Previous Article | Next Article 
Infection and Immunity, September 2001, p. 5589-5596, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5589-5596.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Laccase of Cryptococcus neoformans Is a
Cell Wall-Associated Virulence Factor
Xudong
Zhu,1
Jack
Gibbons,2
Javier
Garcia-Rivera,3
Arturo
Casadevall,4 and
Peter
R.
Williamson1,*
Division of Infectious Diseases, University
of Illinois at Chicago College of Medicine,1
Division of Biological Sciences, University of Illinois at
Chicago,2 Chicago, Illinois, and
Department of Microbiology and
Immunology3 and Division of
Infectious Diseases,4 Albert Einstein College of
Medicine, Bronx, New York
Received 9 May 2001/Returned for modification 11 June 2001/Accepted 20 June 2001
 |
ABSTRACT |
Virulence is the outcome of an interaction between the host and a
microbe and is characterized by a large array of opposing reactions
operating at the host-pathogen interface. Cryptococcus neoformans is an important opportunistic pathogen in
immunocompromised patients, including those with human immunodeficiency
virus, and expresses a virulence-associated laccase which is believed
to oxidize brain catecholamines and iron as a defense against host immune cells. In the present report, we investigated the cellular location of laccase to understand more fully how it contributes to
cryptococcal virulence. A monoclonal antibody to the C. neoformans laccase was generated and used to show localization in
the cell walls of representative serotype A (H99) and serotype D
(B-3501) strains by immunoelectron microscopy. In addition, confocal
microscopy was used to show a peripheral location of green fluorescent
protein-tagged laccase expressed in live H99 cells. Biochemical studies
showed that laccase could be released from intact cells or cell wall fractions with glucanase enzymes but was retained in the cell wall
after sequential extraction with 1 M NaCl, 6 M urea, and 1% sodium
dodecyl sulfate. The presence of a hydrolyzable bond linking laccase to
the cell wall was suggested by removal of laccase from cell wall
preparations after they were boiled in 1% sodium dodecyl sulfate, as
was the presence of a disulfide or thioester bond by removal with
dithiothreitol or
-mercaptoethanol. These data show that laccase is
present as a tightly associated cell wall enzyme that is readily
accessible for interactions with host immune cells.
 |
INTRODUCTION |
Cryptococcus neoformans
is a major opportunistic pathogen in immunocompromised hosts and
accounts for a significant proportion of AIDS-related infections
(28). Three important virulence properties in C. neoformans are its ability to grow at 37°C, requiring the factor
calcineurin (27); production of a polysaccharide capsule (4); and expression of the enzyme laccase (14,
37), which forms a melanin-like pigment when grown on substrates
containing polyphenolic or polyaminobenzene compounds (5).
Recently, additional virulence factors have been proposed, including
urease (8), phospholipase (7), and mannitol
production (6).
More than 35 years ago, Staib first described in vitro melanin
pigmentation by C. neoformans and associated the phenomenon with virulence (31). In spite of considerable efforts by
several investigators, many aspects of the nature of laccase-derived
products in vivo remain unclear. In vitro, the yeast produces a black
melanin pigment after the addition of exogenous catecholamines, a
pigment which has been shown to have several immunological properties that are protective for the yeast (35). However, while
laccase-derived dopamine products are clearly formed in vivo (21,
24), the exact chemical nature of the product in the host
remains to be determined. Dopamine-derived laccase products formed in
the brain confer acid stability to the cell wall similar to that
conferred by true melanin (23) and react to
antibodies made against polymerized melanin (24) but
do not have the absorptive properties of a typical melanin polymer
which are present in cryptococcal melanin produced in vitro
(21). In addition, laccase alone has been demonstrated to
confer significant protection against murine alveolar macrophages
independent of dopamine by virtue of the enzyme's iron oxidase
activity, which appears to diminish the host cell oxidative burst by
reducing available FeII stores (20).
Likewise, the cellular localization of laccase is not fully understood.
Most information on this matter is from experiments the main purpose of
which was to provide soluble enzyme for purification, not to provide
localization of the predominant form of the enzyme. For example,
solubilization of small amounts of enzyme with detergents has suggested
that laccase is a membrane-bound enzyme when cells are grown at neutral
pH (29). In contrast, the finding of a minor fraction of
soluble enzyme when cells are grown under acidic conditions might
suggest that the enzyme has a periplasmic or cytosolic location under
some conditions (14, 37). Biochemical and amino acid
analysis of laccase shows a hydrophobic 20-amino-acid leader sequence
which is proteolytically removed in the mature enzyme as well as four
glycosylation sites which are each linked to N-acetyl
glucosamine and six terminal mannose residues (37); both properties suggest transport within the secretory pathway. The
implications of the cellular location of laccase are important, because
its ability to act as an immune modulator at the host-parasite interface could be affected by the enzyme's proximity to the
extracellular space. For example, oxidation of low levels of exogenous
brain catecholamines as well as transient host cell FeII
species in the phagolysosome would be most effective for an enzyme exposed directly to the reagents at a relatively superficial location and would obviate the need for additional dopamine or iron transport mechanisms.
Because of these questions, we sought to determine the cellular
location of laccase in representative serotype A and D cryptococcal strains by electron microscopy and fluorescent microscopy of green fluorescent protein (GFP)-tagged laccase as well as by biochemical methods. These results show that the majority of mature laccase is
strongly associated with the cell wall of the yeast, which allows the
enzyme to have maximal access to host cell substrates in its role as
modulator of immune response in C. neoformans.
 |
MATERIALS AND METHODS |
Strains.
C. neoformans strain ATCC 208821 (H99)
was a gift of J. Perfect, and C. neoformans strain ATCC
34873 (B-3501) was a gift of K. J. Kwon-Chung. Escherichia
coli strain DH10B (Life Technologies, Bethesda, Md.) was the host
strain for the recovery of ligated plasmids.
Production of recombinant laccase.
Recombinant laccase was
expressed in Pichia pastoris by using expression plasmid
pPIC93 as previously described (20). Expressed laccase was
purified on diethylaminoethyl-Sepharose (Sigma) and then
subjected to gel filtration chromatography with a TosoHaas TSK-Gel
G2000SW 7.8- by 300-mm column (Sulpelco, Bellefonte, Pa.). In addition,
an N-terminal fragment of laccase was expressed in E. coli
by using the pIH902 expression system (New England Biolabs, Beverly,
Mass.). A 588-bp fragment of laccase cDNA obtained by PCR with
Pfu polymerase (Stratagene, La Jolla, Calif.), plasmid p6 as
a template containing laccase cDNA (37), and primers
N-term-lacc-S (GCCGCCGAATTCAAGACTGATGAGTCGCCA) and
N-term-lacc-A (GCCGCCTCTAGAAGTGGCTAGAGCTGCAATGAT) was endonuclease digested with EcoRI and
XbaI and inserted into compatible sites of pIH902. The
recombinant maltose-binding protein-laccase fusion protein
(MBP-laccase) and the MBP were expressed and purified on
amylose-Sepharose according to the manufacturer's directions.
Immunization.
Male BALB/c mice, 18 to 20 weeks old (National
Cancer Institute, Rockville, Md.), were injected intraperitoneally with
full-length recombinant laccase (15, 25, 35, 45, or 50 µg) in
a 1:1 (vol/vol) emulsion of complete Freund's adjuvant (Sigma) and
phosphate-buffered saline (PBS). At week 4 after immunization, mice
were boosted with 25 µg of laccase in a 1:1 (vol/vol) emulsion of
incomplete Freund's adjuvant (Sigma) and PBS. After the immune
response was induced, the mice were bled from the retro-orbital
plexus, and their sera were analyzed for antibodies to laccase by
enzyme-linked immunosorbent assay (ELISA) as described below. The mouse
with the highest antibody titers was boosted twice with 50 µg in PBS at a 3-h interval on week 24. After 1 day, the mouse was boosted again
with 50 µg of laccase in PBS.
Production of hybridomas.
One day after receiving the last
boost, the mouse was sacrificed and the spleen was removed. A
single-cell suspension was fused with the myeloma P3xA63Ag8.653 at a
ratio of 4:1 in the presence of 50% polyethylene glycol as
previously described (10). Fused cells were suspended in
hypoxanthine-aminopterin-thymidine (HAT) medium supplemented with
Dulbecco's modified Eagle's medium with L-glutamine
(Mediatech, Washington, D.C.) containing 20% heat-inactivated fetal
bovine serum (FBS) (Harlan Bioproducts for Science, Indianapolis,
Ind.), 10% NCTC-109 medium (Life Technologies, GIBCO BRL, Grand
Island, N.Y.), 2% HAT (Sigma), 1% nonessential amino acids (Life
Technologies, GIBCO BRL), and 1% penicillin-streptomycin (Life
Technologies, GIBCO BRL); a suspension of 3 × 105
cells/ml was seeded in 20 96-well tissue culture-treated plates (Becton Dickinson) and incubated in a 10% CO2 incubator at
37°C. Hybridomas were fed with complete HAT medium and 10%
Opti-Clone Hybridoma Cloning Factor (ICN Biochemicals). Supernatants
were screened for the presence of monoclonal antibodies (MAbs) to
laccase by ELISA. Hybridomas secreting MAbs of interest were subcloned twice in soft agarose. Single cells were selected, screened, and expanded. Complete HAT medium was substituted by complete
hypoxantine-thymidine medium with 10% Opti-Clone Hybridoma Cloning
Factor (ICN Biochemicals). The concentrations of hypoxantine-thymidine
medium, FBS, and the Opti-Clone Hybridoma Cloning Factor were reduced
gradually. Selected hybridomas were grown in medium supplemented with
Dulbecco's modified Eagle's medium with L-glutamine
(Mediatech) containing 10% FBS (Harlan Bioproducts for Science),
10% NCTC-109 (Life Technologies, GIBCO BRL), 1% nonessential
amino acids (Life Technologies, GIBCO BRL), and 1%
penicillin-streptomycin (Life Technologies, GIBCO BRL). MAbs present in
the supernatants were concentrated and treated with sodium azide at a
final concentration of 1 mM.
ELISA.
Polystyrene 96-well ELISA plates (Corning
Glass Works, Corning, N.Y.) were incubated with laccase (1 µg/ml), MBP-laccase (1 µg/ml), 1% bovine serum albumin (BSA), or
MBP (1 µg/ml) for 1 h at 37 or 4°C overnight. The plates were
blocked with 200 µl of 1% BSA for 2 h. Each of the incubations
was followed by three washes with 0.1% Tween 20 in Tris-buffered
saline. The wells were first treated with 50 µl of hybridoma culture
supernatant and incubated for 1 h at 37°C. After the wells were
washed, 50 µl of a 1:1,000 alkaline phosphatase-conjugated goat
anti-mouse total immunoglobulin G (IgG) (H+L) (Southern
Biotechnologies, Inc., Birmingham, Ala.) was added to the wells and
incubated for 1 h at 37°C. Detection of bound antibodies was
determined by addition of p-nitrophenyl phosphate (Sigma).
After 1 h, the absorbance was measured at 405 nm with a Ceres 900 HDi EIA Workstation (Bio-Tek Instruments, Inc., Winooski, Vt.). The
isotype of each hybridoma was determined with alkaline
phosphatase-conjugated antibodies specific for IgG1, IgG2a, IgG2b, and IgG3.
Electron microscopy.
C. neoformans strains H99
and B-3501 were grown on YP-glycerol agar (2% glycerol, 2% peptone,
1% yeast extract), washed twice in distilled water, then transferred
to modified asparagine agar without glucose (1-g/liter asparagine, 10 mM sodium phosphate, [pH 6.5], 0.1-g/liter MgSO4, 50 µM
CaCl2), and incubated for 2 days at 25°C to express
laccase. Yeast cells were washed three times in sodium phosphate, pH
7.2, and then fixed in 4% (vol/vol) paraformaldehyde and 0.05%
(vol/vol) glutaraldehyde in 100 mM sodium phosphate buffer, pH 7.2, for
16 h at 4°C. Cells were then washed three times for 10 min per
wash in phosphate buffer and then dehydrated for 45 min in a
graded series of ethanol concentrations (15, 30, 50, 75, and 100%
[vol/vol]), with two changes each. Infiltration was continued with 2 parts of ethanol to 1 part of LR White resin and then 1:1 and 1:2
ratios of ethanol and LR White resin each for 2 days. Pure LR White
resin infiltration was completed over 24 h with three changes, and
the samples were then polymerized in 1 ml of pure LR White resin in a
vacuum oven at 50°C for 3 days. Cured blocks were trimmed and thin
sectioned with a diamond knife on a Riechert Ultra Cut E ultramicrotome
(Leica, Inc., Deerfield, Ill.), and the sections were picked up on
200-hex-mesh Ni grids. The thin sections on the Ni grids were incubated
for 45 min at room temperature in blocking solution (0.8% [wt/vol]
BSA, 0.1% [wt/vol] immunogold-silver stain-quality gelatin, 5%
[wt/vol] normal goat serum in PBS [pH 7.4]); washed twice in
0.8% (wt/vol) BSA, 0.1% (wt/vol) gelatin, and 0.025%
(vol/vol) Tween 20 in PBS (pH 7.4); and incubated overnight with MAb
clone G3P4D3 at a concentration of 2.6 µg/ml in 0.8% (wt/vol) BSA,
0.1% (wt/vol) gelatin, and 1% (vol/vol) normal goat serum in
PBS. Then, the sections were washed twice in washing
solution and incubated for 4 h with immunogold-labeled secondary
antibody (goat anti-mouse IgG; Amersham) diluted 1:25. Grids were
washed six times with the washing solution for 5 min per wash and then
twice with PBS, and the samples were fixed for 10 min with 2%
(vol/vol) glutaraldehyde in PBS. Grids were then washed twice in PBS
and three times in distilled water, dried, stained with 2% (wt/vol)
aqueous uranyl acetate for 5 min, dried, stained with lead citrate for
2 min, and photographed with a JEOL 1200 EX transmission electron
microscope. Seven randomly selected cells were selected for each of the
four incubation conditions; gold particles were localized by
morphological criteria and counted. Cross-sectional areas of cell walls
and cell interiors were assessed by weighing traced-out photographs and
comparing them to equivalently traced standard areas. Values were
expressed as the mean of seven values ± standard deviation.
Fluorescent microscopy of GFP-tagged laccase.
A
CNLAC1-GFP fusion protein expression plasmid was constructed
as follows: an HgR-actin fusion gene (a gift of J. Perfect) was
inserted into the XhoI site of plasmid p5.1, which contains a 6-kb genomic fragment of CNLAC1 (37), and an
AvrII restriction site was introduced into CNLAC1
within the open reading frame (ORF) in a position downstream of the
CNLAC1 leader sequence by using divergent PCR and Extend Mix
(Stratagene) and the primers GCCGCCCCTAGGATATCGAAGGTATACTCTCT
and GCCGCCCCTAGGGCTTTCGCCAGCCCTGAT, followed by
endonuclease digestion with AvrII, religation,
transformation, and recovery in E. coli. The GFP ORF of
pFRED25 (a generous gift of A. Stauber) (32) was amplified
by means of PCR using the primers
GCCGCCCCTAGGTAGCAAAGGAGAAGAACTCTT and
GCCGCCCCTAGGGTTGTACAGTTCATCCATGC, followed by digestion with
AvrII and ligation into a compatible site within the
CNLAC1 ORF to produce pGFP-CNLAC. Sequence of the GFP-tagged
laccase construct pGFP-CNLAC was verified by automated sequencing
(CRC-DNA Sequencing Facility, Chicago, Ill.). pGFP-CNLAC was
electroporated into H99 cells and selected on hygromycin-containing media as previously described (9). Two transformants were
selected and shown by Southern blotting to have the construct
present as an episome. The transformants were grown on
yeast-peptone-dextrose (YPD) agar for 2 days and derepressed for
laccase activity by 2 days of growth on asparagine agar, without
glucose (pH 7.0), as previously described (20) and
examined for epifluorescence after being embedded in soft agarose as
previously described (2). Microscopy was performed with a
Zeiss 510 laser confocal microscope and transformants were
observed after excitation with 450 to 490 nm of light with a 520-nm
cutoff filter. Cells were also observed at other wavelengths to monitor
background autofluorescence.
Biochemical localization studies of cryptococcal laccase.
Cells were derepressed for laccase production in the same way as for
electron microscopy, and cell walls were prepared with a protocol
similar to to that of Kollar et al. (16). Briefly, cells
were broken by agitation with 0.45-µm-diometer glass beads for a
total of 2 min with a Braun homogenizer (B. Braun Biotech, Allentown,
Pa.). Microscopic observation of broken cells revealed only cellular
debris with few intact cells. Cell suspensions were assayed for laccase
activity, carbohydrate, and protein; cell components were then
subjected to centrifugation at 16,000 × g for 30 min.
Fractured cell pellets were washed three times with 10 mM sodium
phosphate buffer, pH 6.5, followed by sequential extraction with 1 M
NaCl, 6 M urea, and 1% sodium dodecyl sulfate (SDS) in 10 mM sodium
phosphate, pH 6.5. Salt-urea-SDS-extracted fractured cell
pellets were then washed twice in distilled water and once with 10 mM
sodium citrate, pH 5.8, and digested with 40 mg of glucanase per ml
from Trichoderma harzianum (Sigma) at 37°C for 2 h.
Digested cell pellets were then subjected to microcentrifugation (16,000 × g for 30 min) or ultracentrifugation
(100,000 × g for 4 h). Alternatively,
salt-urea-SDS-extracted fractured cell pellets were incubated with
either 30 mM sodium hydroxide, 100 mM dithiothreitol (DTT), or 2%
-mercaptoethanol at 37°C for 30 min. Laccase enzyme was assayed
with epinephrine as previously described (1 U of enzyme was defined as
0.001 A475 of activity in 30 min at 37°C and
was expressed as the mean of three determinations ± the standard
deviation) (37). Carbohydrate was assayed by a
phenol-sulfuric acid method (11) and was expressed as
glucose equivalents. Protein was determined by a Bio-Rad (Hercules,
Calif.) assay. Western blotting was performed using an SDS-10%
polyacrylamide gel electrophoresis (PAGE) gel, anti-laccase MAb
clone G3P4D3 at 2.6 µg/ml, and horseradish peroxide-labeled anti-mouse antibody at a dilution of 1:2,500 (Sigma) and was visualized with Pico luminescent developer (Pierce, Rockford, Ill.). according to
the manufacturer's directions.
 |
RESULTS |
Production of anti-laccase MAbs.
To localize laccase in
C. neoformans cells, we generated MAbs from splenocytes of
mice immunized with recombinant enzyme expressed in P. pastoris. Hybridoma clones were screened by ELISA. Two hybridomas were recovered producing a MAb (IgG1) to laccase, of which one (G3P4D3)
recognized both full-length recombinant P. pastoris-expressed laccase and an E. coli-expressed
196-amino-acid N-terminal fragment. A second clone (G3P2H11) recognized
full-length laccase but not the N-terminal fragment (data not shown).
Western blotting using the G3P4D3 clone showed no bands when laccase
was repressed (Fig. 1, lane 1) and a
single band when laccase was derepressed (Fig. 1, lane 2).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 1.
Western blots of whole-cell suspensions of C. neoformans. Western blot analyses were performed with C. neoformans cells suspensions (20 µg of carbohydrate) from cells
either glucose repressed (lane 1) or derepressed in the absence of
glucose (lane 2) or 100 ng of recombinant laccase (lane 3) and blots
were developed with the G3P4D3 clone MAb.
|
|
Localization of cryptococcal laccase by immunoelectron
microscopy.
A representative serotype A strain of C. neoformans (H99; ATCC 208821) and a serotype D strain (B-3501;
ATCC 34873) were derepressed for laccase production by incubation in
the absence of glucose and processed for immunoelectron microscopy. As
shown in Fig. 2aA, multiple
5-µm-diameter gold particles were observed in the cell walls of
derepressed cells of H99, but not in glucose-repressed H99 cells (Fig.
2aB). Previous reports have shown laccase transcription and enzyme
activity to be completely repressed by glucose (37). Gold
particles were also found to stain cell walls of derepressed cells of
serotype D cells (Fig. 2aC) but not glucose-repressed cells (Fig. 2aD).
As shown in Fig. 2b, sampling seven
random cryptococcal cells from each of the four incubation conditions
showed a predominance of gold particles in the cell walls of
derepressed H99 and B-3501 cells (H99, 173 particles;
B-3501, 189 particles) versus only a few particles in the cytoplasm
(H99, 17; B-3501, 59) and less in other structures such as the nucleus
(H99, 4; B-3501, 3) or mitochondria (H99, 3; B-3501, 17).
Glucose-repressed cells showed only small amounts of binding throughout
the cell with no one organelle predominating. In addition, no gold
particle staining was evident with any of the cell preparations after
incubation with gold-labeled secondary antibody alone (data not
shown). Adjusting particle counts for a cross-sectional area of cell
organelles in each of the four groups of seven cells yielded a mean
particle density of 22.9 ± 7.5 particles/pm2 in the
cell walls of H99 cells and 2.2 ± 1.3 particles/pm2
in the interior of H99, and 17.4 ± 8.8 particles/pm2
in B-3501 cell walls and 1.9 ± 1.3 particles/pm2 in
the interior (P < 0.005 between cell wall and interior
particle densities in each case). These data indicate that laccase is
localized to the cell wall under these growth conditions. In addition,
the fractional distance from the inner edge of the cell wall to the outer edge was measured for each cell wall gold particle from each of
the seven derepressed cells of H99 and B-3501, and a histogram was
constructed using 0.1 fractional intervals. As shown in Fig 2C, laccase
appeared to be predominantly located at the outer cell wall, indicated
by the greater quantities of gold particles in the outer regions. This
outer cell wall distribution of laccase is the first data showing
polarity of the cell wall of C. neoformans.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Immuno electron microscopy of cell walls of C. neoformans. (a) H99 (A and B) or B-3501 (C and D) cells that
expressed laccase (A and C) or were glucose repressed (B and D) were
subjected to immunoelectron microscopy with laccase MAbs. Arrows point
to 5-µm gold particles. (b) Gold particles from seven random cells of
each group were counted and localized to the cell wall (CW), cytoplasm
(Cy), nucleus (Nu), or mitochondria (Mi). The fractional distance from
the inner edge of the cell wall to the outer edge was measured for each
cell wall gold particle from seven cells of H99 and B-3501, and a
histogram was constructed using 0.1 fractional intervals (the inner
wall edge was designated as 0 distance).
|
|

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of GFP-tagged laccase by epifluorescence.
GFP-laccase transformants of H99 (A) and wild-type H99 (B) were
derepressed in the absence of glucose and examined for epifluorescence
of GFP with a Zeiss 510 laser confocal microscope.
|
|
Localization of cryptococcal laccase by epifluorescence of
GFP-tagged laccase.
To demonstrate the localization of laccase in
live cells of C. neoformans, a GFP (32) was
used to tag recombinant laccase expressed in C. neoformans
strain H99. GFP was inserted into the ORF of laccase in the N-terminal
region downstream from the leader sequence cleavage site, such that it
would not interfere with cellular trafficking. Two laccase-GFP
transformants and wild-type H99 colonies were selected, grown on YPD
agar for 2 days, derepressed for laccase activity by a 2-day incubation
on asparagine agar without glucose (pH 7.0) as previously described
(20), and examined for epifluorescence. Microscopy was
performed with a Zeiss 510 laser confocal microscope, and cells
were observed after excitation with 450 to 490 nm of light and with a
520-nm cutoff filter. As shown in Fig. 3A, transformation of H99 with
the laccase-GFP fusion protein yielded a recombinant laccase showing a
strong signal that localized to the cell periphery. In contrast,
untransformed wild-type H99 showed no specific cellular localization
and only weak autofluorescence at these wavelengths that required a
high-gain setting to visualize. In addition, this low-level
autofluorescence was evident at numerous wavelengths such as excitation
at 568 nm and emission 610 nm, whereas the fluorescence shown in Fig. 3A was evident only at specific GFP-related wavelengths. While the
limited resolution of light microscopy does not allow a differentiation between a cell wall and a membrane localization, these data provide independent confirmation of a peripheral localization of laccase of
C. neoformans.
Cellular fractionation and detection of laccase enzyme
activity.
To corroborate the above data indicating a cell wall
location of laccase, cryptococcal cells expressing laccase were
fractured to determine if enzyme activity was localized to the cell
wall fraction. Laccase was derepressed in representative serotype A (H99) and serotype D (B-3501) cells of Cryptococcus by
incubation of freshly grown cells on asparagine agar plates in the
absence of glucose. Whole-cell assays of laccase from washed cells
showed significant levels of enzyme activity (H99, 429 ± 33 U/107 cells; B-3501, 46 ± 4 U/107 cells)
(Fig. 4, lane 1). Digestion of intact
cells with a glucanase preparation from the fungus T. harzianum widely used to digest cryptococcal cell walls
(34) results in the solubilization of significant amounts
of laccase activity (H99, 260 ± 20 U/107 cells;
B-3501, 35 ± 4 U/107 cells) (Fig. 4, lanes 1 and 2).
The glucanase preparation was not found to contain significant laccase
activity at the concentrations used. Trypan blue staining of digested
cells showed <5% uptake by intact cells, suggesting that the enzyme
was removed from the cell wall without disruption of the cell membrane.
Incomplete removal of laccase was most likely due to incomplete
digestion of the cell wall typical of stationary-phase cells, indicated by retained osmotic stability of the cells in 1% SDS (data not shown).
To study the nature of the laccase-cell wall attachment, laccase-expressing cryptococcal cells were fractured with a Braun homogenizer. A degradative carbohydrate assay was used to estimate the
number of disintegrated cells contained in a given preparation by
reference to the carbohydrate content of intact cells counted by
hemocytometer (for H99, 1 µg of carbohydrate = 1.24 × 105 cells; for B-3501, 1 µg of carbohydrate = 1.1 × 105 cells). Disintegration of cryptococcal cells resulted
in a significant loss of laccase activity (H99, 114 ± 6 U/107 cells; B-3501, 19 ± 1 U/107 cells)
versus that in whole cells, presumably due to the vigorous shaking
required to break the stationary-phase cryptococcal cell walls. After
centrifugation, essentially all laccase activity was found in the
pellet (H99, 115 ± 4 U/107 cells; B-3501, 19 ± 1 U/107 cells) (Fig. 4, lane 4), and no enzyme activity
could be detected in the supernatant. After extraction of the
disintegrated cell pellet sequentially with 1 M NaCl, 6 M urea, and 1%
SDS, virtually all of the laccase activity in the disintegrated cells
was found in the cell pellet (H99, 89 ± 4 U/107
cells; B-3501, 17.3 ± 0.6 U/107 cells) (Fig. 4, lane
5), suggesting a very strong association with the carbohydrate cell
wall. Again, digestion of the disrupted cell wall pellet with glucanase
resulted in solubilization of significant amounts of laccase activity
evident in the supernatant after microfugation (H99, 43 ± 1 U/107 cells; B-3501, 7.9 ± 0.2 U/107
cells) (Fig. 4, lane 6) or ultracentrifugation (H99, 23 ± 1 U/107 cells; B-3501, 5.2 ± 0.2 U/107 cells)
(Fig. 4, lane 7), suggesting that the laccase-cell wall attachment is
dependent on intact cell wall carbohydrate.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Enzymatic activity of laccase in C. neoformans. H99 and B-3501 cells were laccase derepressed in the
absence of glucose, and the enzyme activity of the whole cells was
measured before (lane 1) and after (lane 2) digestion with glucanase
(lane 2). After disintegration of cells, total extract was measured for
laccase activity (lane 3) as well as laccase activity in the pellet
after centrifugation (lane 4). Fractured cells were extracted
sequentially with 1 M NaCl, 6 M urea, and 1% SDS, and the enzyme in
the pellet was assayed (lane 5). Fractured cell pellets were then
subjected to digestion by glucanase (lanes 6 and 7) and laccase was
assayed after microfugation (lane 6) and ultracentrifugation (lane
7). Enzyme activity was measured in the pellet ( ) and/or the
supernatant ( ) as indicated.
|
|
Western blots of laccase from cellular fractions of C. neoformans.
To investigate the nature of the laccase-cell
wall association in more detail, Western blot analysis with a MAb to
laccase was performed to assess the location of laccase after exposure of the cell wall to conditions that result in loss of laccase activity.
As shown in Fig. 5, lane 1, boiling of
disintegrated cells in 1% SDS (without reducing agents) resulted in
solubilization of laccase from the cell wall, as evidenced by the
ability of the protein to migrate into the SDS-PAGE gel as a 75-kDa
glycosylated protein similar to that of the purified enzyme
(37). While the supernatants of fractured cells did not
contain laccase activity, small amounts of laccase were detectable in
these fractions by Western blot analysis (Fig. 5, lane 2) and may
represent a cytosolic laccase precursor. Without being boiled, laccase
in the fractured cell pellet that had been washed in buffer (Fig. 5,
lane 3) or from fractured cell pellets extracted with 1 M NaCl, 6 M
urea, and 1% SDS did not migrate into the SDS-PAGE gel after exposure to sample buffer containing 1% SDS (lane 4), similar to experiments described above which showed that enzyme activity was not extractable with these room temperature extraction procedures. However, subjecting the salt-urea-SDS-extracted cell wall preparation to boiling in 1% SDS
before SDS-PAGE solubilized the laccase, suggested an easily hydrolyzable cell wall attachment (Fig. 5, lane 6). Since numerous covalently attached cell wall proteins in yeast are extractable with
sodium hydroxide (22), these conditions were used to test if laccase could be extracted under these conditions. As shown in Fig.
5, lane 7, laccase was solubilized with dilute sodium hydroxide, which
also resulted in limited proteolysis of the protein. Further
investigation of the laccase cell wall attachment in H99 cells that
showed that laccase could also be solubilized with either room
temperature DTT or
-mercaptoethanol (Fig. 5, lanes 7 and 8),
suggesting a role for a disulfide or thioester bond in the laccase-cell
wall anchor.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
SDS-PAGE Western blot of laccase of cellular fractions
of C. neoformans. Laccase-containing cryptococcal cell
suspension from either H99 or B-3501 cells were either boiled in 1%
SDS (lane 1) or centrifuged, and the supernatant (lane 2) and the
pellet (lane 3) were separately subjected to electrophoresis without
boiling. Alternatively, centrifuged fractured cell pellets were
extracted sequentially with 1 M NaCl, 6 M urea, and 1% SDS and either
subjected to electrophoresis without boiling (lane 4) or with boiling
in 1% SDS (lane 5). Salt-urea-SDS-extracted fractured cell pellets
were additionally treated with 30 mM NaOH at 37°C for 30 min (lane 6)
or 100 mM DTT (lane 7) or 2% -mercaptoethanol (lane 8) and then
electrophoresed without boiling. Each lane contained approximately 20 µg of carbohydrate; in addition, lanes 1 and 2 contained 10 µg of
protein.
|
|
 |
DISCUSSION |
In the present study, a MAb to C. neoformans laccase
was prepared and used to localize the enzyme to the cell wall of the yeast in representative serotype A (H99) and D (B-3501) strains by
immunoelectron microscopy. The cell wall is the same location where
melanin has been localized in cells grown in vitro (36). An interesting finding was that laccase also appeared to localize predominately to the outer region of the cell wall, which suggests polarity in the cryptococcal cell wall. Cells grown in glucose did not
show significant immunoreactivity and were used as negative controls,
since laccase is transcriptionally repressed in the presence of glucose
(37). In addition, a GFP-tagged laccase construct was also
found to express fluorescent protein that localized to the periphery in
live cells. In addition, recovery of laccase activity in cell wall
preparations after extraction with 1 M NaCl, 6 M urea, and 1% SDS
suggests that laccase is not predominately a cytosolic or
membrane-bound protein in its mature form. Solubilization of laccase
activity from intact cells with glucanase enzymes and from
SDS-extracted fractured cell pellets further supports a cell wall-associated laccase.
Determining the location of laccase expression is important for
understanding the mechanism by which this enzyme contributes to
virulence. Yeast cell walls typically allow small molecules to diffuse
freely through the lattice of the cell wall (25), and
the C. neoformans capsule appears permeable even to large molecules such as immunoglobulins (17, 30). Thus, a cell
wall localization indicates that laccase is in a position outside the plasma membrane where it can interact more directly with extracellular substances and host immune cell products without the need for ancillary
membrane or cytosolic transporters. For example, oxidation of
catecholamines on the exterior portion of the cell wall lessens the
exposure to oxidized dopamine products, which have been shown to be
potently cytotoxic in other systems (33). An extracellular location also removes the need for dopamine transporters into and out
of the cell. In addition, production of catecholamine oxidation
products in the extracellular space (rather than in a specialized
structure such as a melanosome in mammalian cells) may explain why
formation of cell wall melanin in vitro requires very high
concentrations of dopamine (100 mg/liter; [36, 38]), which may not be optimal in the brain where lower concentrations of
dopamine are found (1 to 7 mg/liter [13]). Indeed, the
chemical identity of the catecholamine oxidation condensation products in vivo has been a matter of great controversy because of their unusual
properties (21, 23, 24). Besides the oxidative effects on
catecholamines, laccase also has been proposed to exert a fungal protective effect from host macrophages by virtue of its newly described iron oxidase activity (20). Reduced
FeII is required by macrophages to produce toxic oxygen
metabolites, and the oxidation of iron by laccase thus competes with
the host cell oxidation machinery. A cell wall laccase thus allows
greater access to transient iron species, thereby maximizing its effect against host effector cells. It is important to note that cells in the
present study were grown at approximately neutral pH (6.5 to 7.0).
Previous reports by laboratories including our own have noted a minor
and variable amount of soluble laccase in addition to an insoluble
component, but these reports used cells derepressed at a very acidic pH
of approximately 4.5 (14, 37). This acidic pH is similar
to that found in the phagolysosome of macrophages after ingestion of
either live or heat-killed C. neoformans (19). Thus, the ability to alter laccase cellular properties by pH effects could be utilized by immunocompetent macrophages to alter
laccase-associated properties which could, in turn, reduce virulence.
A cell wall location for laccase may also facilitate the survival of
the organism in the environment. Recently, C. neoformans var. neoformans has been found to inhabit the hollows of
living trees (18). Laccase is produced by many of the
white-rot basidiomycete fungi such as Coriolus versicolor
that inhabit the same environment and is thought to serve in the
degradation of lignin in wood pulp (15). Since lignin
polymers are large molecules that would have great difficulty
traversing a cell membrane, a peripheral location of laccase may
facilitate degradation of these polymers. Since these molecules can be
quite large, location in the outer portion of the cell wall in C. neoformans may be critical to efficient degradation of these
polymers. An additional benefit to placing laccase in the outer cell
wall may be to lessen possible toxic effects of the iron oxidase
activity of laccase. In yeast, reduced iron is the substrate of the
iron transporter Fet3p, which is provided by an ancillary plasma
membrane iron reductase (1). Indeed, iron reductase
activity has also been demonstrated in C. neoformans
(26). Placing laccase in the outer cell wall rather than
in the plasma membrane may lessen competition of laccase with the
plasma membrane iron reductase and therefore interfere less with iron
uptake in the yeast.
The yeast cell wall is a highly complex structure whose major
components are
-1,3-and
-1,6-glucans with a number of
mannoproteins attached to the glucan network (for a review, see
reference 12). Cell wall proteins may be loosely
associated, such as the WI-1 protein of Blastomyces
dermatitidis, which is extracted by washing with distilled
H2O (3). A second group of cell wall proteins are resistant to extraction with boiling SDS and can be extracted only
with glucanase preparations. All proteins described thus far of the
second group contain glycosylphosphatidylinositol
(GPI)-anchoring signals at their C termini and are covalently
linked to the glucan wall through a remnant of a GPI anchor containing
five
-linked mannosyl residues (16). A third group of
proteins appears more heterogeneous; they can be released from the cell
wall by hot SDS,
-mercaptoethanol, or by dilute sodium hydroxide and
are exemplified by the Pir proteins of Saccharomyces, but
the structure of attachment has not been described (22).
The laccase of C. neoformans appears to fall into the third
category of cell wall proteins. This enzyme was resistant to
solubilization by 1 M NaCl, 6 M urea, or 1% SDS at room temperature,
which disrupts ionic, hydrophobic, and membrane-associated
interactions. It is doubtful the laccase-cell wall linkage is dependent
on a GPI anchor, since there are no hydrophobic regions within the C
terminus of the laccase ORF to which a GPI anchor would be attached
(37). However, boiling cells in SDS results in the removal
of enzyme and suggests the involvement of an easily hydrolyzable
covalent bond. The size of the SDS-solubilized enzyme (75 kDa)
corresponds to that of a highly glycosylated soluble form of the
purified enzyme isolated as a minor fraction from cells grown at low pH
and suggests that the cell wall-bound enzyme is similarly glycosylated.
A role for a disulfide or perhaps a thioester linkage is also suggested
by the ability of room temperature DTT or
-mercaptoethanol to
solubilize cell wall-associated laccase. Further studies are currently
underway to chemically characterize the laccase-cell wall anchor.
 |
ACKNOWLEDGMENTS |
J.G.-R. is supported by NIH award T32-AI07501. A.C. is supported
by NIH awards AI33774, AI3342, and HL-59842. P.R.W. is supported by NIH
grants AI45995 and AI38258 and a grant from the American Lung Association.
We are grateful to M. L. Chen, who performed the confocal
microscopy examinations, and Matthew Scharff and Susan Bulh, for their
technical support in the generation of the hybridomas. We are also
grateful to E. Cabib, W. Walden, and J. Kaplan for helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Rm. 888, m/c
735, 808 S. Wood St., Chicago, IL 60612. Phone: (312) 996-6070. Fax:
(312) 996-5704. E-mail: prw{at}uic.edu.
Editor:
T. R. Kozel
 |
REFERENCES |
| 1.
|
Askwith, C. C.,
D. deSilva, and J. Kaplan.
1996.
Molecular biology of iron acquisition in Saccharomyces cerevisiae.
Mol. Microbiol.
20:27-34[CrossRef][Medline].
|
| 2.
|
Banta, L. M.,
J. S. Robinson,
D. J. Klionsky, and S. D. Emr.
1988.
Organelle assembly in yeast: characterization of yeast mutants defective in vacuolar biogenesis and protein sorting.
J. Cell Biol.
107:1369-1383[Abstract/Free Full Text].
|
| 3.
|
Brandhorst, T., and B. Klein.
2000.
Cell wall biogenesis of Blastomyces dermatitilidis: evidence for a novel mechanism of cell surface localization of a virulence-associated adhesin via extracellular release and reassociation with cell wall chitin.
J. Biol. Chem.
275:7925-7934[Abstract/Free Full Text].
|
| 4.
|
Chang, Y. C., and K. J. Kwon-Chung.
1994.
Complementation of a capsule-deficient mutation of Cryptococcus neoformans restores its virulence.
Mol. Cell. Biol.
14:4912-4919[Abstract/Free Full Text].
|
| 5.
|
Chasakes, S., and R. L. Tyndall.
1975.
Pigment production by Cryptococcus neoformans from para- and ortho-di-phenols: effect of the nitrogen source.
J. Clin. Microbiol.
1:509-514[Abstract/Free Full Text].
|
| 6.
|
Chaturvedi, V.,
T. Flynn,
W. G. Niehaus, and B. Wong.
1996.
Stress tolerance and pathogenic potential of a mannitol mutant of Cryptococcus neoformans.
Microbiology
142:937-943[Abstract].
|
| 7.
|
Chen, S. C.,
M. Muller,
J. Z. Zhou,
L. C. Wright, and T. C. Sorrell.
1997.
Phospholipase activity in Cryptococcus neoformans: a new virulence factor?
J. Infect. Dis.
175:414-420[Medline].
|
| 8.
|
Cox, G. M.,
J. Mukherjee,
G. T. Cole,
A. Casadevall, and J. R. Perfect.
2000.
Urease as a virulence factor in experimental cryptococcosis.
Infect. Immun.
68:443-448[Abstract/Free Full Text].
|
| 9.
|
Cox, G. M.,
D. L. Toffaletti, and J. R. Perfect.
1996.
Dominant selection system for use in Cryptococcus neoformans.
J. Med. Vet. Mycol.
34:385-391[Medline].
|
| 10.
|
de StGroth, S. F., and D. Scheidegger.
1980.
Production of monoclonal antibodies: strategy and tactics.
J. Immunol. Methods
35:1-21[CrossRef][Medline].
|
| 11.
|
Dubois, M.,
K. A. Giles,
J. K. Hamilton,
P. A. Rebers, and F. Smith.
1956.
Colorimetric method for determination of sugars and related substances.
Anal. Chem.
28:350-358[CrossRef].
|
| 12.
|
Fleet, G. H.
1985.
Composition and structure of yeast cell walls.
Curr. Top. Med. Mycol.
1:24-56[Medline].
|
| 13.
|
Hadesman, R.,
R. H. Wiesner,
V. L. W. Go, and G. M. Tyce.
1995.
Concentrations of 3,4-dihydroxyphenylalanine and catecholamines and metabolites in brain in an anhepatic model of hepatic encephalopathy.
J. Neurochem.
65:1166-1175[Medline].
|
| 14.
|
Ikeda, R.,
T. Shinoda,
T. Morita, and E. S. Jacobson.
1993.
Characterization of a phenol oxidase from Cryptococcus neoformans var. neoformans.
Microbiol. Immunol.
37:759-764[Medline].
|
| 15.
|
Kawai, S.,
T. Umezawa, and T. Higuchi.
1988.
Degradation mechanisms of phenolic beta-1 lignin substructure model compounds by laccase of Coriolus versicolor.
Arch. Biochem. Biophys.
262:99-110[CrossRef][Medline].
|
| 16.
|
Kollar, R.,
B. B. Reinhold,
E. Petrakova,
H. J. C. Yeh,
G. Ashwell,
J. Drgonova,
J. C. Kapteyn,
F. M. Klis, and E. Cabib.
1997.
Architecture of the yeast cell wall.
J. Biol. Chem.
272:17762-17775[Abstract/Free Full Text].
|
| 17.
|
Kozel, T. R.,
G. S. Pfrommer,
A. S. Guerlain,
B. A. Highison, and G. J. Highison.
1988.
Role of the capsule in phagocytosis of Cryptococcus neoformans.
Rev. Infect. Dis.
10(Suppl. 2):S436-S439.
|
| 18.
|
Lazera, M. S.,
M. A. Salmito Cavalcanti,
A. T. Londero,
L. Trilles,
M. M. Nishikawa, and B. Wanke.
2000.
Possible primary ecological niche of Cryptococcus neoformans.
Med. Mycol.
38:379-383[Medline].
|
| 19.
|
Levitz, S. M.,
S. H. Nong,
K. F. Seetoo,
T. S. Harrison,
R. A. Speizer, and E. R. Simons.
1999.
Cryptococcus neoformans resides in an acidic phagolysosome of human macrophages.
Infect. Immun.
67:885-890[Abstract/Free Full Text].
|
| 20.
|
Liu, L.,
R. P. Tewari, and P. R. Williamson.
1999.
Laccase protects Cryptococcus neoformans from antifungal activity of alveolar macrophages.
Infect. Immun.
67:6034-6039[Abstract/Free Full Text].
|
| 21.
|
Liu, L.,
K. Wakamatsu,
S. Ito, and P. R. Williamson.
1999.
Catecholamine oxidative products, but not melanin, are produced by Cryptococcus neoformans during neuropathogenesis in mice.
Infect. Immun.
67:108-112[Abstract/Free Full Text].
|
| 22.
|
Mrsa, V., and W. Tanner.
1999.
Role of NaOH-extractable cell wall proteins Ccw5p, Ccw6p, Ccw7p and Ccw8p (members of the Pir protein family) in stability of the Saccharomyces cerevisiae cell wall.
Yeast
15:813-820[CrossRef][Medline].
|
| 23.
|
Nosanchuk, J. D.,
A. L. Rosas,
S. C. Lee, and A. Casadevall.
2000.
Melanisation of Cryptococcus neoformans in human brain tissue.
Lancet
355:2049-2050[CrossRef][Medline].
|
| 24.
|
Nosanchuk, J. D.,
P. Valadon,
M. Feldmesser, and A. Casadevall.
1999.
Melanization of Cryptococcus neoformans in murine infection.
Mol. Cell. Biol.
19:745-750[Abstract/Free Full Text].
|
| 25.
|
Novick, P.,
B. C. Osmond, and D. Botstein.
1989.
Suppressors of yeast actin mutations.
Genetics
121:659-674[Abstract/Free Full Text].
|
| 26.
|
Nyhus, K. J.,
A. T. Wilborn, and E. S. Jacobson.
1997.
Ferric iron reduction by Cryptococcus neoformans.
Infect. Immun.
65:434-438[Abstract].
|
| 27.
|
Odom, A.,
S. Muir,
E. Lim,
D. L. Toffaletti,
J. Perfect, and J. Heitman.
1997.
Calcineurin is required for virulence of Cryptococcus neoformans.
EMBO J.
16:2576-2589[CrossRef][Medline].
|
| 28.
|
Pinner, R. W.,
R. A. Hajjeh, and W. G. Powderly.
1995.
Prospects for preventing cryptococcosis in persons infected with human immunodeficiency virus.
Clin. Infect. Dis.
21(Suppl. 1):S103-S107.
|
| 29.
|
Polacheck, I.,
V. J. Hearing, and K. J. Kwon-Chung.
1982.
Biochemical studies of phenoloxidase and utilization of catecholamines in Cryptococcus neoformans.
J. Bacteriol.
150:1212-1220[Abstract/Free Full Text].
|
| 30.
|
Rosas, A. L.,
J. D. Nosanchuk,
M. Feldmesser,
G. M. Cox,
H. C. McDade, and A. Casadevall.
2000.
Synthesis of polymerized melanin by Cryptococcus neoformans in infected rodents.
Infect. Immun.
68:2845-2853[Abstract/Free Full Text].
|
| 31.
|
Staib, F.
1962.
Cryptococcus neoformans and Guizotia abyssinica (syn. G. oleifera D.C.) (farbreadktion für C. neoformans).
Z. Hyg.
148:466-475[CrossRef].
|
| 32.
|
Stauber, R. H.,
K. Horie,
P. Carney,
E. A. Hudson,
N. I. Tarasova,
G. A. Gaitanaris, and G. N. Pavlakis.
1998.
Development and applications of enhanced green fluorescent protein mutants.
BioTechniques
24:462-471[Medline].
|
| 33.
|
Tse, D. C. S.,
L. R. McCreery, and R. N. Adams.
1976.
Potential oxidative pathways of brain catecholamines.
J. Med. Chem.
19:37-41[CrossRef][Medline].
|
| 34.
|
Varma, A., and K. J. Kwon-Chung.
1991.
Rapid method to extract DNA from Cryptococcus neoformans.
J. Clin. Microbiol.
29:810-812[Abstract/Free Full Text].
|
| 35.
|
Wang, Y.,
P. Aisen, and A. Casadevall.
1995.
Cryptococcus neoformans melanin and virulence: mechanism of action.
Infect. Immun.
63:3131-3136[Abstract].
|
| 36.
|
Wang, Y.,
P. Aisen, and A. Casadevall.
1996.
Melanin, melanin "ghosts," and melanin composition in Cryptococcus neoformans.
Infect Immun.
64:2420-2424[Abstract].
|
| 37.
|
Williamson, P. R.
1994.
Biochemical and molecular characterization of the diphenol oxidase of Cryptococcus neoformans: identification as a laccase.
J. Bacteriol.
176:656-664[Abstract/Free Full Text].
|
| 38.
|
Williamson, P. R.,
K. Wakamatsu, and S. Ito.
1998.
Melanin biosynthesis in Cryptococcus neoformans.
J. Bacteriol.
180:1570-1572[Abstract/Free Full Text].
|
Infection and Immunity, September 2001, p. 5589-5596, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5589-5596.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Canero, D. C., Roncero, M. I. G.
(2008). Influence of the chloride channel of Fusarium oxysporum on extracellular laccase activity and virulence on tomato plants. Microbiology
154: 1474-1481
[Abstract]
[Full Text]
-
Siafakas, A. R., Sorrell, T. C., Wright, L. C., Wilson, C., Larsen, M., Boadle, R., Williamson, P. R., Djordjevic, J. T.
(2007). Cell Wall-linked Cryptococcal Phospholipase B1 Is a Source of Secreted Enzyme and a Determinant of Cell Wall Integrity. J. Biol. Chem.
282: 37508-37514
[Abstract]
[Full Text]
-
Eisenman, H. C., Mues, M., Weber, S. E., Frases, S., Chaskes, S., Gerfen, G., Casadevall, A.
(2007). Cryptococcus neoformans laccase catalyses melanin synthesis from both D- and L-DOPA. Microbiology
153: 3954-3962
[Abstract]
[Full Text]
-
Martinez, L. R., Ntiamoah, P., Gacser, A., Casadevall, A., Nosanchuk, J. D.
(2007). Voriconazole Inhibits Melanization in Cryptococcus neoformans. Antimicrob. Agents Chemother.
51: 4396-4400
[Abstract]
[Full Text]
-
Baker, L. G., Specht, C. A., Donlin, M. J., Lodge, J. K.
(2007). Chitosan, the Deacetylated Form of Chitin, Is Necessary for Cell Wall Integrity in Cryptococcus neoformans. Eukaryot Cell
6: 855-867
[Abstract]
[Full Text]
-
Waterman, S. R., Hacham, M., Panepinto, J., Hu, G., Shin, S., Williamson, P. R.
(2007). Cell Wall Targeting of Laccase of Cryptococcus neoformans during Infection of Mice. Infect. Immun.
75: 714-722
[Abstract]
[Full Text]
-
Tangen, K. L., Jung, W. H., Sham, A. P., Lian, T., Kronstad, J. W.
(2007). The iron- and cAMP-regulated gene SIT1 influences ferrioxamine B utilization, melanization and cell wall structure in Cryptococcus neoformans. Microbiology
153: 29-41
[Abstract]
[Full Text]
-
Ren, P., Springer, D. J., Behr, M. J., Samsonoff, W. A., Chaturvedi, S., Chaturvedi, V.
(2006). Transcription Factor STE12{alpha} Has Distinct Roles in Morphogenesis, Virulence, and Ecological Fitness of the Primary Pathogenic Yeast Cryptococcus gattii.. Eukaryot Cell
5: 1065-1080
[Abstract]
[Full Text]
-
Siafakas, A. R., Wright, L. C., Sorrell, T. C., Djordjevic, J. T.
(2006). Lipid Rafts in Cryptococcus neoformans Concentrate the Virulence Determinants Phospholipase B1 and Cu/Zn Superoxide Dismutase. Eukaryot Cell
5: 488-498
[Abstract]
[Full Text]
-
da Silva, E. G., Baroni, F. d. A., Viani, F. C., Ruiz, L. d. S., Gandra, R. F., Auler, M. E., Dias, A. L. T., Gambale, W., Paula, C. R.
(2006). Virulence profile of strains of Cryptococcus neoformans var. grubii evaluated by experimental infection in BALB/c mice and correlation with exoenzyme activity. J Med Microbiol
55: 139-142
[Abstract]
[Full Text]
-
Hicks, J. K., Bahn, Y.-S., Heitman, J.
(2005). Pde1 Phosphodiesterase Modulates Cyclic AMP Levels through a Protein Kinase A-Mediated Negative Feedback Loop in Cryptococcus neoformans. Eukaryot Cell
4: 1971-1981
[Abstract]
[Full Text]
-
Mandal, P., Banerjee, U., Casadevall, A., Nosanchuk, J. D.
(2005). Dual Infections with Pigmented and Albino Strains of Cryptococcus neoformans in Patients with or without Human Immunodeficiency Virus Infection in India. J. Clin. Microbiol.
43: 4766-4772
[Abstract]
[Full Text]
-
Heung, L. J., Kaiser, A. E., Luberto, C., Del Poeta, M.
(2005). The Role and Mechanism of Diacylglycerol-Protein Kinase C1 Signaling in Melanogenesis by Cryptococcus neoformans. J. Biol. Chem.
280: 28547-28555
[Abstract]
[Full Text]
-
Garcia-Rivera, J., Tucker, S. C., Feldmesser, M., Williamson, P. R., Casadevall, A.
(2005). Laccase Expression in Murine Pulmonary Cryptococcus neoformans Infection. Infect. Immun.
73: 3124-3127
[Abstract]
[Full Text]
-
Mednick, A. J., Nosanchuk, J. D., Casadevall, A.
(2005). Melanization of Cryptococcus neoformans Affects Lung Inflammatory Responses during Cryptococcal Infection. Infect. Immun.
73: 2012-2019
[Abstract]
[Full Text]
-
Missall, T. A., Moran, J. M., Corbett, J. A., Lodge, J. K.
(2005). Distinct Stress Responses of Two Functional Laccases in Cryptococcus neoformans Are Revealed in the Absence of the Thiol-Specific Antioxidant Tsa1. Eukaryot Cell
4: 202-208
[Abstract]
[Full Text]
-
Olszewski, M. A., Noverr, M. C., Chen, G.-H., Toews, G. B., Cox, G. M., Perfect, J. R., Huffnagle, G. B.
(2004). Urease Expression by Cryptococcus neoformans Promotes Microvascular Sequestration, Thereby Enhancing Central Nervous System Invasion. Am. J. Pathol.
164: 1761-1771
[Abstract]
[Full Text]
-
Noverr, M. C., Williamson, P. R., Fajardo, R. S., Huffnagle, G. B.
(2004). CNLAC1 Is Required for Extrapulmonary Dissemination of Cryptococcus neoformans but Not Pulmonary Persistence. Infect. Immun.
72: 1693-1699
[Abstract]
[Full Text]
-
Hicks, J. K., D'Souza, C. A., Cox, G. M., Heitman, J.
(2004). Cyclic AMP-Dependent Protein Kinase Catalytic Subunits Have Divergent Roles in Virulence Factor Production in Two Varieties of the Fungal Pathogen Cryptococcus neoformans. Eukaryot Cell
3: 14-26
[Abstract]
[Full Text]
-
Nosanchuk, J. D., Casadevall, A.
(2003). Budding of melanized Cryptococcus neoformans in the presence or absence of L-dopa. Microbiology
149: 1945-1951
[Abstract]
[Full Text]
-
Endo, K., Hosono, K., Beppu, T., Ueda, K.
(2002). A novel extracytoplasmic phenol oxidase of Streptomyces: its possible involvement in the onset of morphogenesis. Microbiology
148: 1767-1776
[Abstract]
[Full Text]