Previous Article | Next Article 
Infection and Immunity, September 2001, p. 5456-5463, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5456-5463.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Genetic Immunization with the Region Encoding the
-Helical Domain of PspA Elicits Protective Immunity against
Streptococcus pneumoniae
Joseph R.
Bosarge,1
James M.
Watt,2
D. Olga
McDaniel,3,4
Edwin
Swiatlo,2 and
Larry S.
McDaniel1,2,3,*
Departments of
Microbiology,1
Surgery,3
Medicine,2 and
Neurology,4 The University of
Mississippi Medical Center, Jackson, Mississippi 39216
Received 12 March 2001/Returned for modification 7 May
2001/Accepted 5 June 2001
 |
ABSTRACT |
Pneumococcal surface protein A (PspA) is a pneumococcal virulence
factor capable of eliciting protection against pneumococcal infection
in mice. Previous studies have demonstrated that the protection is
antibody mediated. Here we examined the ability of
pspA to elicit a protective immune response
following genetic immunization of mice. Mice were immunized by
intramuscular injections with a eukaryotic expression vector encoding
the
-helical domain of PspA/Rx1. Immunization induced a
PspA-specific serum antibody response, and immunized mice survived
pneumococcal challenge. Survival and antibody responses occurred in a
dose-dependent manner, the highest survival rates being seen with doses
of 10 µg or greater. The ability of genetic immunization to elicit
cross-protection was demonstrated by the survival of immunized mice
challenged with pneumococcal strains differing in capsule and PspA
types. Also, immunized mice were protected from intravenous and
intratracheal challenges with pneumococci. Similar to the results seen
with immunization with PspA, the survival of mice genetically immunized with pspA was antibody mediated. There was no decline in
the level of protection 7 months after immunization. These results
support the use of genetic immunization to elicit protective immune
responses against extracellular pathogens.
 |
INTRODUCTION |
Much attention is being
focused on the promising new technology of DNA vaccination or genetic
immunization. Genetic immunization offers advantages over immunization
with purified protein. DNA vaccines are capable of eliciting both
humoral and cell-mediated immune responses (38). Plasmid
DNA containing unmethylated CpG motifs and used in immunizations has
been found to modulate immune responses (21, 33). The
presence of these motifs induces cytokine production and a generalized
activation of antigen-presenting cells, giving the DNA an adjuvant
effect (2, 41, 42). The cytokine profile induced leads to
a predominantly T-helper (Th) 1 (Th-1) response that reduces the
likelihood of allergic responses that may occur when proteins are used
(21, 31). Another advantage is the significantly lower
cost of production, since DNA is more easily produced and purified than
proteins. Considering that the greatest morbidity and mortality from
pneumococcal diseases are seen in the populations of developing
countries, such factors are extremely important. DNA vaccines are more
heat stable than protein vaccines, a fact which increases the efficacy
of their use in developing countries, where storage and transportation capabilities may be lacking. The economic and physical characteristics of DNA vaccines make them good candidates for global vaccination programs.
As the prevalence of multidrug-resistant pneumococcal strains
increases, the development of an effective vaccine becomes the primary
focus in preventing pneumococcal diseases. Although the capsular
polysaccharide (PS) of the pneumococcus is considered the major
antigenic determinant conferring immunity following infection
(22), the current 23-valent PS vaccine has had little impact on global morbidity and mortality (9, 12, 15, 34). More importantly, PS is poorly immunogenic in the most important risk
group, children under 3 years old (13, 17, 18, 32). Therefore, efforts in developing a pneumococcal vaccine capable of
eliciting a T-cell-dependent immune response have become a priority.
The pneumococcal conjugate vaccine recently approved for human use
overcomes the T-cell-independent nature of PS antigens, thereby making
them more immunogenic in children (16, 30, 35). Although
this strategy is an effective one, conjugate vaccines have negative
aspects of their own. In addition to their high cost, which reduces
their availability, conjugate vaccines are further limited in the
number of different PSs which can be incorporated, a problem which
reduces the potential range of protection. These concerns have led
researchers to look for pneumococcal proteins capable of eliciting
protective immunity.
Previous studies have established pneumococcal surface protein A (PspA)
as a virulence factor found on all pneumococcal isolates (8,
28). PspA consists of four major domains (25). The N-terminal half of the molecule comprises an
-helical domain. Following the
helix are two highly conserved domains: the
proline-rich domain and the choline binding domain. Seventeen amino
acids on the C-terminal end form the cytoplasmic tail. Based on
immunization studies with full-length and truncated fragments of PspA,
the
-helical domain was determined to contain protection-eliciting epitopes (8, 26, 27). Therefore, this domain was of
particular interest in our study. Immunization studies using purified
PspA have also demonstrated the ability of PspA to elicit protective immune responses that are cross-reactive among pneumococci with different capsule and PspA types (5, 25, 27). These
characteristics offer the possibility of inducing broad protection by
immunizing with one or just a few PspA types (7).
It was previously demonstrated that genetic immunization with
full-length pspA was able to elicit protection against
pneumococcal challenge (24). However, the level of
protection was below that obtained with immunization with purified
PspA, and there was an apparent lack of correlation between antibodies
against PspA and protection. In this study, we examined the possibility
that a fragment of pspA, when used for genetic immunization,
is able to elicit protection similar to that seen with immunization
with purified PspA. Our results demonstrate that genetic immunization can elicit effective protection against an extracellular bacterial pathogen. Moreover, our model system should be useful in optimizing the
expression of bacterial genes for genetic immunization.
 |
MATERIALS AND METHODS |
Plasmid construction and preparation.
The plasmid used in
this study was constructed by the ligation of a
KpnI/XbaI-digested pNGVL3 expression vector
(National Gene Vector Laboratory, Ann Arbor, Mich.) and a
KpnI/XbaI-digested PCR-amplified fragment from
the region encoding the
-helical domain of Streptococcus
pneumoniae PspA/Rx1. The pNGVL3 vector is driven by a
cytomegalovirus immediate-early enhancer and a promoter upstream of a
multiple cloning site. Downstream of the multiple cloning site is a
rabbit beta-globulin poly(A) signal for proper expression in eukaryotic
cells. The region encoding the
-helical domain of PspA was amplified
as previously described (26) from S. pneumoniae
Rx1 genomic DNA using the following primers: LSM180 (upstream primer),
5' GGGCGGTACCATTATGGCCAGTCAGTCTAAGCT 3', and LSM181
(downstream primer), 5' GGCTCTACCCCTAAGCTCTTAAGGTCAGC 3'.
The upstream primer contains a KpnI site and a translational start site. The downstream primer contains an XbaI site and
a stop codon. Vector and insert DNAs were gel purified, ligated, and
transformed into Escherichia coli DH5
. The derived
construct was designated pJB100 and was sequenced to confirm the
insert. Plasmid DNA was prepared using an EndoFree Plasmid Giga kit
(Qiagen, Santa Clarita, Calif.) and stored at
20°C until used.
Plasmid DNA was diluted in lactated Ringer's (LR) solution for immunizations.
In vitro expression.
Expression studies were carried out
using HeLa cells. The HeLa cells were transfected with two constructs:
pJB10, which contains the Rx1 PspA
-helix-encoding insert in
pcDNA3.1 (Invitrogen, Valencia, Calif.), and pJB100, which contains the
same insert in a pNGVL3 vector. Cells that received no DNA served as a
negative control. In preparation for transfection, HeLa cells were
grown in Dulbecco modified Eagle medium with 6% fetal bovine
serum to approximately 40% confluence in a
25-cm2 flask. The HeLa cells were then
transfected using 10 µg of plasmid DNA complexed with 60 µl of
Superfect transfection reagent (Qiagen). Cells were incubated with the
transfection complex for 2 to 3 h at 37°C. Cells were washed
twice with phosphate-buffered saline, and medium was added. After
48 h of growth, cells were removed from the flask by treatment
with 1 ml of 0.25% trypsin-0.1% EDTA and counted. Cells were then
suspended in sodium dodecyl sulfate loading buffer with 100 µg of
phenylmethylsulfonyl fluoride/ml, and the suspension was placed in a
boiling water bath for 5 min. Immunoblot analysis with anti-PspA
monoclonal antibody XiR278 was performed as previously described
(27).
Immunization studies.
Immunization studies were carried out
using CBA/N (CBA/CAHN-BTK XID/J) mice (Jackson Laboratory, Bar Harbor,
Maine). Mice received intramuscular injections of plasmids on days 0, 14, and 28. The immunizations consisted of plasmids diluted in a
50-µl delivery volume of LR solution and were given as lingual
injections (24). Mice were challenged 1 week after the
final boost (day 35), with the exception of the mice in the long-term
protection group, which were challenged 7 months after the final boost.
Mice were challenged by intravenous (i.v.) injections of 0.2 ml of a
pneumococcal strain diluted in LR solution. Additional mice were
challenged by intratracheal (i.t.) inoculation with 20 µl of
pneumococcal strain A66 diluted in LR solution. All mice were observed
for greater than 21 days postchallenge.
Anti-PspA antibody assays.
Serum antibody titers were
determined by enzyme-linked immunosorbent assays (ELISAs). Mice were
bled on days 0, 14, 28, and 35 for the collection of serum. Plates were
coated with 0.3 µg of pneumococcal strain D39 PspA/ml and
blocked with 1% bovine serum albumin in phosphate-buffered saline.
After the plates were washed, serum samples were added and serially
diluted. The plates were incubated overnight at 4°C and washed before
the addition of a biotinylated goat anti-mouse immunoglobulin-specific
antibody (Southern Biotechnology Associates, Birmingham, Ala.).
Following incubation and washing, streptavidin-alkaline phosphatase was added to each well, and the plates were allowed to incubate for 1 h at 37°C. After a final wash, 1 mg of p-nitrophenyl
phosphate disodium (Sigma, St. Louis, Mo.)/ml was added. Plates were
examined at 405 nm, and antibody concentrations were calculated based
on a standard curve generated using an anti-PspA antiserum of known concentration. Isotype determination of the anti-PspA antiserum was
performed in the same manner using biotinylated goat
anti-immunoglobulin G1 (IgG1) or biotinylated goat anti-IgG2a as the
secondary antibody. Samples were diluted 1:3, and the results of
the isotype-specific assays were expressed as the highest dilution
giving a reading greater than 0.1 unit of optical density above the background.
Passive protection assays.
Passive protection assays were
performed as previously described (40). Briefly, naive
CBA/N mice received 0.2-ml intraperitoneal injections of pooled serum
collected from mice immunized with 10 µg of pJB100 or PspA. The
immune serum from protein-immunized mice was diluted to a concentration
equivalent to that of the pJB100 immune serum (8 µg of
antigen-specific antibody/ml). Mice were given a 1:2, 1:20, or 1:200
dilution of serum in LR solution. Another group of mice received
injections of LR solution to serve as an additional control. One hour
after receiving the immune serum, mice were challenged with i.v.
injections of 500 CFU of pneumococcal strain WU2.
Statistics.
The results were analyzed statistically by the
two-tailed Fisher exact test.
 |
RESULTS |
Expression of the
-helical domain of Rx1 PspA in eukaryotic
cells.
HeLa cells were used to examine the expression of PspA in a
eukaryotic cell line (Fig. 1). Cell
lysates containing equivalent numbers of transfected cells were used in
immunoblot assays to detect the presence of PspA/Rx1 and to determine
the relative levels of expression for pJB10 and pJB100. Cells
transfected with pJB100 expressed a protein with an apparent molecular
mass of 43 kDa. However, in cells transfected with pJB10, this
protein was detected as a faint band visible only in the original blot. Based on the reactivity of XiR278 in the Western blotting, levels of
expression were higher with pJB100 than with pJB10. Therefore, pJB100
was chosen for further evaluation in the immunization studies.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Immunoblot of HeLa cell lysates tested with anti-PspA
monoclonal antibody XiR278. The indicated cell lysates or purified
full-length PspA/Rx1 (rightmost lane) were reacted with XiR278. The
pJB100 lane shows a band of the expected size of about 43 kDa. A 43 kDa
band in the pJB10 lane was visible only in the original blot.
|
|
Immunization with pJB100.
Two groups of mice, each receiving
50 µg of plasmid DNA, were immunized in the initial experiment (Fig.
2). One group of mice received pNGVL3,
the vector without any pspA insert, as a control. A second
group of mice received pJB100. Following immunization, the mice were
challenged i.v. with approximately 800 CFU of pneumococcal strain WU2.
This dose is greater than 50 times the 50% lethal dose
(LD50) for WU2 (6). Mice were
observed for greater than 21 days postchallenge. All of the mice that
received pJB100 survived the challenge. The mean number of days to
death in the control group was 2 days.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 2.
Immunization with pJB100. CBA/N mice were immunized with
50 µg of either pJB100 or pNGVL3 (control). Mice were challenged i.v.
with pneumococcal strain WU2. Data represent the results for five or
more mice per group.
|
|
Dose dependence.
To determine the optimum immunization dose,
groups of mice were immunized with different doses of pJB100. Groups
receiving doses of 50, 30, 10, 5, and 2 µg of pJB100 were evaluated
for anti-PspA antibody responses (Fig. 3)
and for protection against a fatal challenge (Fig.
4). An additional group receiving pNGVL3 served as the control. Serum samples collected on day 28 were analyzed
by ELISA to determine the antibody responses. To determine the levels
of protection provided at the different doses, mice were challenged
i.v. with approximately 80 CFU of WU2 on day 35. Doses of 50, 30, and
10 µg provided 100% protection. The level of protection was reduced
in the group receiving 5 µg, and protection was completely absent in
the group receiving 2 µg. Since the 10-µg dose was the minimal dose
that provided complete protection, it was chosen as the minimal
dose for all subsequent immunization studies. The reduced levels of
protection correlated with what would be expected of
dose-dependent responses.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
Dose-dependent antibody responses. CBA/N mice were
immunized with the indicated amounts of pJB100 or 50 µg of pNGVL3
(control). Serum samples collected on day 28 were analyzed by ELISA to
determine the antibody responses. Antibody concentrations were
calculated based on a standard curve generated using an anti-PspA
antiserum of known concentration. Data represent the results for four
mice per group. Error bars show standard errors of the
means.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 4.
Dose-dependent survival. CBA/N mice were immunized with
the indicated amounts of pJB100 or 50 µg of pNGVL3 (control). Mice
were challenged on day 35 with pneumococcal strain WU2. Data represent
the results for four mice per group.
|
|
Anti-PspA antibody responses.
Antibody responses to
pneumococcal surface antigens have been generally regarded as the
primary mechanism of protection against pneumococcal infection. To
evaluate the humoral responses to pJB100, serum anti-PspA antibody
concentrations were measured by ELISA. Serum was collected on days 0, 14, 28, and 35 (Fig. 5). Anti-PspA antibody concentrations rose quickly in the group immunized with 50 µg of pJB100 and reached a plateau at day 28. The rate of responses to the 10-µg dose was reduced, and the antibody levels at day 35 were
significantly lower than those in the group receiving the 50-µg dose.
Anti-PspA antibodies were not detected in control mice receiving
pNGVL3.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Anti-PspA antibody responses following immunization with
pJB100. CBA/N mice were immunized on days 0, 14, and 28 with pJB100 (10 [triangles] or 50 [squares] µg) or pNGVL3 (50 µg)
(circles). Data represent the results for seven or more mice per group.
Error bars show standard errors of the means.
|
|
IgG isotype specificity for determination of Th subtype.
We
used the IgG isotype of the anti-PspA antibodies as a surrogate marker
to determine the Th subtype. Previous studies have shown that DNA
vaccines given as intramuscular injections generate predominantly Th-1
responses (11, 21, 23, 37). Since Th-2 responses are
generally accepted as the Th responses involved in protection during a
natural infection (10, 40), it was important to evaluate
the Th subtype following immunization with pJB100. The predominant Th
subtype was determined by the ratio of IgG1 to IgG2a. Immunization
results are given in Table 1.
Antigen-specific IgG1 antibody served as a Th-2 marker, and
antigen-specific IgG2a served as a Th-1 marker (
1,
29,
36).
An IgG1/IgG2a ratio of >1 denotes a Th-2 response, and a
ratio
of <1 suggests a Th-1 response. Mice immunized with protein or
infected with D39 both responded in a Th-2 manner. This result
was
expected, since the route of administration would lead to
antigen
processing in the major histocompatibility complex class
II pathway
that leads to a Th-2 response. Mice receiving the 50-µg
dose of
pJB100 responded in a Th-1 fashion. However, mice receiving
10 µg of
pJB100 exhibited mixed Th
responses.
Cross-protection.
The ability of Rx1 PspA to elicit
cross-protection in protein immunization studies is well documented
(7, 8, 25-27). However, it is important to determine if
this holds true for genetic immunization with Rx1 pspA. To
evaluate the ability of pJB100 to elicit cross-protection, mice were
immunized with 10 µg of plasmid as described above and challenged
with different pneumococcal strains (Table
2). The pneumococcal strains chosen
represent three different capsule types and two different PspA clades
(5). In each case, survival of immunized mice was
observed.
Protection against i.t. challenge.
Since the pneumococcus is
primarily a respiratory pathogen, we examined the ability of pJB100 to
protect against challenge via the respiratory tract. Mice were
immunized with 10 µg of plasmid on the same immunization schedule as
that used in the other experiments. On day 35, mice were challenged
i.t. with approximately 80 CFU of A66. The LD50
for A66 by this route was determined to be less than 20 CFU (data not
shown). All mice in the immunized group survived challenge by this
route of infection (Fig. 6).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 6.
i.t. challenge of immunized mice. Mice were immunized
with 10 µg of pJB100 or pNGVL3 (control) and challenged on day 35 with pneumococcal strain A66. Data represent the results for six mice
per group.
|
|
Passive immunization assays.
Protection against pneumococcal
infection is considered antibody mediated. Therefore, we evaluated the
ability of immune serum generated in pJB100-immunized mice to provide
protection in naive mice. As a positive control, we used immune serum
from PspA/Rx1 immunized mice (Table 3).
Mice that received pooled pJB100 immune serum at a dilution of at least
1:20 were protected. Therefore, as little as 0.08 µg of
anti-PspA antibody per mouse was sufficient for protection.
Long-term protection.
Providing protection over a significant
portion of an immunized individual's life span is a major goal in
vaccine development. Here we assess the ability of pJB100 to elicit
protection over an extended period of time. CBA/N mice were immunized
with 10 µg of pJB100 or control (pNGVL3) on the same immunization
schedule as that used in the other experiments. Serum was collected on days 0, 14, 28, and 35 and at 11 weeks. Data for days 0 to 35 were used
in Fig. 5 for the control group and the 10-µg group. Anti-PspA
antibody levels not only persisted but actually increased between day
35 and week 11 in the immunized group (Fig. 5); the antibody
concentrations rose from 2.850 ± 0.908 µg/ml
(mean ± standard error of the mean) on day 35 to 7.72 ± 1.74 µg/ml at week 11 (the level of antibodies in the control group
was <0.005 µg/ml). The mice were challenged with WU2 7 months after
the initial immunization. All 10 mice receiving pJB100 survived the
challenge, demonstrating the ability of pJB100 to elicit persistent
antibody responses and long-term protection; only 1 of 9 mice in the
control group survived. The difference in survival between the
immunized and control mice was statistically significant
(P
0.0001).
 |
DISCUSSION |
The pneumococcus is an important antibiotic-resistant pathogen.
The mortality rate for invasive pneumococcal infections remains at 15 to 20% (3, 14). With increasing reports of
multiply-resistant pneumococcal isolates (4, 19, 20), the
mortality rate is likely to rise in the future. There is an urgent need
for the development of cost-effective pneumococcal vaccines.
The survival of immunized mice after challenge established the
effectiveness of pJB100. The overall survival rates for mice receiving
pJB100 were greater than 99%. Protection was confirmed by a greater
than 3-log increase in the LD50 for the immunized mice (data not shown). The results presented in this study demonstrate three major characteristics of the effectiveness of pJB100. First, pJB100 elicited cross-protective immunity similar to that seen with
immunization with PspA. However, DNA vaccines offer the ability to
express different PspA molecules from a single construct. This factor
could potentially broaden the range of protection to cover all known
clinical isolates. It also makes the standardization and production of
a multivalent DNA vaccine much easier than those of a multivalent
protein vaccine. A second demonstrated characteristic was the ability
of pJB100 to protect against both systemic and respiratory challenges.
This finding is significant because systemic and lower respiratory
tract infections are the most devastating forms of pneumococcal
disease. Last, the ability of pJB100 to provide long-term protection
was shown. Long-lasting immunity is the ultimate goal in the
development of any vaccine.
Since protection against pneumococcal infections is considered to be
primarily antibody mediated, it was important to evaluate the humoral
responses to immunization with pJB100. Immunization with pJB100 proved
capable of eliciting a significant anti-PspA immune response. Dose
experiments revealed a correlation between anti-PspA antibody
concentration and protection. This correlation was not seen in earlier
genetic immunization studies with full-length pspA.
Therefore, it was important to establish the relationship between
antibodies and protection in order to evaluate immune responses to
pJB100. The passive immunization experiments illustrated the
functionality of anti-PspA antibodies and their relationship to
protection. The survival of mice receiving pJB100 immune serum demonstrated the direct correlation between anti-PspA antibodies and
protection. In addition, the passive immunization experiments demonstrated that genetic immunization with pJB100 yields an antibody response that is qualitatively equivalent to that seen with
immunization with protein. A comparison of IgG isotype profiles among
genetically immunized, protein-immunized, and infected mice served as
an indicator of relative Th function. The data confirm other reports
that the Th-1 responses elicited by DNA vaccines are dependent on the
quantities of DNA administered (21, 31, 37). Since
protection is seen with both Th-1 and Th-2 IgG isotypes, no conclusions
can be made about the importance of Th subtype in this situation.
However, these observations are important for evaluating future
experiments designed to modulate immune responses.
The development of a pneumococcal DNA vaccine not only offers the
promise of a potential human vaccine but also offers insight into the
efficacy of DNA vaccines for use against extracellular pathogens.
Because of the ability of DNA vaccines to elicit cell-mediated immunity, much of the work done on DNA vaccines has focused on intracellular pathogens, with less attention being given to
extracellular pathogens. Genetic immunization is thought to elicit
immune responses that closely resemble those seen with natural
infections with intracellular pathogens (37, 39). Despite
the fact that antigen is expressed intracellularly, pJB100 elicited an
effective humoral response. The mechanism by which this occurs has not
been fully elucidated. Investigations into Th responses and
costimulatory requirements could lead to the development of more
effective vaccines. The key to examining these elements lies in the use
of an established model system, such as the pneumococcal challenge
model in mice. This model system allows the effective characterization
of DNA vaccines against extracellular pathogens. Now that we have
incorporated genetic immunization into the pneumococcal challenge
model, we can effectively explore variables involved in immune
responses to DNA vaccines.
 |
ACKNOWLEDGMENTS |
This study was supported by NIH grant AI43653.
We are grateful to Kristie Sidie for excellent technical assistance in
collecting ELISA data.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The University
of Mississippi Medical Center, Department of Microbiology, 2500 North State St., Jackson, MS 39216. Phone: (601) 984-6880. Fax: (601) 984-1708. E-mail: LMcDaniel{at}microbio.umsmed.edu.
Editor:
E. I. Tuomanen
 |
REFERENCES |
| 1.
|
Abbas, A. K.,
K. M. Murphy, and A. Sher.
1996.
Functional diversity of helper T lymphocytes.
Nature
383:787-793[CrossRef][Medline].
|
| 2.
|
Akbari, O.,
N. Panjwani,
S. Garcia,
R. Tascon,
D. Lowrie, and B. Stockinger.
1999.
DNA vaccination: transfection and activation of dendritic cells as key events for immunity.
J. Exp. Med.
189:169-177[Abstract/Free Full Text].
|
| 3.
|
Arnold, K. E.,
R. J. Leggiadro,
R. F. Breiman,
H. B. Lipman,
B. Schwartz,
M. A. Appleton,
K. O. Cleveland,
H. C. Szeto,
B. C. Hill,
F. C. Tenover,
J. A. Elliott, and R. R. Facklam.
1996.
Risk factors for carriage of drug-resistant Streptococcus pneumoniae among children in Memphis, Tennessee.
J. Pediatr.
128:757-764[CrossRef][Medline].
|
| 4.
|
Breiman, R. F.,
J. C. Butler,
F. C. Tenover,
J. A. Elliott, and R. R. Facklam.
1994.
Emergence of drug-resistant pneumococcal infections in the United States.
JAMA
271:1831-1835[Abstract/Free Full Text].
|
| 5.
|
Briles, D. E.,
S. K. Hollingshead,
E. Swiatlo,
A. Brooks-Walter,
A. Szalai,
A. Virolainen,
L. S. McDaniel,
K. A. Benton,
K. White,
K. Prellner,
A. Hermansson,
P. C. Aerts,
H. van Dijk, and M. J. Crain.
1997.
PspA and PspC: their potential for use as pneumococcal vaccines.
Microb. Drug Resist.
3:401-408[Medline].
|
| 6.
|
Briles, D. E.,
J. Horowitz,
L. S. McDaniel,
W. H. Benjamin, Jr.,
J. L. Claflin,
C. L. Booker,
G. Scott, and C. Forman.
1986.
Genetic control of susceptibility to pneumococcal infection.
Curr. Top. Microbiol. Immunol.
124:103-120[Medline].
|
| 7.
|
Briles, D. E.,
J. D. King,
M. A. Gray,
L. S. McDaniel,
E. Swiatlo, and K. A. Benton.
1996.
PspA, a protection-eliciting pneumococcal protein: immunogenicity of isolated native PspA in mice.
Vaccine
14:858-867[CrossRef][Medline].
|
| 8.
|
Briles, D. E.,
R. C. Tart,
E. Swiatlo,
J. P. Dillard,
P. Smith,
K. A. Benton,
B. A. Ralph,
A. Brooks-Walter,
M. J. Crain,
S. K. Hollingshead, and L. S. McDaniel.
1998.
Pneumococcal diversity: considerations for new vaccine strategies with an emphasis on pneumococcal surface protein A (PspA).
Clin. Microbiol. Rev.
11:645-657[Abstract/Free Full Text].
|
| 9.
|
Bruyn, G. A. W., and R. van Furth.
1991.
Pneumococcal polysaccharide vaccines: indications, efficacy and recommendations.
Eur. J. Clin. Microbiol. Infect. Dis.
10:897-910[CrossRef][Medline].
|
| 10.
|
Bruyn, G. A. W.,
B. J. M. Zegers, and R. van Furth.
1992.
Mechanisms of host defence against infection with Streptococcus pneumoniae.
Clin. Infect. Dis.
14:251-262[Medline].
|
| 11.
|
Chow, Y.-H.,
B.-L. Chiang,
Y.-L. Lee,
W.-K. Chi,
W.-C. Lin,
Y.-T. Chen, and M.-H. Tao.
1998.
Development of Th1 and Th2 populations and the nature of immune responses to hepatitis B virus DNA vaccines can be modulated by codelivery of various cytokine genes.
J. Immunol.
160:1320-1329[Abstract/Free Full Text].
|
| 12.
|
Control, C. F. D.
1989.
Pneumococcal polysaccharide vaccines: recommendations of the Immunization Practices Advisory Committee.
Morb. Mortal. Wkly. Rep.
38:64-68[Medline].
|
| 13.
|
Cowan, M. J.,
A. J. Ammann,
D. W. Wara,
V. M. Howie,
L. Schultz,
N. Doyle, and M. Kaplan.
1978.
Pneumococcal polysaccharide immunization in infants and children.
Pediatrics
62:721-727[Abstract/Free Full Text].
|
| 14.
|
Duchin, J. S.,
R. F. Breiman,
A. Diamond,
H. B. Lipman,
S. L. Block,
J. A. Hedrick,
R. Finger, and J. A. Elliott.
1995.
High prevalence of multidrug-resistant Streptococcus pneumoniae among children in a rural Kentucky community.
Pediatr. Infect. Dis. J.
14:745-750[Medline].
|
| 15.
|
Fedson, D. S.
1998.
Pneumococcal vaccination in the United States and 20 other developed countries, 1981-1996.
Clin. Infect. Dis.
26:1117-1123[Medline].
|
| 16.
|
Gillespie, S. H.
1989.
Aspects of pneumococcal infection including bacterial virulence, host response and vaccination.
J. Med. Microbiol.
28:237-248[Free Full Text].
|
| 17.
|
Gotschlich, E. C.,
I. Goldschneider,
M. L. Lepow, and R. Gold.
1977.
The immune response to bacterial polysaccharides in man, p. 391-402.
In
E. Haber, and R. Krauss (ed.), Antibodies in human diagnosis and therapy. Raven Press, New York, N.Y.
|
| 18.
|
Gray, B. M.,
H. C. Dillion, and D. E. Briles.
1983.
Epidemiological studies of Streptococcus pneumoniae in infants: development of antibody to phosphocholine.
J. Clin. Microbiol.
18:1102-1107[Abstract/Free Full Text].
|
| 19.
|
Jacobs, M. R.
1992.
Treatment and diagnosis of infections caused by drug-resistant Streptococcus pneumoniae.
Clin. Infect. Dis.
15:119-127[Medline].
|
| 20.
|
Klugman, K. P.
1990.
Pneumococcal resistance to antibiotics.
Clin. Microbiol. Rev.
3:171-196[Abstract/Free Full Text].
|
| 21.
|
Leclerc, C.,
E. Deriaud,
M. Rojas, and R. G. Whalen.
1997.
The preferential induction of a Th1 immune response by DNA-based immunization is mediated by the immunostimulatory effect of plasmid DNA.
Cell. Immunol.
179:97-106[CrossRef][Medline].
|
| 22.
|
MacLeod, C. M.,
R. G. Hodges,
M. Heidelberger, and W. G. Bernhard.
1945.
Prevention of pneumococcal pneumonia by immunization with specific capsular polysaccharides.
J. Exp. Med.
82:445-465[Abstract].
|
| 23.
|
Manickan, E.,
R. J. D. Rouse,
Z. Yu,
W. S. Wire, and B. T. Rouse.
1995.
Genetic immunization against herpes simplex virus: protection is mediated by CD4+ T lymphocytes.
J. Immunol.
155:259-265[Abstract].
|
| 24.
|
McDaniel, L. S.,
F. Loechel,
C. Benedict,
T. Greenway,
D. E. Briles,
R. M. Conry, and D. T. Curiel.
1997.
Immunization with a plasmid expressing pneumococcal surface protein A (PspA) can elicit protection against fatal infection with Streptococcus pneumoniae.
Gene Ther.
4:375-377[CrossRef][Medline].
|
| 25.
|
McDaniel, L. S.,
D. O. McDaniel,
S. K. Hollingshead, and D. E. Briles.
1998.
Comparison of the PspA sequence from Streptococcus pneumoniae EF5668 to the previously identified PspA sequence from strain Rx1 and ability of PspA from EF5668 to elicit protection against pneumococci of different capsular types.
Infect. Immun.
66:4748-4754[Abstract/Free Full Text].
|
| 26.
|
McDaniel, L. S.,
B. A. Ralph,
D. O. McDaniel, and D. E. Briles.
1994.
Localization of protection-eliciting epitopes on PspA of Streptococcus pneumoniae between amino acid residues 192 and 260.
Microb. Pathog.
17:323-337[CrossRef][Medline].
|
| 27.
|
McDaniel, L. S.,
J. S. Sheffield,
P. Delucchi, and D. E. Briles.
1991.
PspA, a surface protein of Streptococcus pneumoniae, is capable of eliciting protection against pneumococci of more than one capsular type.
Infect. Immun.
59:222-228[Abstract/Free Full Text].
|
| 28.
|
McDaniel, L. S.,
J. Yother,
M. Vijayakumar,
L. McGarry,
W. R. Guild, and D. E. Briles.
1987.
Use of insertional inactivation to facilitate studies of biological properties of pneumococcal surface protein A (PspA).
J. Exp. Med.
165:381-394[Abstract/Free Full Text].
|
| 29.
|
Mosmann, T. R., and R. L. Coffman.
1989.
Heterogeneity of cytokine secretion patterns and functions of helper T cells.
Adv. Immunol.
46:111-147[Medline].
|
| 30.
|
O'Brien, K. L.,
M. C. Steinhoff,
K. Edwards,
H. Keyserling,
M. L. Thoms, and D. Madore.
1996.
Immunologic priming of young children by pneumococcal glycoprotein conjugate, but not polysaccharide, vaccines.
Pediatr. Infect. Dis. J.
15:425-430[CrossRef][Medline].
|
| 31.
|
Raz, E.,
H. Tighe,
Y. Sato,
M. Corr,
J. A. Dudler,
M. Roman,
S. L. Swain,
H. L. Spiegelberg, and D. A. Carson.
1996.
Preferential induction of a Th1 immune response and inhibition of specific IgE antibody formation by plasmid DNA immunization.
Proc. Natl. Acad. Sci. USA
93:5141-5145[Abstract/Free Full Text].
|
| 32.
|
Rijkers, G. T.,
E. A. M. Sanders,
M. A. Breukels, and B. J. M. Zegers.
1996.
Responsiveness of infants to capsular polysaccharides: implications for vaccine development.
Rev. Med. Microbiol.
7:3-12.
|
| 33.
|
Sato, Y.,
M. Roman,
H. Tighe,
D. Lee,
M. Corr,
M.-D. Nguyen,
G. J. Silverman,
M. Lotz,
D. A. Carson, and E. Raz.
1996.
Immunostimulatory DNA sequences necessary for effective intradermal gene immunization.
Science
273:352-354[Abstract].
|
| 34.
|
Shapiro, E. D.,
A. T. Berg,
R. Austrian,
D. Schroeder,
V. Parcells,
A. Margolis,
R. K. Adair, and J. D. Clemmens.
1991.
Protective efficacy of polyvalent pneumococcal polysaccharide vaccine.
N. Engl. J. Med.
325:1453-1460[Abstract].
|
| 35.
|
Shelly, M. A.,
H. Jacoby,
G. J. Riley,
B. T. Graves,
M. Pichichero, and J. J. Treanor.
1997.
Comparison of pneumococcal polysaccharide and CRM197-conjugated pneumococcal oligosaccharide vaccines in young and elderly adults.
Infect. Immun.
65:242-247[Abstract].
|
| 36.
|
Street, N. E., and T. R. Mosmann.
1991.
Functional diversity of T lymphocytes due to secretion of different cytokine patterns.
FASEB J.
5:171-177[Abstract].
|
| 37.
|
Tighe, H.,
M. Corr,
M. Roman, and E. Raz.
1998.
Gene vaccination: plasmid DNA is more than just a blueprint.
Immunol. Today
19:89-97[CrossRef][Medline].
|
| 38.
|
Ulmer, J. B.,
J. J. Donnelly,
S. E. Parker,
G. H. Rhodes,
P. L. Felgner,
V. J. Dwarki,
S. H. Gromkowski,
R. R. Deck,
C. M. DeWitt,
A. Friedman, et al.
1993.
Heterologous protection against influenza by injection of DNA encoding a viral protein.
Science
259:1745-1749[Abstract/Free Full Text].
|
| 39.
|
Vogel, F. R., and N. Sarver.
1995.
Nucleic acid vaccines.
Clin. Microbiol. Rev.
8:406-410[Abstract].
|
| 40.
|
Wortham, C.,
L. Grinberg,
D. C. Kaslow,
D. E. Briles,
L. S. McDaniel,
A. Lees,
M. Flora,
C. M. Snapper, and J. J. Mond.
1998.
Enhanced protective antibody responses to PspA after intranasal or subcutaneous injections of PspA genetically fused to granulocyte-macrophage colony-stimulating factor or interleukin-2.
Infect. Immun.
66:1513-1520[Abstract/Free Full Text].
|
| 41.
|
Yi, A.-K.,
J. H. Chace,
J. S. Cowdery, and A. M. Krieg.
1996.
INF- promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides.
J. Immunol.
156:558-564[Abstract].
|
| 42.
|
Yi, A.-K.,
R. Tuetken,
T. Redford,
M. Waldschmidt,
J. Kirsch, and A. M. Krieg.
1998.
CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species.
J. Immunol.
160:4755-4761[Abstract/Free Full Text].
|
Infection and Immunity, September 2001, p. 5456-5463, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5456-5463.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ferreira, D. M., Darrieux, M., Oliveira, M. L. S., Leite, L. C. C., Miyaji, E. N.
(2008). Optimized Immune Response Elicited by a DNA Vaccine Expressing Pneumococcal Surface Protein A Is Characterized by a Balanced Immunoglobulin G1 (IgG1)/IgG2a Ratio and Proinflammatory Cytokine Production. CVI
15: 499-505
[Abstract]
[Full Text]
-
Moore, Q. C. III, Johnson, L., Repka, M., McDaniel, L. S.
(2007). Immunization with PspA Incorporated into a Poly(Ethylene Oxide) Matrix Elicits Protective Immunity against Streptococcus pneumoniae. CVI
14: 789-791
[Abstract]
[Full Text]
-
Quin, L. R., Moore, Q. C. III, McDaniel, L. S.
(2007). Pneumolysin, PspA, and PspC Contribute to Pneumococcal Evasion of Early Innate Immune Responses during Bacteremia in Mice. Infect. Immun.
75: 2067-2070
[Abstract]
[Full Text]
-
Pimenta, F. C., Ribeiro-Dias, F., Brandileone, M. C. C., Miyaji, E. N., Leite, L. C. C., Sgambatti de Andrade, A. L. S.
(2006). Genetic Diversity of PspA Types among Nasopharyngeal Isolates Collected during an Ongoing Surveillance Study of Children in Brazil.. J. Clin. Microbiol.
44: 2838-2843
[Abstract]
[Full Text]
-
Ferreira, D. M., Miyaji, E. N., Oliveira, M. L. S., Darrieux, M., Areas, A. P. M., Ho, P. L., Leite, L. C. C.
(2006). DNA vaccines expressing pneumococcal surface protein A (PspA) elicit protection levels comparable to recombinant protein.. J Med Microbiol
55: 375-378
[Abstract]
[Full Text]
-
Garcia-Suarez, M. d. M., Cima-Cabal, M. D., Florez, N., Garcia, P., Cernuda-Cernuda, R., Astudillo, A., Vazquez, F., De Los Toyos, J. R., Mendez, F. J.
(2004). Protection against Pneumococcal Pneumonia in Mice by Monoclonal Antibodies to Pneumolysin. Infect. Immun.
72: 4534-4540
[Abstract]
[Full Text]
-
Rush, C., Mitchell, T., Garside, P.
(2002). Efficient Priming of CD4+ and CD8+ T Cells by DNA Vaccination Depends on Appropriate Targeting of Sufficient Levels of Immunologically Relevant Antigen to Appropriate Processing Pathways. J. Immunol.
169: 4951-4960
[Abstract]
[Full Text]
-
Miyaji, E. N., Ferreira, D. M., Lopes, A. P. Y., Brandileone, M. C. C., Dias, W. O., Leite, L. C. C.
(2002). Analysis of Serum Cross-Reactivity and Cross-Protection Elicited by Immunization with DNA Vaccines against Streptococcus pneumoniae Expressing PspA Fragments from Different Clades. Infect. Immun.
70: 5086-5090
[Abstract]
[Full Text]