0.5% sodium dodecyl sulfate (SDS) at 42°C
for 20 min and exposed to X-ray film at Identification of the full-length recA gene.
Comparison of the sequence contained within pKPRA3 with the
recA sequence of GAS revealed significant homology but
indicated that the cosmid fragment did not contain the full-length
recA. PCR primer K1 (5' CAAATCAAGGGGACTGGTGAGCAT
3') was designed for the sequence at the 3' end of the
recA cosmid sequence, and primer K2
(5'TTAATCTTCAATTTCAATACCATTATCTAAAT 3') was designed for the sequence immediately outside the stop codon of the GAS recA
sequence (58). An annealing temperature of 45°C was used
to amplify an approximately 400-bp fragment from GBS genomic DNA. To
confirm the entire recA sequence, a full-length
recA PCR product was generated with primer 5'
CGTCGAAAAGCCTTAGATGATGCT 3' and primer 5'
TAAGTTCCAACCACTGTCAGAACT 3' with an annealing temperature of
55°C and extension time of 90 s. Pooled PCR products from both
reactions were sequenced as described below.
Cloning of an internal fragment of the recA gene
into pJRS233.
An internal 603 bp of the recA sequence
was amplified from GBS genomic DNA with primers corresponding to the
amino acid sequences HALDPAYA (5' CACGCTCTTGACCCAGCCTATGC
3') and AGAWYSYN (5' CATTATATGAGTACCATGCACCTGC 3').
The PCR product was ligated into vector pCR2 by the Topo-cloning method
(Invitrogen), following the manufacturer's instructions. The
recombinant plasmid was digested with BamHI and
XhoI, and the insert was gel purified using a gel extraction
column (Qiagen) and ligated into pJRS233, which had been digested with
BamHI and XhoI. The recombinant plasmid was named pKP600.
Transformation of pKP600 into GBS.
Competent GBS were
prepared as previously described (13). The bacteria were
transformed with pKP600 by electroporation (Bio-Rad Gene Pulser;
settings, 1.5 kV, 400 UV light sensitivity assay.
Single colonies of bacteria were
inoculated into THB in the presence or absence of ERY and grown
overnight at 37°C. The cultures were diluted 1:100 in fresh THB and
grown to an optical density at 650 nm of 0.4. The cultures were diluted
1:10,000, and 0.1 ml was plated on BAP. Plates of wild-type A909 GBS
and potential mutants were simultaneously placed on a shortwave UV
light box (Fotodyne) for 5, 10, 20, and 30 s. The plates were
incubated at 37°C for 16 h, and the CFU were counted at each
exposure time and compared with control plates that were not exposed to
UV light.
Immune mouse model of infection.
CD-1 outbred mice (adult
female, 6 to 8 weeks old; Harlan Laboratory) were given 0.25 ml of
rabbit antiserum raised to the nine-repeat alpha C protein, or
nonimmune serum as a control, by intraperitoneal injection. Twenty-four
hours after injection, the mice were given 106 to
107 CFU of bacteria suspended in 0.5 ml of THB by
intraperitoneal injection. Twenty-four hours after bacterial injection,
the mice were sacrificed in CO2, and their
spleens were immediately removed and homogenized in phosphate-buffered
saline, pH 7.0. Mice given nonimmune serum were found dead at 24 h
after bacterial injection. The splenic homogenates were directly plated
on BAP and grown at 37°C overnight.
Sequencing of bca from splenic isolates.
Sequencing of the repeat region of bca, the gene encoding
the alpha C protein, was accomplished by PCR amplification of the complete alpha C protein using primers 5' GGTGGACAAGAAAAAGTTCTC 3'
and 5' TGTTCACACCAATAAATGGTGA 3', with an annealing
temperature of 60°C and extension time of 90 s, using DNA
isolated from a single colony of each isolate by the protoplast method
(12). The pooled product was purified and sequenced as
described below. Sequencing primers used were 5'
GTAAAATTGTTGAGGTTAAT 3' and 5' GGTAGTTTATTTCCTTTACCG
3'.
Southern blots.
Southern blotting was performed as
previously described (36). Probes were prepared using the
ECL chemiluminescence direct nucleic acid labeling and detection kit
(Amersham) following the manufacturer's instructions.
Western blots.
Bacteria were grown in THB (plus ERY for the
A909 Screening for spontaneous tandem repeat deletion in the alpha C
protein.
A909 and A909 PCRs.
Reactions were carried out with PCR Supermix
(Gibco-BRL) with a 0.4 µM primer concentration in a thermocycler
(Perkin-Elmer) using a cycle program as follows: initial denaturation
at 94°C for 5 min, 35 cycles with denaturation at 94°C for 30 s, annealing temperature as indicated for 30 s and extension at
72°C for 30 to 90 s as indicated, and a final extension step at
72°C for 7 min, followed by cooling to 4°C. Template DNA was either
purified genomic DNA or DNA prepared from single bacterial colonies by the protoplast method reaction (12).
Reverse transcriptase PCR (RT-PCR).
Bacterial cultures were
grown to an approximate optical density at 650 nm of 0.400 in THB,
pelleted, and resuspended in 25% glucose-Tris-EDTA (pH 8.0)
containing 2.5 mg of lysozyme/ml and 167 µg of mutanolysin/ml, and
incubated at room temperature for 10 min. The bacteria were then
pelleted, and total RNA isolation was carried out using the RNeasy kit
(Qiagen). After treatment with DNase I (Gibco-BRL), the integrity of
the RNA was assessed by denaturing agarose gel to ensure that no
significant degradation of the RNA had occurred. RT-PCRs were carried
out using the One-Step RT-PCR kit (Qiagen), using 0.8 to 1.0 µg of
total RNA per reaction. All reactions were carried out with a 0.6 µM
primer concentration in a thermocycler (Perkin-Elmer) using a cycle
program as follows: reverse transcription at 50°C for 30 min and
denaturation at 95°C for 15 min, followed by 35 cycles as described
above for PCRs.
Sequencing reactions and facilities.
Direct sequencing from
pooled PCR product or sequencing from cloned DNA was performed with an
automated fluorescent dideoxy sequencing system (Applied Biosystems)
through the Brigham and Women's Hospital Automatic Sequencing and
Genotyping Facility and the Beth Israel-Deaconess Medical Center
Molecular Medicine Sequencing Facility. Direct PCR product sequencing
was carried out from product pooled from 5 to 8 separate PCRs; the
pooled product was purified over a PCR purification column (Qiagen) to remove unincorporated primer and deoxynucleoside triphosphates.
Statistical analyses.
Alpha C protein Western blot phenotype
data were obtained on 24 mice, with 1 to 124 isolates obtained per
mouse. The isolate data were classified into nine-repeat, deletion, and
null phenotypes. The primary analysis concerned the association between
the A909 Nucleotide sequence accession number.
The complete
recA sequence has been deposited in the GenBank database
under accession number AF307982.
Identification and cloning of the recA gene of
GBS.
Using PCR primers designed to anneal to highly conserved
regions of recA from other bacterial species
(14), a 320-bp fragment was amplified from GBS genomic
DNA. Using the PCR product as probe, a single band was seen on a
Southern blot of GBS DNA digested with several restriction enzymes,
indicating the presence of a single recA gene in GBS. To
isolate the entire GBS recA gene, the PCR product was used
to screen a cosmid library of GBS genomic DNA. A cosmid containing a
partial recA sequence was identified; PCR methods were used
to obtain the full-length sequence. An alignment of the deduced RecA
amino acid sequences from GBS, GAS, Streptococcus pneumoniae, and E. coli reveals that the GBS sequence
is 88% identical to that of GAS, 79% identical to that of the
pneumococcus, and 55% identical to that of E. coli
(44, 50, 57).
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.8.5037-5045.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Tandem Repeat Deletion in the Alpha C Protein of
Group B Streptococcus Is recA
Independent
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
recA, was constructed by
insertional inactivation in the recA locus.
A909
recA demonstrated significant sensitivity to UV
light, and the 50% lethal dose of the mutant strain in a mouse intraperitoneal model of sepsis was 20-fold higher than that of the
parent strain. The spontaneous rate of tandem repeat deletion in the
alpha C protein in vitro, as well as in our mouse model of immune
infection, was studied using A909
recA. We report that tandem repeat deletion in the alpha C protein does occur in the absence
of a functional recA gene both in vitro and in vivo,
indicating that tandem repeat deletion in GBS occurs by a
recA-independent recombinatorial pathway.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
recA, a strain in which the
recA gene is functionally deleted by insertional
inactivation. We compared the rate of spontaneous deletion in A909 with
that in A909
recA in vitro and compared the strains in our
mouse model of GBS infection. We demonstrate that tandem repeat
deletion occurs in the absence of intact recA both in vitro
and in vivo.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
80°C for 20 h.
Thirteen positive colonies were identified, and cosmid DNA was prepared
from each with plasmid miniprep columns (Qiagen). The cosmid DNA was
digested with HindIII, transferred to a nylon membrane,
and probed with the radiolabeled PCR fragment. A 3-kb
HindIII fragment from one cosmid showed strong
reactivity with the probe, and this fragment was subcloned into pCR2
and named pKPRA3.
, 25 µF), placed on ice for 30 min,
incubated at 30°C for 90 min, and finally plated on erythromycin (ERY)-containing sheep's blood agar (ERY/BAP) at 30°C for
48 h. ERY-resistant colonies were streaked on ERY/BAP and grown at
30°C for 48 h. Liquid cultures of ERY-resistant strains were
grown in Todd-Hewitt broth (THB) with ERY (THB/ERY) at 30°C
overnight and then diluted 1:10 into THB/ERY and grown for 8 to 16 h at 37°C. These cultures were then diluted at 1:100 to 1:10,000,
plated on BAP/ERY, and grown overnight at 37°C. ERY-resistant
colonies growing at 37°C were passaged a second time in THB/ERY
medium at 37°C and again plated at 37°C on ERY/BAP, to decrease any
illegitimate persistence of free plasmid.
recA strain) overnight at 37°C, pelleted, and
resuspended in one-third-volume phosphate-buffered saline. Resuspended
bacteria were mixed with Laemmli gel sample buffer (plus
dithiothreitol), boiled, spun briefly to pellet debris, and immediately
run on a 10% Tris-glycine SDS gel. Western blotting was performed as
previously described (19) using rabbit antiserum raised to
the one-repeat form of the alpha C protein at 1:500 to 1:2,000 dilutions.
recA were plated on BAP (with
or without ERY) at a density of 200 to 400 colonies/plate. Forty
plates were screened for each strain (12,213 colonies for A909; 9,457 colonies for A909
recA.) Colony immunoblotting was
performed as previously described (36). Lightly stained
colonies were retrieved from the corresponding primary plate and
restreaked on BAP with or without ERY. Each potential alpha C protein
mutant was examined by Western blotting as described above to determine
the size of the alpha C protein. Several A909
recA-derived
isolates with alpha C protein deletions were tested for UV sensitivity,
and all remained UV sensitive, indicating that the deletions did not
arise from reversion to a recA+ phenotype.
recA genotype and the frequency of each isolate
phenotype. Special statistical analysis was required to account for
mouse-to-mouse variation in the number of isolates obtained.
Overdispersed binomial logistic regression (2) was
performed to test the null hypothesis that the A909
recA
genotype and the nonnull, deletion phenotype were not associated.
Colony blot data on alpha C protein repeat number were obtained from
12,213 colonies of A909 and from 9,457 colonies of
A909
recA and were analyzed using a two-tailed Fisher's exact test.
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Comparison of E. coli recA active sites with
the GBS recA sequencea
Creation of a strain of GBS with recA deleted.
pJRS233 is an E. coli/streptococcal shuttle vector that
contains a gram-negative replicon, a temperature-sensitive
gram-positive replicon, and an ERY resistance gene (45).
Persistence of an ERY resistance phenotype at 37°C in a gram-positive
strain can be accomplished by integration of this plasmid into the
genomic DNA of the organism. An internal fragment of GBS
recA was cloned into pJRS233, creating vector pKP600.
Integration of pKP600 at the recA locus can occur by
homologous recombination, interrupting the recA gene, as
shown schematically in Fig. 1. Competent
GBS were transformed with the recombinant plasmid, passaged at 30°C, and then shifted to growth at 37°C. After serial passaging at 37°C,
five isolates were chosen for further study.
|
recA. This isolate demonstrated
essentially complete killing after only 5 s of exposure to UV
light (data not shown).
Molecular analysis of A909
recA.
To confirm
disruption of recA in A909
recA,
EcoRI restriction digests of genomic DNA from wild-type and
mutant bacteria were analyzed by a Southern blot with fragments of the
recA sequence. The Southern blot shown in Fig. 1D reveals
the generation of a new fragment of the predicted size in the mutant
strain when it was probed with sequence from the 5' portion of
recA and a slight shift downward of the large fragment when
probed with sequence at the 3' end of the recA gene,
consistent with integration of the plasmid at the recA
locus. The remaining four erythromycin-resistant isolates were also
analyzed by a Southern blot (data not shown). One of these (which also
showed enhanced susceptibility to UV killing) showed a pattern
identical to that of A909
recA. The others were not UV
sensitive and showed patterns incompatible with interruption of the
recA gene.
recA, total RNA from strains A909
and A909
recA was analyzed by RT-PCR. Primer 15 and primer
16 were used as a positive control, since this primer pair should
amplify a 603-bp recA fragment from both A909 and
A909
recA. The primer pair recfd and recrv correspond to
sequences immediately outside recA (Fig. 1) and amplify an 1,155-bp fragment that contains the entire recA coding
region. RT-PCR was carried out as described in Materials and Methods; control reaction mixtures were held on ice during the reverse transcription step to ensure that products were not the result of
contaminating genomic DNA. The 603-bp product was amplified as
predicted from both the wild-type strain and the recA
mutant, but the 1,155-bp product was amplified only from the wild-type strain, indicating that full-length recA mRNA is not made in
the mutant strain. There was no product amplified from any of the control reactions (data not shown).
Attenuation of A909
recA in a mouse model of
sepsis.
The 50% lethal dose (LD50) of the
mutant strain was compared with that of the wild-type strain A909 in
our mouse model of intraperitoneal sepsis. The
LD50 of A909
recA was 9.4 × 104, and that of wild-type A909 was 3.5 × 103, as calculated by the method of Reed and
Muench (47) (data not shown), demonstrating that
A909
recA was attenuated in this model. To determine if
the difference in virulence of A909
recA was due to a
growth defect in the mutant strain, we compared the in vitro growth
rates of the wild-type and mutant strains. The slope of the growth
curves during log-phase growth was essentially identical between the
strains, indicating that there was not a significant growth defect in
the mutant strain. The spleen of one of the mice used in the
LD50 study was removed, homogenized, and plated
on blood agar plates. Single bacterial colonies were isolated and were
observed to retain both the ERY resistance marker and the UV
sensitivity phenotype.
Comparison of alpha C protein tandem repeat deletion in the
wild-type and recA mutant strains in a mouse model of
infection.
In our mouse model of GBS infection, when mice are
infected with wild-type GBS after receiving a protective antibody to
the alpha C protein, bacterial colonies with truncated forms of the alpha C protein are frequently isolated. The genes encoding the truncated proteins contain precise deletions of tandem repeat elements
(36). To determine whether the process of tandem repeat deletion in the alpha C protein of GBS involves
recA-mediated homologous recombination, we compared the
occurrence and frequency of isolating mutants with tandem repeat
deletions in mice challenged with A909
recA and those
challenged with wild-type A909.
recA GBS, at or above the
LD50 for each strain. Mice given nonimmune serum
were found dead at 24 h, but mice given immune serum were
generally alive and appeared well after 24 h. At 24 h, the
surviving mice were sacrificed and the spleens from all mice were
immediately removed. Individual bacterial colonies were isolated from
the spleens, and the alpha C protein from each isolate was assessed by
a Western blot. Rabbit antiserum to the one-repeat alpha C protein was
used because it recognizes all forms of the alpha C protein on a
Western blot.
Western blot analysis of the alpha C protein from splenic
isolates.
The Western blot shown in Fig.
2A shows representative bacterial splenic
isolates obtained from a mouse given nine-repeat immune serum and
challenged with the wild-type strain A909.
|
so that, for example, nine bands are seen with nine-repeat alpha
C protein, whereas two bands are seen with a two-repeat form of the
alpha C protein (41, 54). Wild-type A909 is shown in Fig.
2A, lane 2. Lanes 3 to 6 show alpha C protein from individual splenic
isolates, consistent with the one-repeat (lane 3), two-repeat (lane 4),
three-repeat (lane 5) and nine-repeat (lane 6) forms of the alpha C
protein. Lane 7 exhibits no alpha C protein. Many isolates of this type
were obtained that apparently produce no alpha C protein; they were termed null mutants. Control experiments with representative null mutants demonstrate that these mutants produce overall adequate amounts
of protein, and specifically, these mutants do produce another
antigenic surface protein, the beta C protein (data not shown). Some
isolates appeared to produce intact nine-repeat alpha C protein at
markedly lower levels than the wild type. For the purposes of
statistical analysis, these were also considered to be null mutants
since they did not appear to have undergone tandem repeat deletion (see
PCR amplification below). In control mice that received nonimmune
serum, 56 isolates were tested and all had intact nine-repeat alpha C
protein as determined by a Western blot, whether the challenge strain
was A909 or A909
recA.
Similar results were obtained when mice received nine-repeat immune
serum and were challenged with the mutant strain
A909
recA. A Western blot of representative bacterial
splenic isolates is shown in Fig. 2B, with A909
recA in
lane 2. Lanes 3 to 6 show alpha C protein from individual splenic
isolates from a mouse challenged with A909
recA,
consistent with one-repeat (lane 3), three-repeat (lane 4), four-repeat
(lane 5) and nine-repeat (lane 6) protein. In addition, a number of
null mutants were also observed, as shown in lane 7. Each of the
splenic isolates obtained from mice challenged with
A909
recA retained their resistance to erythromycin; representative null and deletion isolates were further tested for
sensitivity to the killing effects of UV light and were observed to
retain the UV sensitivity phenotype of A909
recA.
PCR amplification and sequencing of the alpha C protein gene in
splenic isolates.
To ensure that the phenotypes seen on Western
blots in these experiments corresponded to gene deletions, the alpha C
protein genes from the wild-type strain, the A909
recA
mutant, and several splenic isolates were amplified by PCR. The
products obtained from the wild-type isolates are shown in Fig.
3. In lane 3, a product of the predicted
size, approximately 3.5 kb, is observed with amplification from the
wild-type A909 strain. In lanes 4, 5, and 6, the band sizes correspond
to products from isolates with one, two, and three repeats on a Western
blot. The null mutants have not been previously genetically
characterized; amplification of DNA from a null mutant, shown in
lane 7, yielded a band close to that of the wild type. Similar results
were observed with truncated and null mutants isolated from spleens of
mice challenged with A909
recA. Products consistent with a
nine-repeat alpha C protein are observed in lane 8 (A909
recA parent strain) and lane 12, a null mutant by a
Western blot. In lanes 9, 10, and 11, the band sizes correspond to
products from isolates with one, three, and four repeats on a Western
blot.
|
Statistical analysis of the splenic isolate data.
A summary of
the Western blot analyses of the splenic isolates is shown in Table
2. Non-nine-repeat mutants were obtained from 7 of 10 mice challenged with the wild-type A909 strain, and 293 of
these isolates were analyzed by Western blots. Non-nine-repeat mutants
were obtained from 7 of 13 mice challenged with the recA deletion strain A909
recA, and 341 isolates were analyzed
by Western blots. If fewer than 125 isolates were recovered from an
individual spleen, 50 to 100% of the isolates were analyzed. If more
than 250 isolates were recovered from an individual spleen, a
representative proportion of the isolates was randomly chosen for
analysis. The number of isolates obtained from a spleen ranged from 1 to more than 1,000 and did not depend on the challenge strain
(P = 0.64 by the Wilcoxon test).
|
recA, with a
nonsignificant P value of 0.57.
Comparison of the spontaneous rate of alpha C protein tandem repeat
deletion in the wild-type and recA mutant strains.
The mouse model of immune infection provides a powerful selection for
mutations in the alpha C protein and has the advantage of illustrating
the biological relevance of mutations in this bacterial surface
protein. We thought it possible that the strength of this in vivo
selection could obscure some effect of the recA mutation on
the spontaneous rate of tandem repeat deletion in the alpha C protein.
To address this, we compared the rate of spontaneous deletion in the
alpha C proteins in the wild-type and mutant strains by colony
immunoblots using a monoclonal antibody, 4G8, which specifically
recognizes the repeat region of the protein (26). This
monoclonal antibody is highly reactive with intact nine-repeat alpha C
protein but only weakly reactive with lower-repeat-number forms of the
protein (37). Based on our previous work that indicated the rate of spontaneous deletion was 6 × 10
4 (36), we prospectively
determined that screening of approximately 10,000 colonies of each
strain would allow us to detect a 10-fold decrease in the rate of
mutation with a P value of <0.05. As described in Materials
and Methods, each potential mutant identified by colony immunoblotting
was isolated and analyzed by a Western blot to confirm the deletion
phenotype. We screened 12,213 wild-type colonies and obtained 22 mutants for a rate of deletion of 1.8 × 10
3 (1 mutant per 555 colonies); we screened
9,457 mutant colonies and obtained 16 mutants for a rate of deletion of
1.7 × 10
3 (1 mutant per 591 colonies).
The difference is not significant (P = 0.872),
indicating that the recA mutation does not affect the rate
of spontaneous tandem repeat deletion of the alpha C protein.
| |
DISCUSSION |
|---|
|
|
|---|
Single nucleotide changes that result in differences in enzyme activity or protein expression can confer a survival advantage to bacteria that are subject to adverse environmental conditions. Tandem repeat deletion within the alpha C protein gene confers a survival advantage to GBS bearing this surface protein by resulting in antigenic change that allows escape from humoral immunity, thereby serving as a pathogenicity trait in GBS. Similar to the deletions found in the M proteins of GAS (22), deletions in the alpha C protein occur by homologous recombination between intragenic repeats, in that the deletions are precise and occur between identical sequences, but the molecular mechanisms involved in the process are unknown.
Tandem repeat deletion has been most extensively studied with E. coli with both plasmid-based and chromosomal reporter constructs, and the dependence on RecA in these systems is variable, ranging from no RecA dependence for deletion of small (<100-bp) repeats to modest reductions (2- to 40-fold) in deletion rates for larger repeats (5, 6, 33, 34). Nontandem repeat deletion appears to be more dependent on RecA, with increasing distance between repeats (5, 34). We sought to determine whether RecA-mediated homologous recombination was involved in deletion of the 246-bp tandem repeats found in the alpha C protein during passage in an immune host.
Nothing is known about homologous recombination or recombinatorial
mechanisms in general in GBS, and we report here the identification of
a recA homologue in this species. The sequence of this gene is highly related to those of other reported streptococcal species and
to the well-studied recA gene of E. coli. As
evidenced by the high degree of conservation with putative active sites
in the E. coli RecA protein (Table 1) and by the phenotype
of sensitivity to UV light in the recA deletion mutant
strain, it is expected that the GBS RecA protein plays a role in
homologous recombination similar to that of RecA in E. coli.
Deletion of recA in other bacterial species has a variable
effect on the virulence of the organism (10, 16, 17, 46,
56); A909
recA is significantly attenuated in our
mouse model of sepsis, with an LD50 that is approximately 20-fold higher than that with wild-type A909. Although it
has been shown that recA mutant E. coli bacteria
grow poorly (48), our in vitro growth studies of
A909
recA demonstrate that during log phase, the mutant
strain grows similarly to A909, suggesting that the attenuation of the
strain is not due simply to a growth rate defect in the mutant. In
addition to its role in homologous recombination, E. coli
RecA is involved in LexA repressor cleavage and the induction of the
SOS response, in chromosome partitioning, and in induced stable DNA
replication (28). In S. pneumoniae, coordinate
expression of recA and cinA is induced during
competence (38, 44). GBS RecA may also be involved in
bacterial processes aside from its role in homologous recombination,
and the decreased virulence observed in our recA mutant
strain could be due to the loss of another RecA function.
We found that tandem repeat deletion in the alpha C protein in vitro
and in our mouse model of immune infection occurs in the absence of
RecA. Deletion mutants were found with the wild-type GBS strain and
with the strain of GBS with recA deleted, indicating that
intramolecular recombination between tandem repeats in GBS does not
require functional RecA. This observation is of particular importance,
since we have been able to study this process on the chromosome with a
protective surface antigen in a pathogenic species, rather than with an
experimental plasmid construct. The mutant construct
A909
recA was created by insertional inactivation at the
recA locus; thus, a partial recA sequence does
remain on the chromosome. This partial sequence lacks the C-terminal 68 amino acid residues; in E. coli, the C-terminal region of
RecA functions in double-stranded DNA binding (1, 29, 65).
Although we cannot completely exclude the possibility that a truncated
and partially functional form of the protein is present, the extreme sensitivity of this strain to the killing effects of UV light argue
that the strain functionally has a deletion of RecA with respect to DNA
repair, which requires the same processes
binding of single-stranded
DNA, pairing of homologous sequences, and promotion of DNA strand
exchange
as does RecA-mediated homologous recombination.
RecA-independent tandem repeat deletion in GBS may be explained by a number of alternate recombination mechanisms. It is possible that forms of RecA-like homologous recombination are involved in tandem repeat deletion in GBS; such a RecA-like function has been attributed to the RecE and RecT proteins of E. coli (28). Alternatively, other recombination mechanisms may be involved in tandem repeat deletion in GBS, including site-specific recombination, which involves highly specific sequences and unique proteins, and illegitimate recombination, which does not require DNA homology and is relatively inefficient, occurring at low frequency. RecA-independent tandem repeat deletion in E. coli, however, does not seem to be supported by any of these mechanisms, in that the process is not sequence specific, does involve homologous stretches of DNA, and occurs with some efficiency between repeats (6). It is also apparently influenced by replication factors such as DNA polymerases and helicases. Deletions of several genes in E. coli have been shown to result in increased levels of RecA-independent tandem repeat deletion, including deletion of dnaE (9) and dnaQ (51), which encode subunits of DNA polymerase III, and rep, which encodes a replicative helicase (9). Deletion of dnaB, which encodes a replication fork helicase, and deletion of uvrD, which encodes helicase II, appear to increase RecA-dependent tandem repeat deletion (8, 64).
In light of these observations, several models of RecA-independent tandem repeat deletion have been suggested in E. coli, including sister-strand exchange, replication slippage, rolling-circle replication, and misalignment exchange (6, 7, 33). The different models proposed for RecA-independent tandem repeat deletion are essentially all replication-driven models that invoke the formation of recombinogenic intermediates to result in intramolecular recombination. Each of these models would predict involvement of some elements of the RecA pathways distal to RecA, as well as predicting a prominent role for replication enzymes.
Which, if any, of the proposed mechanisms of RecA-independent tandem
repeat deletion in gram-negative organisms might be functional in GBS
is not known. Neither the baseline rate of spontaneous tandem repeat
deletion in the alpha C protein nor the relatively high rate at which
we recover deletion mutants in our immune mouse model of infection was
significantly affected by the recA mutation. The spontaneous
rate of deletion we report here is somewhat higher than previously
reported (36); we attribute this difference to the fact
that in the previous work only a relatively small number of colonies
was screened. The rate of approximately 1.8 × 10
3 is much higher than the single base DNA
replication error rate (estimated in prokaryotes to be 10
8
to 10
12) but is within the range of
tandem repeat deletion rates reported for E. coli with
plasmid-based reporter systems (ranging from 3 × 10
3 to 6 × 10
5)
(27, 33, 34). It is likely that these deletions occur in
vivo at an ongoing baseline rate and are biologically amplified in our
immune mouse model by the survival advantage of the shift in
antigenicity conferred by the deletions. Whether this process is
mediated by alternate forms of homologous recombination, by site-specific recombination, by illegitimate recombination, or by
replicational error may be best addressed by the identification of
mutations in the recA-deleted background which significantly decrease the rate of tandem repeat deletion. The high degree of sequence conservation at the junctional regions between repeats suggests that these specific sequences may be important in facilitating recombination (30). The specificity and frequency of these
deletions argue against a role for illegitimate recombination and
support a role for site-directed recombination or replicational error. Replicational error, which under some circumstances might be
disadvantageous to the species, may in the immune environment confer a
survival advantage by resulting in antigenic variation.
It is also possible, but far less likely, that the binding of effective antibody to the alpha C protein transmits a signal that results in a targeted deletion process. This model would invoke a more site-specific process, which is attractive given the quite precise nature of these deletions. Yet it does not explain the rate of spontaneous tandem repeat deletion in the absence of immune pressure, unless it is assumed that the presence of effective antibody results in upregulation of a baseline rate of deletion. Further study of the recombination and replication processes of GBS, and in particular the identification of gene mutations that result in both increased and decreased rates of tandem repeat deletion, may lead to a better understanding of this process and other bacterial strategies for antigenic variation and immune evasion.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by National Research Service Award grant HD070466, National Institutes of Health grants AI38424 and AI33963, and National Institutes of Health contract N01-AI-75326.
We thank Beth Lurvey and Anne Behrens for technical assistance, Dennis Kasper for many helpful discussions, Eric Eichenwald for critical review of the manuscript, and Merton Bernfield, Steven Ringer, and Gary Silverman for their ongoing support of our work.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Channing Laboratory, 181 Longwood Ave., Boston, MA 02115. Phone: (617) 525-2681. Fax: (617) 731-1541. E-mail: kpuopolo{at}rics.bwh.harvard.edu.
Editor: E. I. Tuomanen
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Aihara, H., Y. Ito, H. Kurumizaka, T. Terada, S. Yokoyama, and T. Shibata. 1997. An interaction between a specified surface of the C-terminal domain of RecA protein and double-stranded DNA for homologous pairing. J. Mol. Biol. 274:213-221[CrossRef][Medline]. |
| 2. | Aitkin, M., D. Anderson, B. Francis, and J. Hinde (ed.). 1989. Statistical modelling in GLIM. Oxford University Press, Oxford, United Kingdom. |
| 3. | Alger, L. S., J. C. Lovchik, J. R. Hebel, L. R. Blackmon, and M. C. Crenshaw. 1988. The association of Chlamydia trachomatis, Neisseria gonorrhoeae, and group B streptococci with preterm rupture of the membranes and pregnancy outcome. Am. J. Obstet. Gynecol. 159:397-404[Medline]. |
| 4. |
Anderson, B. E.,
G. A. McDonald,
D. C. Jones, and R. L. Regnery.
1990.
A protective protein antigen of Rickettsia rickettsii has tandemly repeated, near-identical sequences.
Infect. Immun.
58:2760-2769 |
| 5. | Bi, X., and L. F. Liu. 1994. recA-independent and recA-dependent intramolecular plasmid recombination. Differential homology requirement and distance effect. J. Mol. Biol. 235:414-423[CrossRef][Medline]. |
| 6. | Bi, X., and L. F. Liu. 1996. recA-independent DNA recombination between repetitive sequences: mechanisms and implications. Prog. Nucleic Acid Res. Mol. Biol. 54:253-292[Medline]. |
| 7. | Bi, X., and L. F. Liu. 1996. A replicational model for DNA recombination between direct repeats. J. Mol. Biol. 256:849-858[CrossRef][Medline]. |
| 8. | Bierne, H., M. Seigneur, S. D. Ehrlich, and B. Michel. 1997. uvrD mutations enhance tandem repeat deletion in the Escherichia coli chromosome via SOS induction of the RecF recombination pathway. Mol. Microbiol. 26:557-567[CrossRef][Medline]. |
| 9. | Bierne, H., D. Vilette, S. D. Ehrlich, and B. Michel. 1997. Isolation of a dnaE mutation which enhances RecA-independent homologous recombination in the Escherichia coli chromosome. Mol. Microbiol. 24:1225-1234[CrossRef][Medline]. |
| 10. | Buchmeier, N. A., C. J. Lipps, M. Y. So, and F. Heffron. 1993. Recombination-deficient mutants of Salmonella typhimurium are avirulent and sensitive to the oxidative burst of macrophages. Mol. Microbiol. 7:933-936[Medline]. |
| 11. |
Buscaglia, C. A.,
J. Alfonso,
O. Campetella, and A. C. Frasch.
1999.
Tandem amino acid repeats from Trypanosoma cruzi shed antigens increase the half-life of proteins in blood.
Blood
93:2025-2032 |
| 12. | Chaffin, D. O., and C. E. Rubens. 1998. Blue/white screening of recombinant plasmids in Gram-positive bacteria by interruption of alkaline phosphatase gene (phoZ) expression. Gene 219:91-99[CrossRef][Medline]. |
| 13. |
Dunny, G. M.,
L. Lee, and D. J. LeBlanc.
1991.
Improved electroporation and cloning vector system for gram-positive bacteria.
Appl. Environ. Microbiol.
57:1194-1201 |
| 14. |
Dybvig, K.,
S. K. Hollingshead,
D. G. Heath,
D. B. Clewell,
F. Sun, and A. Woodard.
1992.
Degenerate oligonucleotide primers for enzymatic amplification of recA sequences from gram-positive bacteria and mycoplasmas.
J. Bacteriol.
174:2729-2732 |
| 15. |
Farley, M. M.,
R. C. Harvey,
T. Stull,
J. D. Smith,
A. Schuchat,
J. D. Wenger, and D. S. Stephens.
1993.
A population-based assessment of invasive disease due to group B Streptococcus in nonpregnant adults.
N. Engl. J. Med.
328:1807-1811 |
| 16. | Fletcher, J. J., and R. C. Gordon. 1990. Perinatal transmission of bacterial sexually transmitted diseases. Part II: group B streptococcus and Chlamydia trachomatis. J. Fam. Pract. 30:689-696[Medline]. |
| 17. | Fuchs, S., I. Muhldorfer, A. Donohue-Rolfe, M. Kerenyi, L. Emody, R. Alexiev, P. Nenkov, and J. Hacker. 1999. Influence of RecA on in vivo virulence and Shiga toxin 2 production in Escherichia coli pathogens. Microb. Pathog. 27:13-23[CrossRef][Medline]. |
| 18. | Gravekamp, C., D. L. Kasper, J. L. Michel, D. E. Kling, V. Carey, and L. C. Madoff. 1997. Immunogenicity and protective efficacy of the alpha C protein of group B streptococci are inversely related to the number of repeats. Infect. Immun. 65:5216-5221[Abstract]. |
| 19. |
Gravekamp, C.,
B. Rosner, and L. C. Madoff.
1998.
Deletion of repeats in the alpha C protein enhances the pathogenicity of group B streptococci in immune mice.
Infect. Immun.
66:4347-4354 |
| 20. | Hervas, J. A., L. Gonzalez, J. Gil, L. C. Paoletti, L. C. Madoff, and V. J. Benedi. 1993. Neonatal group B streptococcal infection in Mallorca, Spain. Clin. Infect. Dis. 16:714-718[Medline]. |
| 21. | Hohn, B., and J. Collins. 1980. A small cosmid for efficient cloning of large DNA fragments. Gene 11:291-298[CrossRef][Medline]. |
| 22. | Hollingshead, S. K., V. A. Fischetti, and J. R. Scott. 1987. Size variation in group A streptococcal M protein is generated by homologous recombination between intragenic repeats. Mol. Gen. Genet. 207:196-203[CrossRef][Medline]. |
| 23. |
Hood, D. W.,
M. E. Deadman,
M. P. Jennings,
M. Bisercic,
R. D. Fleischmann,
J. C. Venter, and E. R. Moxon.
1996.
DNA repeats identify novel virulence genes in Haemophilus influenzae.
Proc. Natl. Acad. Sci. USA
93:11121-11125 |
| 24. |
Hoyer, L. L.,
T. L. Payne, and J. E. Hecht.
1998.
Identification of Candida albicans ALS2 and ALS4 and localization of als proteins to the fungal cell surface.
J. Bacteriol.
180:5334-5343 |
| 25. | Klein, B. S., L. H. Hogan, and J. M. Jones. 1993. Immunologic recognition of a 25-amino acid repeat arrayed in tandem on a major antigen of Blastomyces dermatitidis. J. Clin. Investig. 92:330-337. |
| 26. | Kling, D. E., C. Gravekamp, L. C. Madoff, and J. L. Michel. 1997. Characterization of two distinct opsonic and protective epitopes within the alpha C protein of the group B Streptococcus. Infect. Immun. 65:1462-1467[Abstract]. |
| 27. |
Kong, D., and W. Masker.
1994.
Deletion between direct repeats in T7 DNA stimulated by double-strand breaks.
J. Bacteriol.
176:5904-5911 |
| 28. |
Kowalczykowski, S. C.,
D. A. Dixon,
A. K. Eggleston,
S. D. Lauder, and W. M. Rehrauer.
1994.
Biochemistry of homologous recombination in Escherichia coli.
Microbiol. Rev.
58:401-465 |
| 29. |
Kurumizaka, H.,
H. Aihara,
S. Ikawa,
T. Kashima,
L. R. Bazemore,
K. Kawasaki,
A. Sarai,
C. M. Radding, and T. Shibata.
1996.
A possible role of the C-terminal domain of the RecA protein. A gateway model for double-stranded DNA binding.
J. Biol. Chem.
271:33515-33524 |
| 30. |
Lachenauer, C.,
R. Creti,
J. Michel, and L. Madoff.
2000.
Mosaicism in the alpha-like protein genes of group B streptococci.
Proc. Natl. Acad. Sci. USA
97:9630-9635 |
| 31. | Lachenauer, C. S., and L. C. Madoff. 1996. A protective surface protein from type V group B streptococci shares N-terminal sequence homology with the alpha C protein. Infect. Immun. 64:4255-4260[Abstract]. |
| 32. | Levinson, G., and G. A. Gutman. 1987. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4:203-221[Abstract]. |
| 33. | Lovett, S. T., P. T. Drapkin, V. A. Sutera, Jr., and T. J. Gluckman-Peskind. 1993. A sister-strand exchange mechanism for recA-independent deletion of repeated DNA sequences in Escherichia coli. Genetics 135:631-642[Abstract]. |
| 34. | Lovett, S. T., T. J. Gluckman, P. J. Simon, V. A. Sutera, Jr., and P. T. Drapkin. 1994. Recombination between repeats in Escherichia coli by a recA-independent, proximity-sensitive mechanism. Mol. Gen. Genet. 245:294-300[CrossRef][Medline]. |
| 35. |
Madoff, L. C.,
S. Hori,
J. L. Michel,
C. J. Baker, and D. L. Kasper.
1991.
Phenotypic diversity in the alpha C protein of group B streptococcus.
Infect. Immun.
59:2638-2644 |
| 36. |
Madoff, L. C.,
J. L. Michel,
E. W. Gong,
D. E. Kling, and D. L. Kasper.
1996.
Group B streptococci escape host immunity by deletion of tandem repeat elements of the alpha C protein.
Proc. Natl. Acad. Sci. USA
93:4131-4136 |
| 37. |
Madoff, L. C.,
J. L. Michel, and D. L. Kasper.
1991.
A monoclonal antibody identifies a protective C-protein alpha-antigen epitope in group B streptococci.
Infect. Immun.
59:204-210 |
| 38. | Martin, B., P. Garcia, M. P. Castanie, B. Glise, and J. P. Claverys. 1995. The recA gene of Streptococcus pneumoniae is part of a competence-induced operon and controls an SOS regulon. Dev. Biol. Stand. 85:293-300[Medline]. |
| 39. | McDonald, H., R. Vigneswaran, and J. A. O'Loughlin. 1989. Group B streptococcal colonization and preterm labour. Aust. N. Z. J. Obstet. Gynaecol. 29:291-293[Medline]. |
| 40. |
Michel, J. L.,
L. C. Madoff,
D. E. Kling,
D. L. Kasper, and F. M. Ausubel.
1991.
Cloned alpha and beta C-protein antigens of group B streptococci elicit protective immunity.
Infect. Immun.
59:2023-2028 |
| 41. |
Michel, J. L.,
L. C. Madoff,
K. Olson,
D. E. Kling,
D. L. Kasper, and F. M. Ausubel.
1992.
Large identical tandem repeating units in the C protein alpha antigen gene, bca, of group B streptococci.
Proc. Natl. Acad. Sci. USA
89:10060-10065 |
| 42. | Murphy, G. L., T. D. Connell, D. S. Barritt, M. Koomey, and J. G. Cannon. 1989. Phase variation of gonococcal protein II: regulation of gene expression by slipped-strand mispairing of a repetitive DNA sequence. Cell 56:539-547[CrossRef][Medline]. |
| 43. | Musatovova, O., and J. F. Alderete. 1999. The Trichomonas vaginalis phenotypically varying P270 immunogen is highly conserved except for numbers of repeated elements. Microb. Pathog. 27:93-104[CrossRef][Medline]. (Erratum, 28:191, 2000.) |
| 44. |
Pearce, B. J.,
A. M. Naughton,
E. A. Campbell, and H. R. Masure.
1995.
The rec locus, a competence-induced operon in Streptococcus pneumoniae.
J. Bacteriol.
177:86-93 |
| 45. | Perez-Casal, J., J. Price, E. Maguin, and J. Scott. 1993. An M protein with a single C repeat prevents phagocytosis of Streptococcus pyogenes: use of a temperature-sensitive shuttle vector to deliver homologous sequences to the chromosome of S. pyogenes. Mol. Microbiol. 8:809-819[Medline]. |
| 46. | Pogson, C. A., C. P. Simmons, R. A. Strugnell, and A. L. Hodgson. 1996. Cloning and manipulation of the Corynebacterium pseudotuberculosis recA gene for live vaccine vector development. FEMS Microbiol. Lett. 142:139-145[CrossRef][Medline]. |
| 47. | Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27:493-497. |
| 48. | Roca, A. I., and M. M. Cox. 1997. RecA protein: structure, function, and role in recombinational DNA repair. Prog. Nucleic Acid Res. Mol. Biol. 56:129-223[Medline]. |
| 49. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 50. |
Sancar, A.,
C. Stachelek,
W. Konigsberg, and W. D. Rupp.
1980.
Sequences of the recA gene and protein.
Proc. Natl. Acad. Sci. USA
77:2611-2615 |
| 51. | Saveson, C. J., and S. T. Lovett. 1997. Enhanced deletion formation by aberrant DNA replication in Escherichia coli. Genetics 146:457-470[Abstract]. |
| 52. |
Schrag, S. J.,
S. Zywicki,
M. M. Farley,
A. L. Reingold,
L. H. Harrison,
L. B. Lefkowitz,
J. L. Hadler,
R. Danila,
P. R. Cieslak, and A. Schuchat.
2000.
Group B streptococcal disease in the era of intrapartum antibiotic prophylaxis.
N. Engl. J. Med.
342:15-20 |
| 53. |
Shankar, V.,
A. S. Baghdayan,
M. M. Huycke,
G. Lindahl, and M. S. Gilmore.
1999.
Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein.
Infect. Immun.
67:193-200 |
| 54. |
Stalhammar-Carlemalm, M.,
L. Stenberg, and G. Lindahl.
1993.
Protein Rib: a novel group B streptococcal cell surface protein that confers protective immunity and is expressed by most strains causing invasive infections.
J. Exp. Med.
177:1593-1603 |
| 55. | Stern, A., M. Brown, P. Nickel, and T. F. Meyer. 1986. Opacity genes in Neisseria gonorrhoeae: control of phase and antigenic variation. Cell 47:61-71[CrossRef][Medline]. |
| 56. | Stroeher, U. H., A. J. Lech, and P. A. Manning. 1994. Gene sequence of recA+ and construction of recA mutants of Vibrio cholerae. Mol. Gen. Genet. 244:295-302[Medline]. |
| 57. | Tao, L., S. K. Hollingshead, A. N. Suvorov, J. J. Ferretti, and W. M. McShan. 1995. Construction of a Streptococcus pyogenes recA mutant via insertional inactivation, and cloning and sequencing of the complete recA gene. Gene 162:59-62[CrossRef][Medline]. |
| 58. | Tapscott, S. J., T. R. Klesert, R. J. Widrow, R. Stoger, and C. D. Laird. 1998. Fragile-X syndrome and myotonic dystrophy: parallels and paradoxes. Curr. Opin. Genet. Dev. 8:245-253[CrossRef][Medline]. |
| 59. |
van Belkum, A.,
S. Scherer,
L. van Alphen, and H. Verbrugh.
1998.
Short-sequence DNA repeats in prokaryotic genomes.
Microbiol. Mol. Biol. Rev.
62:275-293 |
| 60. | van Ham, S. M., L. van Alphen, F. R. Mooi, and J. P. van Putten. 1993. Phase variation of H. influenzae fimbriae: transcriptional control of two divergent genes through a variable combined promoter region. Cell 73:1187-1196[CrossRef][Medline]. |
| 61. | Verghese, A., K. Mireault, and R. D. Arbeit. 1986. Group B streptococcal bacteremia in men. Rev. Infect. Dis. 8:912-917[Medline]. |
| 62. |
Wastfelt, M.,
M. Stalhammar-Carlemalm,
A. Delisse,
T. Cabezon, and G. Lindahl.
1996.
Identification of a family of streptococcal surface proteins with extremely repetitive structure.
J. Biol. Chem.
271:18892-18897 |
| 63. | Weiser, J. N., J. M. Love, and E. R. Moxon. 1989. The molecular mechanism of phase variation of H. influenzae lipopolysaccharide. Cell 59:657-665[CrossRef][Medline]. |
| 64. |
Yamashita, T.,
K. Hanada,
M. Iwasaki,
H. Yamaguchi, and H. Ikeda.
1999.
Illegitimate recombination induced by overproduction of DnaB helicase in Escherichia coli.
J. Bacteriol.
181:4549-4553 |
| 65. | Yu, C., and J. Ferretti. 1991. Molecular characterization of new group A streptococcal bacteriophages containing the gene for streptococcal erythrogenic toxin A (speA). Mol. Gen. Genet. 231:161-168[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»