Previous Article | Next Article 
Infection and Immunity, September 2001, p. 5403-5411, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5403-5411.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Protective Efficacy of a DNA Vaccine Encoding
Antigen 85A from Mycobacterium bovis BCG against
Buruli Ulcer
Audrey
Tanghe,1
Jean
Content,2
Jean-Paul
Van
Vooren,3
Françoise
Portaels,4 and
Kris
Huygen1,*
Mycobacterial
Immunology1 and Molecular
Microbiology,2 Pasteur Institute of Brussels,
and Hôpital Erasme ULB,3 Brussels,
and Mycobacteriology Unit, Institute of Tropical Medicine,
Antwerp,4 Belgium
Received 26 February 2001/Returned for modification 9 April
2001/Accepted 6 June 2001
 |
ABSTRACT |
Buruli ulcer, caused by Mycobacterium ulcerans, is
characterized by deep and necrotizing skin lesions, mostly on the arms and legs. Together with tuberculosis and leprosy, this mycobacterial disease has become a major health problem in tropical and subtropical regions, particularly in central and western Africa. No specific vaccine is available for Buruli ulcer. There is, however, evidence in
the literature that suggests a cross-reactive protective role of the
tuberculosis vaccine M. bovis BCG. To identify potential mechanisms for this cross-protection, we identified and characterized the M. ulcerans homologue of the important protective
mycobacterial antigen 85 (Ag85A) from BCG. The homologue is well
conserved in M. ulcerans, showing 84.1% amino acid
sequence identity and 91% conserved residues compared to the sequence
from BCG. This antigen was sufficiently conserved to allow
cross-reactive protection, as demonstrated by the ability of M. ulcerans- infected mice to exhibit strong cellular immune
responses to both BCG and its purified Ag85 complex. To further address
the mechanism of cross-reactive protection, we demonstrate here that
prior vaccination with either BCG or plasmid DNA encoding BCG Ag85A is
capable of significantly reducing the bacterial load in the footpads of
M. ulcerans- infected mice, as determined by Ziehl-Neelsen
staining and by actual counting of CFU on 7H11 Middlebrook agar.
Together, the results reported here support the potential of a
cross-protective Ag85-based future vaccine against tuberculosis, Buruli
ulcer, and leprosy.
 |
INTRODUCTION |
Buruli ulcer, caused by
Mycobacterium ulcerans, is an emerging mycobacteriosis
characterized by deep and necrotizing skin lesions, mostly of the upper
and lower limbs. Together with tuberculosis (TB) and leprosy, this
mycobacterial disease has become a major health problem in developing
countries (20). Buruli ulcer affects mostly children in
tropical and subtropical regions of central and western Africa. Other
foci of endemicity are present in some regions of Australia, Southeast
Asia, and a few scattered parts of Latin America (44).
There is no evidence for direct person-to-person transmission, and it
has been suggested that contaminated water of rivers, swamps, and lakes
is the most likely reservoir for the disease. A sensitive and specific
PCR method, based on the insertion sequences IS2404 and
IS2606, has enabled the detection of M. ulcerans
in water samples from a swamp and a golf course irrigation system, but
direct culture of this mycobacterium from environmental samples has
been unsuccessful (34, 35). A very close phylogenetic
relationship exists between M. ulcerans and M. marinum, another mycobacterial species causing cutaneous problems (38).
Buruli ulcer can manifest itself in different forms, ranging from a
small skin nodule to a deep and enlarging skin ulcer ultimately necessitating chirurgical care. Treatment with antimycobacterial agents
has generally been disappointing, especially in patients with extensive
ulcers. Wide surgical excision and skin grafting or even amputation of
the affected limbs is often the only treatment possible. Buruli ulcer
is generally found on lower-temperature parts of the body, such as the
arms and legs, and the disease is accompanied by remarkably few
systemic symptoms and is rarely fatal (44). The infection
remains confined to the subcutaneous tissue and overlying skin. The
absence of a positive skin test response in most patients may indicate
that cellular immune responses are not or are only weakly induced.
Interestingly, spontaneous healing is often accompanied by skin test
conversion (44), again suggesting a pivotal role of the
immune system in the control of the disease. Clearly, a better
understanding of the immune response generated following M. ulcerans infection is essential in this respect. No specific
vaccine is available for Buruli ulcer, but evidence in the literature
suggests a cross-reactive protective role of the M. bovis
BCG vaccine used against TB (37).
For TB, it has been shown convincingly in mouse and guinea pig
experimental models that important protective antigens can be found
among the secreted or exported proteins of the bacillus, which are
present in large amounts in mycobacterial culture filtrates (CF)
(1, 13, 14). A major protein component of these CF is the
antigen 85 (Ag85) complex, a 30- to 32-kDa family of three proteins,
Ag85A, Ag85B, and Ag85C, which are encoded by three distinct but highly
homologous genes (47). The bacteriostatic drug isoniazid
enhances the expression of the Ag85 complex in M. tuberculosis CF (11), and its role in cell wall
synthesis through its mycolyl-transferase activity is now well
documented (4, 33). Homologues of the Ag85 complex have
been described in all of the mycobacterial species tested so far and in
another member of the actinomycete family, i.e., Corynebacterium
glutamicum (21). The Ag85 complex induces strong
T-cell proliferation and gamma interferon (IFN-
) production in most
healthy individuals infected with M. tuberculosis and in
BCG-vaccinated mice and humans (15, 19). On the other
hand, TB patients show decreased cellular immune responses but
increased antibody production in response to Ag85 (19,
45). In leprosy, strong cross-reactive cellular and humoral
immune responses against purified Ag85 from M. bovis BCG can
also be detected in, respectively, healthy contacts and leprosy
patients (23-25). Ag85 plays an important role in
protective immunity against TB, and we and others have previously
demonstrated that vaccination with plasmid DNA encoding Ag85A and Ag85B
can protect mice against an experimental aerosol and intravenous
challenge with M. tuberculosis (3, 16, 22, 40).
In order to analyze the possible role of the Ag85 complex in the
cross-reactive protection conferred by BCG against M. ulcerans infection, we have first determined the complete
nucleotide sequence of Ag85A from M. ulcerans and we show
that the gene is 84% identical to its homologue in M. bovis
BCG. Furthermore, mice infected in the footpad with M. ulcerans can mount a cross-reactive cellular immune response,
restricted to the draining lymph nodes (LN), against M. bovis BCG CF and its major Ag85 complex. Finally, prior vaccination with BCG or with plasmid DNA encoding Ag85A from M. bovis BCG can partially protect mice against a subsequent footpad challenge with M. ulcerans, resulting in a more-than-20-fold
reduction in the number of mycobacteria in the infected footpad.
 |
MATERIALS AND METHODS |
Mycobacterial strains.
M. ulcerans type 1 strain
5150 from the Democratic Republic of Congo was isolated at the
Institute of Tropical Medicine of Antwerp (30). Bacteria
were grown on Löwenstein-Jensen or Middlebrook 7H9 medium at 32 to 33°C for approximately 1 month. M. bovis BCG strain GL2
was grown at the Pasteur Institute in Brussels for 2 weeks as a surface
pellicle at 37°C in synthetic Sauton medium.
Genomic DNA isolation.
A 500-mg pellet of M. ulcerans obtained from 50 ml of a 6-week 7H9 liquid culture was
resuspended in 0.1 M NaCl-1 mM EDTA-50 mM Tris-HCl buffer (buffer I)
and heated for 20 min at 80°C. DNA was extracted by using lysozyme,
pronase, and sodium dodecyl sulfate (SDS) treatment. For the
extraction, 1 volume of chloroform-isoamyl alcohol (24:1) was added to
mycobacteria in buffer I. The aqueous phase was then extracted three
times with 1 volume of neutralized phenol. After several cycles of
freeze-thawing, the aqueous phase was recovered and added to 1 volume
of ether. RNase A (10 µg/ml) was added to the DNA, incubated for 1 h
at 37°C, and removed by three extractions with
phenol-chloroform-isoamyl alcohol. After precipitation of the DNA with
2 volumes of ethanol, the pellet was resuspended in Tris-EDTA buffer
and analyzed by electrophoresis on agarose gel. Purity was evaluated by
calculation of the ratio of optical density at 260 nm
(OD260) to OD280 and the ratio of OD260 to OD230.
Probes.
Three different probes were used to clone a fragment
including the complete gene coding for Ag85A of M. ulcerans.
(i) BB1-BB3 probe.
Since the BB1 and BB3 sequences are
highly conserved among Ag85-encoding genes from several mycobacterial
species, this 162-bp fragment of the Ag85-encoding gene was amplified
by PCR on M. ulcerans genomic DNA by using
primers ATCAACACCCCGGCCGTCGAG (BB1 sense) and
CGGCAGCTCGCTGGTCAGGA (BB3 antisense) (10).
(ii) Probes A and B.
Probes A and B were obtained by
digestion with PstI and XhoI of plasmid 5.1, which contains the gene encoding Ag85B from M. bovis BCG
(7, 27). Probe A (700 bp) encodes the N-terminal region of
the protein, whereas probe B (300 bp) encodes the C-terminal region of
the protein. All probes were labeled with [32P]dCTP by
using the multiprime labeling kit (Amersham, Amersham, United Kingdom).
Southern blot hybridization.
Purified genomic DNA
from M. ulcerans (5 µg) was digested overnight by
BamHI (Fermentas) and separated on a 1% Seakem GTG agarose
gel (FMC). Before overnight transfer onto a nylon Hybond N membrane
(Amersham), the gel was denatured in a 0.5 M NaOH-1.5 M NaCl solution
and neutralized in a 3 M Na acetate solution. The DNA transferred onto
the membrane was fixed by short-wavelength UV exposure. Hybridization
with the three different Ag85 probes was then realized sequentially.
Each filter was prehybridized in Rapid-Hyb buffer (Amersham) at 65°C
and then hybridized overnight with the denatured probe at 2 × 106 cpm/ml. The filter was washed two times in 2 × SSPE (1× SSPE is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% SDS
for 10 min at room temperature and once in 1× SSPE-0.1% SDS for 15 min at 65°C. For BB1-BB3, a more stringent procedure was used that
included a wash in 0.7× SSPE-0.1% SDS. After air drying, each filter
was autoradiographed on Kodak X-Omat film. Complete stripping of each probe was obtained by immersion of the membrane for 30 min in 0.1% SDS
at 95°C.
Cloning of a 1,400-bp fragment encoding Ag85A from M. ulcerans.
Purified DNA of M. ulcerans (20 µg)
was digested with BamHI, and a fragment of about 1,400 bp
was cut and extracted from the agarose gel by GenElute agarose spin
columns (Sigma). Ligation was made in pBlueScript II-SK+
vector (pBSK+) (Stratagene), previously digested with
BamHI, using the T4 DNA ligase (Roche). Transformation was
made in electrocompetent DH5
cells (Gibco BRL) by electroporation.
Cultures were incubated overnight on ampicillin-containing agar plates.
Addition of isopropyl-
-D-thiogalactopylanoside (IPTG)
and 5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside
(X-Gal) allowed us to distinguish between colonies containing the
insert (white) and colonies without the insert (blue). Each positive individual colony was streaked onto a grid Hybond N membrane laid on
the surface of an agar plate. After overnight growth, filters were
denaturated and neutralized on Whatman 3MM paper, washed in 2× SSC,
and then fixed by short-wavelength UV exposure. After treatment with
proteinase K (100 µg/ml, 1 h at 37°C), filters were hybridized
with the 162-bp [32P]dCTP-labeled BB1-BB3 M. ulcerans DNA probe.
DNA sequencing.
DNA prepared from clone 71 was obtained by
using a Qiagen plasmid midi protocol (Qiagen). DNA sequencing was
carried out by Texas red dye primer cycle sequencing with an automatic
Vistra 725 sequencer using a DYEnamic Direct cycle sequencing kit
(Amersham). External oligonucleotides T3 and T7 were used initially,
followed by six other internal oligonucleotides, allowing complete
sequencing of the clone 71 insert in both orientations.
Plasmid construction.
The gene encoding Ag85A from M. tuberculosis (which is 100% identical to that of M. bovis BCG) was amplified by PCR without its mycobacterial signal
sequence by using primers containing BglII restriction sites
and inserted into the V1Jns.tPA vector, driven by the IE1
cytomegalovirus promoter and encoding the signal sequence for
human tissue plasminogen activator (16).
Mice.
C57BL/10 (B10) and C57BL/6 (B6
[H-2b]) mice were bred in the animal
facilities of the Pasteur Institute of Brussels. Only male mice, 6 to 8 weeks old at the start of the experiment, were used.
M. ulcerans infection.
An M. ulcerans
suspension was prepared from cultures grown for 1 month on
Löwenstein-Jensen medium. Cultures (1 mg/ml) were mixed with
2-mm-diameter glass beads (Vel, Leuven, Belgium) and vortexed
vigorously, and the number of acid-fast bacilli (AFB) was determined by
Ziehl-Neelsen staining. Mice were injected in the right footpad with
0.03 ml of the M. ulcerans suspension in Dubos medium
(Difco) containing 3 × 104 or 105 AFB.
Vaccination.
B6 mice were anesthesized by intraperitoneal
injection of ketamine (100 mg/ml) -xylazine (10 mg/ml) and injected
three times, at 3-week intervals, in both quadriceps with 2 × 50 µg of plasmid DNA encoding Ag85A or the empty V1Jns.tPA vector
(control DNA) using a 0.3-cm3 insulin syringe (Becton
Dickinson). Mice were infected with M. ulcerans 5 weeks
after the third DNA vaccination. For BCG vaccination, mice were
injected intravenously with 0.5 mg (±2 × 106 CFU) of
live M. bovis BCG at the time of the first DNA injection (11 weeks before challenge).
Antigens.
CF was prepared from M. bovis BCG
cultures by ammonium sulfate precipitation as described before
(15). Purified protein derivative (PPD) was prepared from
8-week-old CF of M. bovis strain Vallée. The Ag85
complex (Ag85A plus Ag85B plus Ag85C) was purified from M. bovis BCG CF by sequential chromatography on phenyl Sepharose, DEAE-Sephacel, and Sephadex G75 (8). Pokeweed mitogen
(PWM; Gibco Life Sciences), a T-cell-dependent B-cell mitogen, was used as a control to measure polyclonal T-cell stimulation. Recombinant catalase-peroxidase (KatG) and malate synthase (GlcB) proteins from
M. tuberculosis were a kind gift of J. T. Belisle
(Colorado State University).
Cytokine production.
Mice were killed 7 weeks after
infection with 3 × 104 AFB, and spleen and inguinal
LN were removed aseptically. Spleens and LN from five mice were pooled,
but LN draining the infected (right) and uninfected (left) limbs were
analyzed separately. A suspension of 4 × 106
leukocytes/ml was incubated in the presence of PPD (25 µg/ml), CF (25 µg/ml), or Ag85 (5 µg/ml) in round-bottom microwell plates in RPMI
medium supplemented with 10% fetal calf serum, antibiotics, and 5 × 10
5 M 2-mercaptoethanol. Cells were incubated for 1 or
3 days at 37°C in 5% CO2. Supernatants from three
separate wells were pooled for each antigen.
IL-2 assay.
Interleukin-2 (IL-2) activity was determined in
duplicate on 24-h culture supernatants (pool of five mice) using a
bio-assay with IL-2-dependent CTLL-2 cells as described before
(15). IL-2 levels are expressed as mean counts per
minute ± the standard deviation (SD). The detection limit is
around 10 pg/ml.
IFN-
assay.
IFN activity was quantified in duplicate on
72-h spleen cell culture supernatants (pool of five mice) using a mouse
IFN-
enzyme-linked immunosorbent assay as described before
(46). Coating antibody R4-6A2 and biotinylated detection
antibody XMG1.2 were obtained from Pharmingen. The standard murine
recombinant IFN-
used was obtained from Gibco. Titers are expressed
as the mean number of picograms per milliliter. The detection limit of the assay is 20 pg/ml.
Lymphoproliferation.
Pooled inguinal LN cells (LN draining
infected hind legs separated from LN draining uninfected hind legs)
from five M. ulcerans-infected mice were incubated in vitro
at 106 leukocytes/ml in the presence of control medium,
bovine PPD (5 µg/ml), Ag85 from BCG (1 µg/ml), or PWM (1:50
dilution) in round-bottom microwell plates in RPMI 1640 medium
supplemented with 10% Fetal calf serum, antibiotics, and 5 × 10
5 M 2-mercaptoethanol. Cells were incubated for 3 or 4 days at 37°C in 5% CO2, and [3H]thymidine
(Amersham) was added at 0.4 µCi/well during the last 24 h. Cells
were harvested onto glass fiber filter mats using a Titertek cell
harvester, and radioactivity was measured in a Betaplate liquid
scintillation counter (Wallace). The lymphoproliferation level was
expressed as mean counts per minute ± SD from quadruplicate cultures.
Western blot analysis.
Naive B6 and B10 mice or B6
mice vaccinated with BCG 11 weeks before were infected with 3 × 104 M. ulcerans AFB or 2 × 106
CFU of M. bovis BCG. Sera were collected at different time
points, diluted 1:20, and tested against CF from M. bovis
BCG as described before (17). The specificities of
BCG-specific monoclonal antibodies (MAbs) directed against the 30- to
32-kDa Ag85 complex (MAb 17-4), the 40-kDa PstS-3 protein (MAb 2C1-5),
the 65-kDa heat shock protein (MAb IA1), and an 80-kDa CF
protein (MAb 5D9) have been described before (17, 18, 41).
MAbs IT42 and IT57, directed against the 80-kDa catalase-peroxidase
(KatG) protein from M. tuberculosis CF, were kindly provided
by J. Belisle (Colorado State University).
Enumeration of AFB and CFU in the footpad.
In a first
experiment, B10 mice were injected in the footpad with 105
AFB and growth was evaluated for up to 8 weeks after the initial infection. In the vaccination experiments, infected footpads of B6 mice
were analyzed 5 or 7 weeks after M. ulcerans inoculation with 105 or 3 × 104 AFB, respectively.
The skin and bones were removed carefully. The tissues were homogenized
in a Dounce homogenizer and resuspended in 2 ml of Dubos broth medium
(Difco) containing 0.4 g of glass beads 2 mm in diameter (Vel).
Bacilli were counted as described previously by Shepard and McRae
(36). Briefly, 1 volume of tissue homogenate was diluted
in 1 volume of 10% milk-0.15% formaldehyde medium. A volume of 5 µl was fixed on a glass slide (in triplicate) by heating at 60 to
70°C for 15 min. The slide was then stained with Ziehl-Neelsen stain,
and the AFB in 20 fields were counted under a microscope. For
enumeration of actual CFU, serial dilutions of tissue homogenate were
plated on 7H11 Middlebrook agar, supplemented with oleic
acid-albumin-dextrose-catalase enrichment medium. Petri dishes were
sealed in plastic bags, and yellow colonies were counted after 8 weeks
of incubation at 32 to 33°C. Numbers of AFB (viable and nonviable
organisms) or CFU (viable organisms) were determined on individual mice
(four to seven mice per group) and converted to log10
values, and statistical analysis was performed on mean log10 ± SD values by using Student's t test.
Nucleotide sequence accession number.
The nucleotide
sequence of the gene coding for Ag85A from M. ulcerans has
been assigned GenBank accession number AJ300576.
 |
RESULTS |
Cloning of a 1,400-bp DNA fragment containing the Ag85A-encoding
gene from M. ulcerans.
After BamHI
digestion of the complete genomic DNA from M. ulcerans, sequential Southern blot hybridization with probes A and B (from Ag85B of M. bovis BCG) and probe BB1-BB3 from
M. ulcerans revealed two fragments with estimated sizes of
1,400 and 7,300 bp. These two BamHI fragments hybridized
with all three probes (results not shown). The 1,400-bp fragment was
isolated, purified, and ligated into pBSK+. The
transformation in DH5
cells yielded 139 individual colonies. Among
these, only one (clone 71) hybridized with the M. ulcerans DNA BB1-BB3 probe. Southern blot analysis of plasmid DNA from clone 71 confirmed that the hybridization of this DNA to probe BB1-BB3 is
entirely due to the 1,400-bp insert (and not to the pBSK+
vector) (Fig. 1).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 1.
Agarose gel electrophoresis (A) and Southern blot
analysis (B) after hybridization under stringent conditions with the
162-bp probe BB1-BB3 from M. ulcerans. Lanes: 1, pBSK+ (1 µg); 2, plasmid DNA from clone 71 (1 µg); 3, molecular
weight marker III (Roche); 4, plasmid DNA from clone 71 after
BamHI digestion (1 µg); 5, V1Jns.tPA-85A from M. bovis BCG (1 µg).
|
|
Nucleotide sequence analysis.
Sequencing the 1,400-bp purified
DNA from clone 71, we found a 1,014-bp open reading frame corresponding
to a gene coding for an Ag85 homolog from M. ulcerans (Fig.
2A). As for all other known Ag85
sequences, the conserved mature protein starts with an FSRPGL sequence.
The gene encoding the mature protein is preceded by a signal peptide of
129 bp (43 amino acids [aa]) that is necessary for its the secretion.
Alignment of the Ag85 sequence of M. ulcerans with those
encoding Ag85A, Ag85B, and Ag85C from M. tuberculosis revealed a high similarity with, respectively, 84, 73.7, and 59.7% identical amino acids. We therefore concluded that DNA from clone 71 encodes the Ag85A homolog of M. ulcerans (Fig. 2B).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Nucleotide and deduced amino acid sequences of Ag85A
from M. ulcerans strain 5150 type I. Uppercase letters
represent the complete open reading frame sequence. The signal peptide
with an ATG as the initial codon is underlined. The conserved BB1 and
BB3 primers used to select a probe in M. ulcerans are
underlined with a dotted line. The putative Shine-Dalgarno or
ribosome-binding sequence is indicated in bold. (B) Sequence comparison
of mature Ag85A protein of M. ulcerans and M. tuberculosis (which is 100% identical to that of M. bovis BCG). Dots indicate identical amino acids; conserved amino
acid differences (determined according to the Needleman-Wunsh
criterion) are underlined.
|
|
Multiplication of M. ulcerans in the footpads of B10
mice.
Injection of 105 M. ulcerans AFB into
the footpads of B10 mice resulted in significant multiplication of the
mycobacteria in the injected leg. No AFB could be detected in the other
leg. The number of AFB increased more than 100-fold over the 8-week
period (Fig. 3). Footpad swelling was
observed after 4 weeks of infection. Necrosis of the footpad and
extension of the infection appeared after 7 to 8 weeks. For ethical
reasons, mice were euthanatized at that time point. For the subsequent
vaccination experiments described in this study, mice were sacrificed
at 5 weeks after infection with 105 AFB and at 7 weeks
after infection with 3 × 104 AFB, when all of the
control mice demonstrated visible swelling of the infected footpad.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Mycobacterial replication of M. ulcerans in
footpads of B10 mice infected with 105 AFB. Results
represent the mean ± SD log10 AFB per milliliter (six
mice were tested individually for each time point). Arrows point out
different steps during mycobacterial replication in the footpad, i.e.,
visible swelling or footpad enlargement after 4 weeks and skin
ulceration with extensive necrosis of subcutaneous fat after 7 weeks.
|
|
Cross-reactive T-cell response against M. bovis BCG
antigens in mice infected with M. ulcerans.
IFN-
and IL-2 production was examined in inguinal LN cell and spleen cell
cultures from B6 mice infected with 3 × 104 M. ulcerans AFB only and in B6 mice infected with M. ulcerans following vaccination with BCG or with DNA encoding Ag85A
from BCG. A significant cross-reactive IFN-
and IL-2 response to
M. bovis PPD, CF from M. bovis BCG, and its
purified 30- to 32-kDa Ag85 complex could be detected in inguinal LN
cell cultures from B6 mice infected in the footpad with M. ulcerans 7 weeks before (Fig. 4).
Interestingly, cross-reactive IL-2 or IFN-
responses were observed
only in cell cultures from LN draining the infected hind leg and not in
cell cultures from LN draining the uninfected hind leg (data not shown)
or in spleen cell cultures from the same mice, clearly demonstrating
the localized aspect of the M. ulcerans infection 7 weeks
after inoculation. Previous vaccination with BCG or with plasmid DNA
encoding Ag85A from M. tuberculosis before infection
resulted in significantly lower IL-2 and IFN-
production in the
draining LN, probably because vaccination reduced the multiplication of
M. ulcerans (see Table 1). Confirming previous results
(14, 15), spleen cell Th1 responses were readily detected in mice vaccinated with BCG or Ag85A DNA upon in vitro stimulation with
PPD, BCG CF, and Ag85 (Fig. 4).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
IFN- (A) and IL-2 (B) production in LN cell and
spleen cell cultures from unvaccinated and vaccinated B6 mice infected
with 3 × 104 M. ulcerans strain 5150 AFB.
Cells were restimulated for 3 days in vitro with bovine PPD (grey
bars), BCG CF (white bars), or purified Ag85 (black bars). Data are
expressed as mean numbers of picograms per milliliter ± SD
(IFN- ) and as mean counts per minute ± SD (IL-2) in culture
supernatants (tested in duplicate) from pools of five mice.
|
|
In line with the cytokine results, inguinal LN cells from
M. ulcerans-infected mice showed a positive
lymphoproliferative response following in vitro stimulation with PPD or
purified Ag85 (Fig. 5). Again,
antigen-specific T-cell responses were only observed in cell cultures
from LN draining the infected footpad and not in those from LN draining
the uninfected one. Proliferative responses to PWM could be found in
both infected and uninfected LN cell cultures but were clearly higher
in the former, probably because of the presence of a higher percentage
of activated CD4+ T cells in the infected leg.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Lymphoproliferative response of pooled inguinal LN cells
from a pool of five B6 mice infected with 3 × 104
M. ulcerans AFB 7 weeks before. (A) LN draining infected
hind legs. (B) LN draining uninfected hind legs. Cells were
restimulated for 3 or 4 days in vitro with medium alone (closed
diamonds), bovine PPD (black squares), purified Ag85 (open triangles),
or PWM (open circles). Data are expressed as mean counts per minute ± SD of triplicate cultures.
|
|
Cross-reactive B-cell response against M. bovis BCG
antigens in mice infected with M. ulcerans.
Western
blot analysis of individual sera from M. ulcerans-infected
B10 mice demonstrated a cross-reactive antibody response against a
small number of BCG CF antigens. Whereas early following infection
(weeks 2 to 4), this response was directed almost exclusively against a
BCG CF protein with an estimated molecular mass of 80 kDa, later
in infection (weeks 7 and 8), antibodies were mostly directed against
the 30- to 32-kDa Ag85 complex proteins (Fig. 6A). By using recombinant
catalase-peroxidase and malate synthase proteins from M. tuberculosis, we demonstrated that the antibody response against
the 80-kDa protein in sera from M. ulcerans-infected mice
was directed against a homologue of the KatG protein (data not shown).
Interestingly, sera from none of the five B6 mice previously vaccinated
with BCG and subsequently infected with M. ulcerans produced
antibodies against the KatG homologue (Fig. 6B, data shown for two
mice). Confirming previous results, sera from BCG-vaccinated B6 mice
reacted very weakly against BCG CF after one immunization and strongly
against the 40-kDa PstS-3 lipoprotein following two BCG immunizations
(17) (Fig. 6B).


View larger version (177K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Western blot analysis of CF antigens from M. bovis BCG separated by SDS-15% polyacrylamide gel
electrophoresis of sera (diluted 1:20) from B10 mice infected with
105 AFB of M. ulcerans and tested over an 8-week
period. Reactivity of BCG-specific MAbs is shown. Lanes: 1, MAb 17-4, directed against the 30- to 32-kDa Ag85 complex; 2, MAb 2C1-5, directed
against the 40-kDa PstS-3 protein; 3, MAb IA1, directed
against the 65-kDa hsp65 protein; 4 and 5, IT42 and IT57, directed
against the 80-kDa KatG protein. (B) Western blot analysis against CF
antigens from M. bovis BCG of sera from B6 mice vaccinated
with BCG once (lane 1 and 2) or twice (lane 3 and 4) and from mice
infected with 3 × 104 AFB of M. ulcerans
only (lane 5 and 6) or after prior BCG vaccination (lane 7 and 8).
Reactivity of BCG-specific MAbs is shown. Lanes: 9, MAb 5D9, directed
against the 80-kDa KatG protein; 10, MAb 17-4, directed against 30- to
32-kDa Ag85 complex; 11, MAb 2C1-5, directed against the 40-kDa PstS-3
protein; 12, MAb IA1, directed against the 65-kDa hsp65
protein.
|
|
Protective effect of vaccination with M. bovis BCG or
with plasmid DNA encoding Ag85A against M. ulcerans
multiplication.
As shown in Table 1,
a more-than-20-fold reduction in the number of M. ulcerans
AFB was observed in mice previously vaccinated with BCG or with DNA
encoding Ag85A compared to that in mice vaccinated with the empty
control plasmid or in naive mice. This highly significant protection
was observed in two independent experiments following challenge with
increasing doses of M. ulcerans, i.e., 3 × 104 and 105 AFB. Furthermore, the number of
actual CFU of M. ulcerans was also determined in the
experiment with the 105-AFB challenge. Here again, the
reduction in the number of CFU in Ag85A DNA-vaccinated mice compared to
that in mice injected with the empty vector was highly significant.
Numbers of AFB or CFU per milliliter in naive mice infected with
M. ulcerans were not significantly different from numbers in
mice vaccinated with control DNA.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Mycobacterial multiplication in unvaccinated and
vaccinated B6 mice infected by 3 × 104 or
105 M. ulcerans strain 5150 AFB
|
|
 |
DISCUSSION |
Following tuberculosis and leprosy, Buruli ulcer disease is the
third most common mycobacterial disease (44). The first International Conference on Buruli Ulcer Control and Research, held in
1998 in Côte d'Ivoire, expressed concern that little is known
about this disease and called on the international community to support
control and research efforts. It is clear that prevention of infection
through vaccination of populations at high risk could ultimately be the
best strategy for controlling this emerging disease.
The currently available tuberculosis vaccine, i.e., the M. bovis BCG vaccine, is very effective in preventing disseminated TB
in infants and young children (31) but does not have a
significant impact on pulmonary TB in young adults (6).
Interestingly, this same BCG vaccine was reported to confer protection
against leprosy in Papua New Guinea (2), central Brazil
(32), and northern Malawi (29) and against
Buruli ulcer in two controlled clinical trials in Uganda (5,
37), indicating that immune responses against common
mycobacterial antigens present in the BCG vaccine may be important
for the control of mycobacterial diseases. Obviously, the toxin
produced by M. ulcerans may be another key antigen
relevant for vaccine development, but it is unknown whether protective
immune responses can be generated against this polyketide-like
structure, which moreover was reported to have immunosuppressive
activities (12).
It is now generally accepted that a major protective antigen present in
the BCG vaccine is the so-called Ag85 complex, a protein family
involved in cell wall synthesis and triggering strong cell-mediated immune responses in situations of controlled, primary M. tuberculosis infection. In this paper, we have reported on
the cloning and sequencing of a gene of M. ulcerans strain
5150 encoding an Ag85 homologue. M. ulcerans and M. marinum are known to be genetically very similar
(42), and while this work was in progress, sequencing of a
417-bp fragment of M. ulcerans revealed a similarity of more than 99% with the Ag85A gene of M. marinum
(38). Comparison of our M. ulcerans sequence
with this partial sequence and the complete sequence of M. bovis BCG confirmed our blast analysis, indicating that our gene
indeed encodes the Ag85A component from M. ulcerans.
Mice experimentally infected in the hind footpad with
M. ulcerans type 1 strain 5150 from the
Democratic Republic of Congo demonstrated a strong cross-reactive
Th1-type immune response against M. bovis BCG and the 30- to
32-kDa Ag85 complex purified from BCG CF. Significant IL-2 and
IFN-
secretion, as well as lymphoproliferative
responses, could be demonstrated in inguinal LN cells draining
the infected footpad but not in cells from LN draining the uninfected
footpad or in the spleen. The 84% sequence identity and 91%
similarity between the mature M. bovis BCG and M. ulcerans Ag85A proteins could effectively explain this
cross-reactive Th1 immune response. Interestingly, one of the two
Ag85 peptide regions previously described as immunodominant in BCG
and Ag85A DNA-vaccinated B6 mice (aa 261 to 280) was almost completely
identical (one conserved change at aa 275) (18, 39). In
line with the strong but localized cellular immune response, systemic
antibody responses against BCG CF antigens were very weak in M. ulcerans-infected mice. However, antibodies directed against an
80-kDa protein antigen from BCG CF were found in 17 (35%) of 48 M. ulcerans-infected mice and, interestingly, prior BCG
vaccination inhibited the appearance of these antibodies. At least two
protein antigens with similar sizes have been described in BCG CF,
i.e., a peroxidase-catalase (KatG) and a malate synthase (GlcB) (Suman
Laal, New York University School of Medicine, personal communication).
By using recombinant KatG and GlcB from M. tuberculosis, we
found that the anti-80-kDa antibodies in sera from M. ulcerans-infected mice were directed against the former protein,
demonstrating that M. ulcerans expresses a
catalase-peroxidase homologue as well. Recently, Dobos et al. reported
on the serologic response to CF antigens of M. ulcerans in 70% of patients suffering from Buruli ulcer.
Three M. ulcerans antigens with estimated molecular
masses of 70, 36 to 38, and 5 kDa were commonly recognized
by Buruli ulcer patients' sera, and this antibody response was
consistent throughout the early to late disease stages
(9). Apart from the weak skin test reactions to tuberculin
or burulin and the paper of Dobos et al. on serology, little is known
concerning the cellular and humoral immune responses of patients with
Buruli ulcer. Our results indicate that analysis of the T-cell response
to CF antigens and Ag85, in particular, could give us more insight into
the immune mechanisms involved in control of the infection. Also, it
would be interesting to analyze the antibody response against whole BCG
CF in infected subjects in order to find out whether the KatG protein
is a dominant B-cell antigen in infected humans, as it is in infected
B6 (and BALB/c [data not shown]) mice. M. ulcerans can be
grown in liquid protein-free media (28), and we plan to
start a comparative study of immune responses to M. bovis
BCG and M. ulcerans CF in the near future in Benin (E. Lozes, personal communication).
Vaccination with BCG or with plasmid DNA encoding Ag85A from M. bovis BCG was very effective in reducing the bacterial replication of M. ulcerans in the footpad. Both the number of AFB
determined by classical Ziehl-Neelsen staining and the number of CFU
determined by plating on specific 7H11 agar were about 20-fold lower in
vaccinated mice than in mice vaccinated with the empty control vector
or in naive, unvaccinated mice. Although our results have to be
interpreted with caution, they are promising for future Buruli ulcer
vaccine development. Plasmid DNA vaccination appears to be a powerful and easy method for the definition of protective antigens for this
disease. These initial experiments now have to be repeated with
other M. ulcerans isolates and with plasmids encoding other antigens, additional mouse strains, and eventually other experimental animal species, and with longer resting periods between vaccination and
challenge. Also, a direct comparison of the immunogenicity and
protective efficacy of plasmid DNA encoding Ag85A from M. ulcerans and of M. bovis BCG is in progress.
Despite the extensive homology between both Ag85A proteins, minor
differences do exist and use of the Ag85A-encoding gene from M. ulcerans could provide a more potent vaccine. Finally,
immunotherapeutic plasmid vaccination, which has been reported to be
effective for TB with plasmid DNA encoding hsp65 (26)
but not Ag85A (43), can now be examined for M. ulcerans infection.
In conclusion and in view of the more than 90% amino acid sequence
similarity between Ag85A from M. ulcerans and Ag85A from M. bovis BCG, these results hold promise for future TB,
Buruli ulcer, and possibly leprosy vaccines based on common antigenic components.
 |
ACKNOWLEDGMENTS |
The excellent technical skills of C. Fissette (ITM), A. Van Aerde
(ITM), V. Motte, F. Jurion, K. Palfliet, N. De Smet, and A. Vanonckelen
are gratefully acknowledged. Special thanks go to M. Decock
(Hôpital Erasme ULB, Brussels, Belgium) for help with the Western
blots and to V. Rosseels for help with the scans. We are grateful to
I. Feck for technical assistance in DNA sequencing, to P. Gilot
for helping with the cloning procedure, and particularly to J. Ooms for
enthusiastic technical assistance throughout this study. We thank
M. A. Liu (previously at Merck Research Laboratories, West Point,
Pa.) for giving us the V1Jns.tPA vector and J. Belisle (Colorado State
University, Fort Collins) for MAbs IT42 and IT57 and the recombinant
KatG and GlcB proteins (material produced through funds from NIH,
NIAID, contract NO1-AI-75320, entitled "Tuberculosis Research
Materials and Vaccine Testing").
This work was supported by grants from the Damiaanaktie-Belgium and by
grant G.0266.00 from the Fonds voor Wetenschappelijk Onderzoek Vlaanderen.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Mycobacterial
Immunology, Pasteur Institute of Brussels, 642 Engelandstraat, B-1180 Brussels, Belgium. Phone: 32.2.373.33.70. Fax: 32.2.373.33.67. E-mail:
khuygen{at}pasteur.be.
Editor:
S. H. E. Kaufmann
 |
REFERENCES |
| 1.
|
Andersen, P.
1994.
Effective vaccination of mice against Mycobacterium tuberculosis infection with a soluble mixture of secreted mycobacterial proteins.
Infect. Immun.
62:2536-2544[Abstract/Free Full Text].
|
| 2.
|
Bagshawe, A.,
G. C. Scott,
D. A. Russell,
S. C. Wigley,
A. Merianos, and G. Berry.
1989.
BCG vaccination in leprosy: final results of the trial in Karimui, Papua New Guinea, 1963-79.
Bull. W. H. O.
67:389-399[Medline].
|
| 3.
|
Baldwin, S. L.,
C. D. D'Souza,
I. M. Orme,
M. A. Liu,
K. Huygen,
O. Denis,
A. Tang,
L. Zhu,
D. Montgomery, and J. B. Ulmer.
1999.
Immunogenicity and protective efficacy of DNA vaccines encoding secreted and non-secreted forms of Mycobacterium tuberculosis Ag85A.
Tubercle Lung Dis.
79:251-259[CrossRef][Medline].
|
| 4.
|
Belisle, J. T.,
V. D. Vissa,
T. Sievert,
K. Takayama,
P. J. Brennan, and G. S. Besra.
1997.
Role of the major antigen of Mycobacterium tuberculosis in cell wall biogenesis.
Science
276:1420-1422[Abstract/Free Full Text].
|
| 5.
|
Bradley, D. J.,
M. S. R. Hutt,
J. W. M. Kiryabwire,
A. Kisuule,
A. Lloyd,
J. Mafigiri,
R. H. Morrow,
W. Passon,
I. Phillips,
M. C. Pike,
P. A. Pike, and D. L. Revill.
1969.
B.C.G. vaccination against Mycobacterium ulcerans infection (Buruli Ulcer). First results of a trial in Uganda.
Lancet
i:111-115[CrossRef].
|
| 6.
|
Colditz, G. A.,
T. F. Brewer,
C. S. Berkey,
M. E. Wilson, and E. Burdick.
1994.
Efficacy of BCG vaccine in the prevention of tuberculosis: meta-analysis of the published literature.
JAMA
271:689-702.
|
| 7.
|
Content, J.,
A. de la Cuvellerie,
L. de Wit,
V. Vincent-Levy-Frébault,
J. Ooms, and J. de Bruyn.
1991.
The genes coding for the antigen 85 complexes of Mycobacterium tuberculosis and Mycobacterium bovis BCG are members of a gene family: cloning, sequence determination, and genomic organization of the gene coding for antigen 85-C of M. tuberculosis.
Infect. Immun.
59:3205-3212[Abstract/Free Full Text].
|
| 8.
|
De Bruyn, J.,
K. Huygen,
R. Bosmans,
M. Fauville,
R. Lippens,
J.-P. Van Vooren,
P. Falmagne,
M. Weckx,
H. G. Wiker,
M. Harboe, and M. Turneer.
1987.
Purification, characterization and identification of a 32 kDa protein antigen of Mycobacterium bovis BCG.
Microb. Pathog.
2:351-366[CrossRef][Medline].
|
| 9.
|
Dobos, K. M.,
E. A. Spotts,
B. J. Marston,
C. R. Horsburgh, Jr., and C. H. King.
2000.
Serologic response to culture filtrate antigens of Mycobacterium ulcerans during Buruli ulcer disease.
Emerg. Infect. Dis.
6:158-164[Medline].
|
| 10.
|
Fauville-Dufaux, M.,
B. Vanfleteren,
L. De Wit,
J. P. Vincke,
J. P. Van Vooren,
M. D. Yates,
E. Serruys, and J. Content.
1992.
Rapid detection of tuberculous and non-tuberculous mycobacteria by polymerase chain reaction amplification of a 162 bp DNA fragment from antigen 85.
Eur. J. Clin. Microbiol. Infect. Dis.
11:797-803[CrossRef][Medline].
|
| 11.
|
Garbe, T. R.,
N. S. Hibler, and V. Deretic.
1996.
Isoniazid induces expression of the antigen 85 complex in Mycobacterium tuberculosis.
Antimicrob. Agents Chemother.
40:1754-1756[Abstract].
|
| 12.
|
George, K. M.,
D. Chatterjee,
G. Gunawardana,
D. Welty,
J. Hayman,
R. Lee, and P. Small.
1999.
Mycolactone: a polyketide toxin from Mycobacterium ulcerans required for virulence.
Science
283:854-857[Abstract/Free Full Text].
|
| 13.
|
Horwitz, M. A.,
B. W. E. Lee,
B. J. Dillon, and G. Harth.
1995.
Protective immunity against tuberculosis induced by vaccination with major extracellular proteins of Mycobacterium tuberculosis.
Proc. Natl. Acad. Sci. USA
92:1530-1534[Abstract/Free Full Text].
|
| 14.
|
Hubbard, R. D.,
C. M. Flory, and F. M. Collins.
1992.
Immunization of mice with mycobacterial culture filtrate proteins.
Clin. Exp. Immunol.
87:94-98[Medline].
|
| 15.
|
Huygen, K.,
D. Abramowicz,
P. Vandenbussche,
F. Jacobs,
J. De Bruyn,
A. Kentos,
A. Drowart,
J.-P. Van Vooren, and M. Goldman.
1992.
Spleen cell cytokine secretion in Mycobacterium bovis BCG-infected mice.
Infect. Immun.
60:2880-2886[Abstract/Free Full Text].
|
| 16.
|
Huygen, K.,
J. Content,
O. Denis,
D. L. Montgomery,
A. M. Yawman,
R. R. Deck,
C. M. DeWitt,
I. M. Orme,
S. Baldwin,
C. D'Souza,
A. Drowart,
E. Lozes,
P. Vandenbussche,
J.-P. Van Vooren,
M. A. Liu, and J. B. Ulmer.
1996.
Immunogenicity and protective efficacy of a tuberculosis DNA vaccine.
Nat. Med.
2:893-898[CrossRef][Medline].
|
| 17.
|
Huygen, K.,
A. Drowart,
M. Harboe,
R. ten Berg,
J. Cogniaux, and J. P. Van Vooren.
1993.
Influence of genes from the major histocompatibility complex on the antibody repertoire against culture filtrate antigens in mice infected with live Mycobacterium bovis BCG.
Infect. Immun.
61:2687-2693[Abstract/Free Full Text].
|
| 18.
|
Huygen, K.,
E. Lozes,
B. Gilles,
A. Drowart,
K. Palfliet,
F. Jurion,
I. Roland,
M. Art,
M. Dufaux,
J. Nyabenda,
J. De Bruyn,
J.-P. Van Vooren, and R. Deleys.
1994.
Mapping of Th1 helper T-cell epitopes on major secreted mycobacterial antigen 85A in mice infected with live Mycobacterium bovis BCG.
Infect. Immun.
62:363-370[Abstract/Free Full Text].
|
| 19.
|
Huygen, K.,
J.-P. Van Vooren,
M. Turneer,
R. Bosmans,
P. Dierckx, and J. De Bruyn.
1988.
Specific lymphoproliferation, gamma interferon production, and serum immunoglobulin G directed against a purified 32 kDa mycobacterial protein antigen (P32) in patients with active tuberculosis.
Scand. J. Immunol.
27:187-194[CrossRef][Medline].
|
| 20.
|
Johnson, R.,
T. P. Stinear, and J. A. Hayman.
1999.
Mycobacterium ulcerans a mini-review.
J. Med. Microbiol.
48:511-513[Medline].
|
| 21.
|
Joliff, G.,
L. Mathieu,
V. Hahn,
N. Bayan,
F. Duchiron,
M. Renaud,
E. Shechter, and G. Leblon.
1992.
Cloning and nucleotide sequence of the csp1 gene encoding PS1, one of the two major secreted proteins of Corynebacterium glutamicum: the deduced N-terminal region of PS1 is similar to the Mycobacterium antigen 85 complex.
Mol. Microbiol.
6:2349-2362[CrossRef][Medline].
|
| 22.
|
Kamath, A. T.,
C. G. Feng,
M. MacDonald,
H. Briscoe, and W. J. Britton.
1999.
Differential protective efficacy of DNA vaccines expressing secreted proteins of Mycobacterium tuberculosis.
Infect. Immun.
67:1702-1707[Abstract/Free Full Text].
|
| 23.
|
Launois, P.,
R. DeLeys,
M. N'Diaye Niang,
A. Drowart,
M. Andrien,
P. Dierckx,
J.-L. Cartel,
J.-L. Sarthou,
J.-P. Van Vooren, and K. Huygen.
1994.
T-cell-epitope mapping of the major secreted mycobacterial antigen Ag85A in tuberculosis and leprosy.
Infect. Immun.
62:3679-3687[Abstract/Free Full Text].
|
| 24.
|
Launois, P.,
K. Huygen,
J. De Bruyn,
M. N'Diaye,
B. Diouf,
J. L. Sarthou,
J. Grimaud, and J. Millan.
1991.
T cell response to purified filtrate antigen 85 from Mycobacterium bovis bacillus Calmette-Guérin (BCG) in leprosy patients.
Clin. Exp. Immunol.
86:286-290[Medline].
|
| 25.
|
Launois, P.,
M. N. Niang,
J. De Bruyn,
J. L. Sarthou,
F. Rivier,
A. Drowart,
J.-P. Van Vooren,
J. Millan, and K. Huygen.
1993.
The major secreted antigen complex (Ag 85) from Mycobacterium bovis bacille Calmette-Guérin is associated with protective T cells in leprosy: a follow-up study of 45 household contacts.
J. Infect. Dis.
167:1160-1167[Medline].
|
| 26.
|
Lowrie, D. B.,
R. E. Tascon,
V. L. D. Bonato,
V. M. F. Lima,
L. H. Faccioli,
E. Stavropoulos,
M. J. Colston,
R. G. Hewinson,
K. Moelling, and C. L. Silva.
1999.
Therapy of tuberculosis in mice by DNA vaccination.
Nature
400:269-271[CrossRef][Medline].
|
| 27.
|
Matsuo, K.,
R. Yamaguchi,
A. Yamazaki,
H. Tasaka, and T. Yamada.
1988.
Cloning and expression of the Mycobacterium bovis BCG gene for extracellular antigen.
J. Bacteriol.
170:3847-3854[Abstract/Free Full Text].
|
| 28.
|
Mve-Obiang, A.,
J. Remacle,
J. C. Palomino,
A. Houbion, and F. Portaels.
1999.
Growth and cytotoxic activity by Mycobacterium ulcerans in protein-free media.
FEMS Microbiol. Lett.
181:153-157[CrossRef][Medline].
|
| 29.
|
Pönnighaus, J. M.,
P. E. M. Fine,
J. A. C. Sterne,
R. J. Wilson,
E. Msosa,
P. J. K. Gruer,
P. A. Jenkins,
S. B. Lucas,
N. G. Liomba, and L. Bliss.
1992.
Efficacy of BCG vaccine against leprosy and tuberculosis in northern Malawi.
Lancet
339:636-639[CrossRef][Medline].
|
| 30.
|
Portaels, F.,
P.-A. Fonteyne,
H. De Beenhouwer,
P. De Rijk,
A. Guédénon,
J. Hayman, and W. M. Meyers.
1996.
Variability in 3' end of 16S rRNA sequence of Mycobacterium ulcerans is related to geographic origin of isolates.
J. Clin. Microbiol.
34:962-965[Abstract].
|
| 31.
|
Rodrigues, L. C.,
V. K. Diwan, and J. G. Wheeler.
1993.
Protective effect of BCG against tuberculosis meningitis and military tuberculosis: a meta-analysis.
Int. J. Epidemiol.
22:1154-1158[Abstract/Free Full Text].
|
| 32.
|
Rodrigues, M. L. O.,
S. A. Silva,
J. C. A. Neto,
A. L. S. S. de Andrade,
C. M. T. Martelli, and F. Zicker.
1992.
Protective effect of intradermal BCG against leprosy; a case-control study in central Brazil.
Int. J. Leprosy
60:335-339.
|
| 33.
|
Ronning, D. R.,
T. Klabunde,
G. S. Besra,
V. D. Vissa,
J. Belisle, and J. C. Sacchettini.
2000.
Crystal structure of the secreted form of antigen 85C reveals potential targets for mycobacterial drugs and vaccines.
Nat. Struct. Biol.
7:141-146[CrossRef][Medline].
|
| 34.
|
Ross, B. C.,
R. Johnson,
F. Oppedisano,
L. Marino,
A. Sievers,
T. Stinear,
J. A. Hayman,
K. Veitch, and R. M. Robins-Browne.
1997.
Detection of Mycobacterium ulcerans in environmental samples during an outbreak of ulcerative disease.
Appl. Environ. Microbiol.
63:4135-4138[Abstract].
|
| 35.
|
Ross, B. C.,
L. Marino,
F. Oppediasano,
R. Edwards,
R. M. Robins-Browne, and P. D. R. Johnson.
1997.
Development of a PCR for rapid diagnosis of Mycobacterium ulcerans infection.
J. Clin. Microbiol.
35:1696-1700[Abstract].
|
| 36.
|
Shepard, C. C., and D. H. McRae.
1968.
A method for counting acid-fast bacteria.
Int. J. Leprosy
36:78-82.
|
| 37.
|
Smith, P. G.,
W. D. L. Revill,
E. Lukwago, and Y. P. Rykushin.
1976.
The protective effect of BCG against Mycobacterium ulcerans disease: a controlled trial in an endemic area of Uganda.
Trans. R. Soc. Trop. Med. Hyg.
70:449-457.
|
| 38.
|
Stinear, T. P.,
G. A. Jenkin,
P. D. R. Johnson, and J. K. Davies.
2000.
Comparative genetic analysis of Mycobacterium ulcerans and Mycobacterium marinum reveals evidence of recent divergence.
J. Bacteriol.
182:6322-6330[Abstract/Free Full Text].
|
| 39.
|
Tanghe, A.,
S. D'Souza,
V. Rosseels,
O. Denis,
T. H. M. Ottenhoff,
W. Dalemans,
C. Wheeler, and K. Huygen.
2001.
Increased immunogenicity and protective efficacy of a tuberculosis DNA vaccine encoding Ag85 following protein boost.
Infect. Immun.
69:3041-3047[Abstract/Free Full Text].
|
| 40.
|
Tanghe, A.,
O. Denis,
B. Lambrecht,
V. Motte,
T. van den Berg, and K. Huygen.
2000.
Tuberculosis DNA vaccine encoding Ag85A is immunogenic and protective when administered by intramuscular needle injection, but not by epidermal gene gun bombardment.
Infect. Immun.
68:3854-3860[Abstract/Free Full Text].
|
| 41.
|
Thole, J. E. R.,
W. C. A. Van Schooten,
W. J. Keulen,
P. W. M. Hermans,
A. A. M. Janson,
R. R. P. de Vries,
A. H. J. Kolk, and J. D. A. van Embden.
1988.
Use of recombinant antigens expressed in Escherichia coli K-12 to map B-cell and T-cell epitopes on the immunodominant 65-kilodalton protein of Mycobacterium bovis BCG.
Infect. Immun.
56:1633-1640[Abstract/Free Full Text].
|
| 42.
|
Tonjum, T.,
D. B. Welty,
E. Jantzen, and P. L. Small.
1998.
Differentiation of Mycobacterium ulcerans, M. marinum, and M. haemophilum: mapping of their relationships to M. tuberculosis by fatty acid profile analysis, DNA-DNA hybridization, and 16S rRNA gene sequence analysis.
J. Clin. Microbiol.
36:918-925[Abstract/Free Full Text].
|
| 43.
|
Turner, J.,
E. R. Rhoades,
M. Keen,
J. T. Belisle,
A. A. Frank, and I. M. Orme.
2000.
Effective preexposure tuberculosis vaccines fail to protect when they are given in an immunotherapeutic mode.
Infect. Immun.
68:1706-1709[Abstract/Free Full Text].
|
| 44.
|
van der Werf, T. S.,
W. T. A. van der Graaf,
J. W. Tappero, and K. Asiedu.
1999.
Mycobacterium ulcerans infection.
Lancet
354:1013-1018[CrossRef][Medline].
|
| 45.
|
Van Vooren, J.-P.,
A. Drowart,
J. De Bruyn,
P. Launois,
J. Millan,
E. Delaporte,
M. Develoux,
J. C. Yernault, and K. Huygen.
1992.
Humoral responses against the 85A and 85B antigens of Mycobacterium bovis BCG in patients with leprosy and tuberculosis.
J. Clin. Microbiol.
30:1608-1610[Abstract/Free Full Text].
|
| 46.
|
Vercammen, M.,
T. Scorza,
K. Huygen,
J. De Braekeleer,
R. Diet,
D. Jacobs,
E. Saman, and H. Verschueren.
2000.
DNA vaccination with genes encoding Toxoplasma gondii antigens GRA1, GRA7, and ROP2 induces partially protective immunity against lethal challenge in mice.
Infect. Immun.
68:38-45[Abstract/Free Full Text].
|
| 47.
|
Wiker, H. G., and M. Harboe.
1992.
The antigen 85 complex: a major secretion product of Mycobacterium tuberculosis.
Microbiol Rev.
56:648-661[Abstract/Free Full Text].
|
Infection and Immunity, September 2001, p. 5403-5411, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5403-5411.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Torrado, E., Adusumilli, S., Fraga, A. G., Small, P. L. C., Castro, A. G., Pedrosa, J.
(2007). Mycolactone-Mediated Inhibition of Tumor Necrosis Factor Production by Macrophages Infected with Mycobacterium ulcerans Has Implications for the Control of Infection. Infect. Immun.
75: 3979-3988
[Abstract]
[Full Text]
-
Tanghe, A., Adnet, P.-Y., Gartner, T., Huygen, K.
(2007). A Booster Vaccination with Mycobacterium bovis BCG Does Not Increase the Protective Effect of the Vaccine against Experimental Mycobacterium ulcerans Infection in Mice. Infect. Immun.
75: 2642-2644
[Abstract]
[Full Text]
-
Torrado, E., Fraga, A. G., Castro, A. G., Stragier, P., Meyers, W. M., Portaels, F., Silva, M. T., Pedrosa, J.
(2007). Evidence for an Intramacrophage Growth Phase of Mycobacterium ulcerans. Infect. Immun.
75: 977-987
[Abstract]
[Full Text]
-
Rosseels, V., Marche, S., Roupie, V., Govaerts, M., Godfroid, J., Walravens, K., Huygen, K.
(2006). Members of the 30- to 32-Kilodalton Mycolyl Transferase Family (Ag85) from Culture Filtrate of Mycobacterium avium subsp. paratuberculosis Are Immunodominant Th1-Type Antigens Recognized Early upon Infection in Mice and Cattle. Infect. Immun.
74: 202-212
[Abstract]
[Full Text]
-
Oliveira, M. S., Fraga, A. G., Torrado, E., Castro, A. G., Pereira, J. P., Filho, A. L., Milanezi, F., Schmitt, F. C., Meyers, W. M., Portaels, F., Silva, M. T., Pedrosa, J.
(2005). Infection with Mycobacterium ulcerans Induces Persistent Inflammatory Responses in Mice. Infect. Immun.
73: 6299-6310
[Abstract]
[Full Text]
-
Shin, S. J., Chang, C.-F., Chang, C.-D., McDonough, S. P., Thompson, B., Yoo, H. S., Chang, Y.-F.
(2005). In Vitro Cellular Immune Responses to Recombinant Antigens of Mycobacterium avium subsp. paratuberculosis. Infect. Immun.
73: 5074-5085
[Abstract]
[Full Text]
-
Santosuosso, M., Zhang, X., McCormick, S., Wang, J., Hitt, M., Xing, Z.
(2005). Mechanisms of Mucosal and Parenteral Tuberculosis Vaccinations: Adenoviral-Based Mucosal Immunization Preferentially Elicits Sustained Accumulation of Immune Protective CD4 and CD8 T Cells within the Airway Lumen. J. Immunol.
174: 7986-7994
[Abstract]
[Full Text]
-
Okenu, D. M. N., Ofielu, L. O., Easley, K. A., Guarner, J., Spotts Whitney, E. A., Raghunathan, P. L., Stienstra, Y., Asamoa, K., van der Werf, T. S., van der Graaf, W. T. A., Tappero, J. W., Ashford, D. A., King, C. H.
(2004). Immunoglobulin M Antibody Responses to Mycobacterium ulcerans Allow Discrimination between Cases of Active Buruli Ulcer Disease and Matched Family Controls in Areas Where the Disease Is Endemic. CVI
11: 387-391
[Abstract]
[Full Text]
-
Prevot, G., Bourreau, E., Pascalis, H., Pradinaud, R., Tanghe, A., Huygen, K., Launois, P.
(2004). Differential Production of Systemic and Intralesional Gamma Interferon and Interleukin-10 in Nodular and Ulcerative Forms of Buruli Disease. Infect. Immun.
72: 958-965
[Abstract]
[Full Text]
-
Portaels, F., Aguiar, J., Debacker, M., Guedenon, A., Steunou, C., Zinsou, C., Meyers, W. M.
(2004). Mycobacterium bovis BCG Vaccination as Prophylaxis against Mycobacterium ulcerans Osteomyelitis in Buruli Ulcer Disease. Infect. Immun.
72: 62-65
[Abstract]
[Full Text]
-
Dahl, J. L., Kraus, C. N., Boshoff, H. I. M., Doan, B., Foley, K., Avarbock, D., Kaplan, G., Mizrahi, V., Rubin, H., Barry, C. E. III
(2003). The role of RelMtb-mediated adaptation to stationary phase in long-term persistence of Mycobacterium tuberculosis in mice. Proc. Natl. Acad. Sci. USA
100: 10026-10031
[Abstract]
[Full Text]
-
Huygen, K.
(2003). On the Use of DNA Vaccines for the Prophylaxis of Mycobacterial Diseases. Infect. Immun.
71: 1613-1621
[Full Text]
-
Portaels, F., Aguiar, J., Debacker, M., Steunou, C., Zinsou, C., Guedenon, A., Meyers, W. M.
(2002). Prophylactic Effect of Mycobacterium bovis BCG Vaccination against Osteomyelitis in Children with Mycobacterium ulcerans Disease (Buruli Ulcer). CVI
9: 1389-1391
[Abstract]
[Full Text]