Previous Article | Next Article ![]()
Infection and Immunity, August 2001, p. 5189-5192, Vol. 69, No. 8
Departments of
Pathology1 and Environmental
Health,2 College of Veterinary Medicine and
Biomedical Sciences, Colorado State University, Fort Collins, Colorado
80523-1671, and Centro de Pesquisas Goncalo Moniz, Fundacao
Oswaldo Cruz, Salvador-Bahia, Brazil3
Received 19 March 2001/Returned for modification 12 April
2001/Accepted 2 May 2001
Since interleukin-6 (IL-6) may promote Th2 responses, we infected
BALB IL-6-deficient (IL-6 Perhaps the best-studied example of
a disease in which Th1 and Th2 cells dictate the outcome of the
infection is cutaneous leishmaniasis induced by Leishmania
major. Mice that develop a Th1 response to infection with L. major (e.g., C57BL/6 mice) recover from their infections,
whereas mice that develop a Th2 response (e.g., BALB/c mice) succumb to
infection (reviewed in references 3, 10, 16, and
18). Among the many regulators of Th development, it has
been suggested that interleukin-6 (IL-6) favors the outgrowth of Th2
cells (19). Several cell types, including
macrophages, dendritic cells, and T cells, produce IL-6. Originally
thought of as a B-cell growth factor, IL-6 is now known to have effects on several components of the immune system (1, 24).
Work by Moskowitz et al. (15) showed that C57BL/6
IL-6 The course of infection with L. major in
IL-6
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.8.5189-5192.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Interleukin-6 Deficiency Influences Cytokine
Expression in Susceptible BALB Mice Infected with Leishmania
major but Does Not Alter the Outcome of Disease
![]()
ABSTRACT
Top
Abstract
Text
References
/
) mice with Leishmania
major. There was not a significant difference between the
courses of infection (lesion size and parasite burden) in
IL-6
/
and wild-type mice, but IL-6
/
mice expressed lower levels of Th2- and Th1-associated cytokines.
![]()
TEXT
Top
Abstract
Text
References
/
and wild-type C57BL/6 mice recovered
from infections with L. major with the same kinetics.
However, since C57BL/6 mice do not develop a Th2 response when infected
with L. major, these experiments did not address the
question of whether IL-6 is involved in Th2 development against
infection with L. major. To address this question, it is
necessary to investigate the role of IL-6 in the development of an
anti-L. major Th2 response in susceptible BALB mice.
/
BALB.B mice does not significantly differ from
the course of infection in susceptible wild-type BALB.B mice.
In
pilot experiments, we determined whether the amounts of IL-6 produced
by susceptible and resistant mice differed. We utilized an in vitro
priming system, which we have previously reported mimics the in vivo
response to L. major (23). In this system, we
found that cells from susceptible mice produced between two- and
fourfold more IL-6 than cells from resistant mice.
/
BALB.B mice (6)
(BALB.B/AiTac-[KO]IL-6 N9; Taconic Farms, Germantown, N.Y.) would be
more resistant to infection with L. major than susceptible
wild-type BALB.B mice (C.B10-H2b/LilMcdJ
[BALB.B10]; Jackson Laboratories, Bar Harbor, Maine). BALB.B mice (as
well as other BALB congenics, such as BALB.K) are as susceptible to
infection with L. major as BALB/c mice are; all of the mice
die from infection at the same time postinfection (4).
Groups of five mice each were infected subcutaneously with 2 × 106 L. major promastigotes (LV39) in
one hind footpad. The lesion progression and parasite burden were
monitored as described elsewhere (11, 23). Contrary to our
hypothesis, the lesion size (Fig. 1) in
IL-6
/
BALB.B mice was not significantly
different from that seen in wild-type susceptible BALB.B mice
(three-way analysis of variance followed by all pairwise
multiple-comparison posthoc t tests [Student-Newman-Keuls method]; differences were considered significant at a P of
<0.05). However, the lesion size did not fully reflect the extent of
pathology in these experiments. In the three replicate experiments
performed, the pathology associated with infection in the
IL-6
/
mice was consistently more severe than
that in control BALB.B mice. That is, lesions on
IL-6
/
mice ulcerated and became necrotic more
rapidly (5 to 7 days earlier) than those on control BALB.B mice.

View larger version (30K):
[in a new window]
FIG. 1.
The course of infection with L. major in
susceptible BALB.B mice does not significantly differ from the course
of infection in IL-6
/
BALB.B mice. The results shown
are averages of three independent experiments ± standard errors
of the mean. KO, knockout.
/
BALB.B
mice by using published techniques (11).
IL-6
/
BALB.B mice had somewhat fewer
parasites within their lesions at all times tested; however, these
differences were not statistically significant (Fig. 1). Taken as a
whole, the data showed small differences (both positive and
negative) between the susceptibilities of
IL-6
/
mice and control BALB.B mice to
infection with L. major. However, none of these differences
was statistically significant.
IL-6 deficiency down regulates the expression of both Th1- and
Th2-associated cytokines in BALB.B mice infected with L.
major.
In an effort to explain the mechanism underlying
the lack of effect of IL-6 on susceptibility to infection with L. major, we measured the expression of mRNA for five different
cytokines involved in the immune response to the parasite. We measured
IL-4 and IL-13 mRNA levels, since these cytokines drive Th2 responses (3, 10, 12, 18). We measured IL-12 and gamma interferon (IFN-
) mRNA levels, since these factors are critical for the development of a Th1 response and the subsequent destruction of L. major (3, 10, 18). Finally, we also measured
levels of IL-10 mRNA expression, since IL-10, IL-12, and IFN-
cross regulate each other's expression (3, 10, 14, 18, 23).
-actin, IL-4, IL-10, IL-12, and IFN-
were generated according to published procedures (13, 17). A
competitor for mouse IL-13 was constructed in our laboratory by PCR
using primers (CGCTGGCGGGTTCTGTGTACTGGATGGAGGCGGATAAAGTTG
and
GCCTCTC CCCAGCAAAGTCTCTACGATACGGGAGGGCTTACC AT) and the
pCRII-TOPO plasmid (Invitrogen Corp., Carlsbad, Calif.) as the
template DNA. IL-13 primers (CGCTGGCGGGTTCTGTGTA and
GCCTCTCCCCAGCAAAGTCT) and all other primers (13,
17) were purchased from Gibco BRL, Life Technologies, Inc.
(Rockville, Md.).
Fluorescent-band intensities were determined as peak heights for each
lane of agarose gels using the 1D-Multi function of AlphaEase image
analysis software, version 5 (Alpha Innotech, San Leandro, Calif.). The
ratio of peak heights for competitor and cDNA bands was plotted against
the number of competitor molecules added per reaction on a
log-log scale, and the coefficients of a least-squares
regression line were calculated using SigmaPlot graphical software
version 5 for Windows (SPSS Inc., Chicago, Ill.). The number of
specific cDNA molecules per reaction equals antilog
(
intercept/slope).
First, it should be mentioned that baseline and spontaneous production
of all cytokines measured did not differ (P > 0.05) between uninfected control BALB.B and IL-6
/
BALB.B mice except for IFN-
. Baseline expression of IFN-
in IL-6
/
BALB.B mice was 69% of that seen in
BALB.B mice (P = 0.047). Therefore, for IFN-
mRNA
expression, the results are normalized to the average uninfected
IFN-
levels for each mouse strain.
In Fig. 2, the data from three replicate
experiments have been normalized and are presented as the fold
difference of the IL-6
/
group compared to the
control. This approach allowed for a statistical analysis of all
experiments, and P values are presented in the figure. IL-6
deficiency led to depressed expression of all mRNAs analyzed except
that of IFN-
.
|
/
and control BALB.B mice and
that IL-6 mRNA could not be detected in BALB.B
IL-6
/
mice.
Our results agree with those of Moskowitz et al. (15), who
showed that IL-6 had little effect in resistant C57BL/6 mice infected
with L. major. They also agree with those of Saha et al.
(20), who showed that treatment with an anti-IL-6 antibody was therapeutic for susceptible BALB/c mice infected with L. major; however, as was the case in this study using IL-6-deficient
mice (Fig. 1), it did not cause the animals to recover from their
infections. Therefore, IL-6 can be involved in the development of a Th2
response in susceptible BALB/c mice infected with L. major;
however, IL-6 is not required for the development of that response.
Alternatively, since it has been suggested that the Th2 response seen
in BALB/c mice infected with L. major results from
cross-reactivity with an environmental antigen(s) (5), the
results presented here may suggest that IL-6 is not required for the
maintenance of a Th2 response to L. major.
It is interesting that in BALB.B IL-6
/
mice
infected with L. major, the levels of expression of mRNA for
both Th1- and Th2-associated cytokines (except IFN-
) were reduced
(Fig. 2). This pattern of cytokine response is not unique. For example,
IL-6
/
mice have been reported to produce
lower levels of IL-4 but unchanged levels of IFN-
in other
experimental settings (2, 25). The results presented here
are also in partial agreement with those of Saha et al.
(20), who showed that treating BALB/c mice with an
anti-IL-6 antibody lowered production of IL-4 (as was the case here
[Fig. 2]) but increased production of IFN-
(while IFN-
mRNA
expression was unchanged or slightly elevated here [Fig. 2]). This
discrepancy may be due to the different systems analyzed. Therefore, in
the BALB.B IL-6
/
mouse system examined here,
IL-6 deficiency appeared to generally lower the set point for the
expression of both Th1 and Th2 cytokines but not their overall balance
of expression. As a result, BALB.B IL-6
/
mice
remained susceptible to infection with L. major.
Others have also reported that IL-6 can affect the development of both
type 1 and type 2 immune responses. The literature regarding the effect
of IL-6 on the development of immune responses is large; however,
representative examples of the diverse effects of IL-6 include the
following: (i) IL-6 is required for the development of a Th1 response
(26), (ii) IL-6 is required for the development of a Th2
response (19), and (iii) IL-6 is required for the
development of both a Th1 and Th2 response (21).
Although IL-6 is not required for the development of either a Th1 or a
Th2 response in mice infected with L. major, it can affect
the immune responses to other pathogens, albeit variably. IL-6 is not
required for the development of a Th2 response in mice infected with
Schistosoma mansoni, but it has an important regulatory role
(8, 9). In one study, IL-6 appeared to be critical for the
development of resistance of mice to Mycobacterium tuberculosis (an infection in which a type 1 response leads to resistance [7]), but in another study IL-6 was not
essential for the development of immunity to M. tuberculosis
(22). Finally, IL-6 can also compromise the ability of
mice to resist viral infection (6).
In summary, IL-6 deficiency reduces the expression of both Th1- and
Th2-associated cytokines in BALB mice infected with L. major, but it does not alter the susceptible phenotype of the mice. Indeed, taking the results presented here in conjunction with the
results of others, it appears that the effect that IL-6 may have on the
development of either a Th1 or Th2 response cannot be predicted.
Rather, each experimental system must be examined on a case-by-case basis.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grant AI-29955.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, CO 80523-1671. Phone: (970) 491-4964. Fax: (970) 491-0603. E-mail: rtitus{at}cvmbs.colostate.edu.
Editor: J. M. Mansfield
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Akira, S., T. Taga, and T. Kishimoto. 1993. Interleukin-6 in biology and medicine. Adv. Immunol. 54:1-78[Medline]. |
| 2. | Anguita, J., M. Rincon, S. Samanta, S. W. Barthold, R. A. Flavell, and E. Fikrig. 1998. Borrelia burgdorferi-infected, interleukin-6-deficient mice have decreased Th2 responses and increased Lyme arthritis. J. Infect. Dis. 178:1512-1515[CrossRef][Medline]. |
| 3. | Bogdan, C., and M. Rollinghoff. 1998. The immune response to Leishmania: mechanisms of parasite control and evasion. Int. J. Parasitol. 28:121-134[CrossRef][Medline]. |
| 4. | Howard, J. G., C. Hale, and W. L. Chan-Liew. 1980. Immunological regulation of experimental cutaneous leishmaniasis. 1. Immunogenetic aspects of susceptibility to Leishmania tropica in mice. Parasite Immunol. 2:303-314[Medline]. |
| 5. |
Julia, V.,
S. S. McSorley,
L. Malherbe,
J.-P. Breittmayer,
F. Girard-Pipau,
A. Beck, and N. Glaichenhaus.
2000.
Priming by microbial antigens from the intestinal flora determines the ability of CD4+ T cells to rapidly secrete IL-4 in BALB/c mice infected with Leishmania major.
J. Immunol.
165:5637-5645 |
| 6. | Kopf, M., H. Baumann, G. Freer, M. Fruedenberg, M. Lamers, T. Kishimoto, R. Zinkernagel, H. Bluethmann, and G. Kohler. 1994. Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature 368:339-342[CrossRef][Medline]. |
| 7. | Ladel, C. H., C. Blum, A. Dreher, K. Reifenberg, M. Kopf, and S. H. E. Kaufmann. 1997. Lethal tuberculosis in interleukin-6-deficient mutant mice. Infect. Immun. 65:4843-4849[Abstract]. |
| 8. |
La Flamme, A. C.,
A. S. MacDonald, and E. J. Pearce.
2000.
Role of IL-6 in directing the initial immune response to schistosome eggs.
J. Immunol.
164:2419-2426 |
| 9. |
La Flamme, A. C., and E. J. Pearce.
1999.
The absence of IL-6 does not affect Th2 cell development in vivo, but does lead to impaired proliferative, IL-2 receptor expression, and B cell responses.
J. Immunol.
162:5829-5837 |
| 10. | Launois, P., F. Tacchini-Cottier, C. Parra-Lopez, and J. A. Louis. 1998. Cytokines in parasitic diseases: the example of cutaneous leishmaniasis. Int. Rev. Immunol. 17:157-180[Medline]. |
| 11. | Lima, H. C., J. Bleyenberg, and R. G. Titus. 1997. A simple method for quantifying Leishmania in tissues of infected animals. Parasitol. Today 13:80-82[CrossRef][Medline]. |
| 12. |
Matthews, D. J.,
C. L. Emson,
G. L. McKenzie,
H. E. Jolin,
J. M. Blackwell, and A. N. McKenzie.
2000.
IL-13 is a susceptibility factor for Leishmania major infection.
J. Immunol.
164:1458-1462 |
| 13. |
Mbow, M. L.,
J. A. Bleyenberg,
L. R. Hall, and R. G. Titus.
1998.
Phlebotomus papatasi sand fly salivary gland lysate downregulates a Th1, but upregulates a Th2, response in mice infected with Leishmania major.
J. Immunol.
161:5571-5577 |
| 14. | Morris, S. C., K. B. Madden, J. J. Adamovicz, W. C. Gause, B. R. Hubbard, M. K. Gately, and F. D. Finkelman. 1994. Effects of IL-12 on in vivo cytokine gene expression and Ig isotype selection. J. Immunol. 152:1047-1056[Abstract]. |
| 15. | Moskowitz, N. H., D. R. Brown, and S. L. Reiner. 1997. Efficient immunity against Leishmania major in the absence of interleukin-6. Infect. Immun. 65:2448-2450[Abstract]. |
| 16. | Mosmann, T. R., and R. L. Coffman. 1989. Th1 and Th2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145-173[CrossRef][Medline]. |
| 17. | Platzer, C., G. Richter, K. Überla, W. Müller, H. Blöcker, T. Diamantstein, and T. Blankenstein. 1992. Analysis of cytokine mRNA levels in interleukin-4-transgenic mice by quantitative polymerase chain reaction. Eur. J. Immunol. 22:1179-1184[Medline]. |
| 18. | Reiner, S. L., and R. M. Locksley. 1995. The regulation of immunity to Leishmania major. Annu. Rev. Immunol. 13:151-177[CrossRef][Medline]. |
| 19. |
Rincon, M.,
J. Anguita,
T. Nakamura,
E. Fikrig, and R. A. Flavell.
1997.
Interleukin (IL)-6 directs the differentiation of IL-4-producing CD4+ T cells.
J. Exp. Med.
185:461-469 |
| 20. | Saha, B., A. Saini, R. Germond, P. J. Perrin, D. M. Harlan, and T. A. Davis. 1999. Susceptibility or resistance to Leishmania infection is dictated by the macrophages evolved under the influence of IL-3 or GM-CSF. Eur. J. Immunol. 29:2319-2329[CrossRef][Medline]. |
| 21. |
Samoilova, E. B.,
J. L. Horton,
B. Hilliard,
T. S. Liu, and Y. Chen.
1998.
IL-6-deficient mice are resistant to experimental autoimmune encephalomyelitis: roles of IL-6 in the activation and differentiation of autoreactive T cells.
J. Immunol.
161:6480-6486 |
| 22. |
Saunders, B. M.,
A. A. Frank,
I. M. Orme, and A. M. Cooper.
2000.
Interleukin-6 induces early gamma interferon production in the infected lung but is not required for generation of specific immunity to Mycobacterium tuberculosis infection.
Infect. Immun.
68:3322-3326 |
| 23. | Soares, M. B. P., J. R. David, and R. G. Titus. 1997. An in vitro model for infection with Leishmania major that mimics the immune response in mice. Infect. Immun. 65:2837-2845[Abstract]. |
| 24. | Taga, T., and T. Kishimoto. 1997. GP130 and the interleukin-6 family of cytokines. Annu. Rev. Immunol. 15:797-819[CrossRef][Medline]. |
| 25. |
Wang, J.,
R. J. Homer,
Q. Chen, and J. A. Elias.
2000.
Endogenous and exogenous IL-6 inhibit aeroallergen-induced Th2 inflammation.
J. Immunol.
165:4051-4061 |
| 26. |
Yamamoto, M.,
K. Yoshikazi,
T. Kishimoto, and H. Ito.
2000.
IL-6 is required for the development of Th1 cell-mediated murine colitis.
J. Immunol.
164:4878-4882 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|