Previous Article | Next Article 
Infection and Immunity, September 2001, p. 5612-5618, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5612-5618.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Mycoplasma pneumoniae P1 Type 1- and Type
2-Specific Sequences within the P1 Cytadhesin Gene of Individual
Strains
J. Wendelien
Dorigo-Zetsma,1,2
Berry
Wilbrink,2
Jacob
Dankert,1 and
Sebastian
A. J.
Zaat1,*
Department of Medical Microbiology, Academic Medical
Center, Amsterdam,1 and Diagnostic
Laboratory for Infectious Diseases and Perinatal Screening, National
Institute of Public Health and the Environment,
Bilthoven,2 The Netherlands
Received 24 January 2001/Returned for modification 16 March
2001/Accepted 16 May 2001
 |
ABSTRACT |
Mycoplasma pneumoniae strains traditionally are
divided into two types, based on sequence variation in the P1 gene.
Recently, however, we have identified 8 P1 subtypes by restriction
fragment length polymorphism analysis. In the present study the P1 gene sequences of three P1 type 1 and two P1 type 2 M.
pneumoniae strains were analyzed. A new P1 gene sequence in a
type 1 strain with partial similarity to a recently reported variable
region in the P1 gene of an M. pneumoniae type 2 strain
(T. Kenri, R. Taniguchi, Y. Sasaki, N. Okazaki, M. Narita, K. Izumikawa, M. Umetsu, and T.Sasaki, Infect. Immun. 67:4557-4562, 1999)
was identified. In addition, the P1 gene of the type 1 strain contained
another region with nucleotide polymorphisms identical to a stretch in
the P1 gene of one of our type 2 strains. These findings indicate that recombination between sequences specific for P1 type 1 and type 2 had
occurred and that P1 type 1 and type 2 hybrid sequences can be present
within the P1 gene of an individual strain. Identical or nearly
identical variable P1 gene sequences were present in several repetitive
regions outside the P1 gene locus in the genome of M.
pneumoniae strain M129, implying recombination as a mechanism for generation of the P1 gene variation. Additionally, in the P1 gene
sequences of four of the five strains studied, single-nucleotide polymorphisms different from the previously reported P1 type 1 and 2 characteristic sequences were identified. The polymorphic sites are
candidate targets for genotyping of M. pneumoniae by direct sequencing of amplicons from clinical specimens.
 |
INTRODUCTION |
Mycoplasma pneumoniae is
a common cause of respiratory infections in humans. Colonization of the
respiratory epithelium by M. pneumoniae is mediated by the
attachment organelle, a terminal tip structure of M. pneumoniae cells (17). Several bacterial surface
proteins, including a 170-kDa protein, P1, are involved in the
formation of the attachment organelle and cytadherence of M. pneumoniae to the respiratory epithelium. The 170-kDa protein P1
is a major adhesin protein which is densely clustered at the site of
the attachment organelle (1). Protein P1 is encoded by a
gene of nearly 5,000 bp, comprising copies of repetitive regions
RepMP2/3 and RepMP4, which are present in the M. pneumoniae genome in 10 and 8 copies, respectively (8). Since humans
mount a strong immune response to the P1 protein during infection
(21; M. Pedersen, S. Birkelund, and G. Christiansen, Abstr. 13th
Int. Congr. Int. Org. Mycoplasmol. 2000, p. 241), the P1 gene is
likely to display antigenic variation (1).
Early studies showed the existence of only two P1 gene types among
M. pneumoniae clinical isolates (22, 27). In
those studies Southern blotting and PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of P1 gene amplicons using one restriction enzyme were applied. Other approaches for genotyping of
M. pneumoniae identified two genomic groups among M. pneumoniae clinical isolates, which corresponded to their P1 gene
types (3, 6, 16, 30).
Among a collection of 218 M. pneumoniae clinical isolates in
Japan, a new variable sequence in the P1 gene was identified in four P1
type 2 strains (15). We used an extended panel of restriction enzymes in PCR-RFLP analysis, and we recently reported that
five subtypes could be discriminated among 13 P1 type 1 strains and
that three subtypes could be discriminated among 8 P1 type 2 strains
(6). These findings indicate that more variation in the P1
gene sequence exists than previously anticipated.
Until now, the complete sequences of the P1 genes of the P1 type 1 reference strain M129 (ATCC 29342), the P1 type 2 reference strain FH
(ATCC 15531), and three clinical isolates (one P1 type 1 isolate and
two P1 type 2 isolates) (26) have been reported. The P1
gene sequences of the clinical P1 type 1 isolate and of the two P1 type
2 isolates were identical to those of the respective reference strains
M129 and FH (26). In order to analyze P1 gene sequence
variability, we performed sequence analysis of the P1 genes of two
M. pneumoniae reference strains and three M. pneumoniae clinical isolates with variable P1 genes as detected by
our PCR-RFLP (6).
 |
MATERIALS AND METHODS |
M. pneumoniae strains and DNA isolation.
Two
M. pneumoniae reference strains and three strains from a
collection of 23 M. pneumoniae patient isolates used in P1
PCR-RFLP typing experiments as described before (6) were
selected. Reference strains were PI 1428 (ATCC 29085), a P1 type 1 strain (6), and MAC (ATCC 15492), a P1 type 2 strain
(27). Patient strains were two P1 type 1 strains, Mp22 and
Mp4817, isolated in Denmark in 1963 and 1993, respectively, and one P1
type 2 strain, Mp1842, isolated in Denmark in 1987. Selection of these
strains for P1 gene sequence analysis was based on their unique P1
PCR-RFLP pattern. M. pneumoniae strains were cultured in
plastic flasks (Nunc, Roskilde, Denmark) containing 60 ml of SP4 medium
at 37°C. Cells were harvested upon color change of the medium, after
1 to 5 weeks, by centrifugation at 8,000 × g for 45 min. The supernatant was discarded, and DNA was extracted from the
pelleted bacteria with a QIAmp Tissue Kit (Qiagen GmbH, Hilden, Germany).
DNA sequencing.
Fragments of approximately 2,280 and 2,580 bp, together comprising almost the entire P1 gene, were amplified with
primer pairs ADH1-ADH2 and ADH3-ADH4, respectively, using AmpliTaq DNA
polymerase (Roche Molecular Systems, Inc., Branchburg, N.J.)
(22). ADH1-ADH2 and ADH3-ADH4 amplicons were purified from
agarose gel with QiaEx (Qiagen) and used for sequencing by applying a
primer-walking strategy using a BigDye terminator cycle sequencing kit
and a 307 DNA sequencer (Perkin-Elmer Applied Biosystems, Foster City, Calif.).
Primer pairs P1up (GCTTTAAAGTATGGTGGCGGGGG) and ADH1BR
(AAGTCATACCGGCGTAACGC), ADH2BF
(GTAGTAGTAGTAGTCACAACG) and ADH3BR
(TGTCCACTTGAAGCCTTATC), and ADH4AF
(CCGCACAGGTATCAGTCAAG) and P1down
(GGTGAGGGTGTTGTGGTCTTGG) were used to generate amplicons
comprising the sequences upstream of the ADH1-ADH2 fragment, between
the ADH1-ADH2 and ADH3-ADH4 fragments, and downstream of the ADH3-ADH4
fragment, respectively. Sequencing of these amplicons allowed
completion of the P1 gene sequences.
Sequence analysis and nucleotide sequence accession numbers.
Sequence analysis was performed with the ClustalW multiple-alignment
tool (http://pbil.ibcp.fr/cgi-bin/alignclustalw.pl). P1 gene
nucleotide sequences from M. pneumoniae strain M129 (GenBank accession no. M18639), strain 309 (GenBank accession no. AB024618), and
strain TW 7-5 (26) were used for alignments. Protein
translation was performed with "The Protein Machine," using the
Mycoplasma codon table (http://www2.ebi.ac.uk/translate/).
Unless stated otherwise, nucleotide positions in this paper are
designated according to the numbering in the P1 gene sequence
of
M. pneumoniae strain M129 (
29), accession
number
M18639.
The nucleotide sequence data reported in this paper are listed in the
GenBank nucleotide sequence database under accession
numbers
AF286371
(strain PI 1428),
AF289999 (strain Mp22),
AF290000 (strain Mp4817),
AF290001 (strain MAC), and
AF290002 (strain
Mp1842).
 |
RESULTS |
Comparison of P1 gene sequences.
The complete P1 gene
nucleotide sequences of two M. pneumoniae reference strains,
PI 1428 and MAC, and of strains Mp22, Mp4817, and Mp1842 were
determined. The promoter and terminator regions of the P1 gene
sequences of all five strains were identical to the corresponding
regions in the P1 gene sequence of strain M129, the strain used to
sequence the entire M. pneumoniae genome (29). The deduced translation products were full-length P1 proteins. The
sequences of the P1 type 1 strains PI 1428, Mp22, and Mp4817 showed the
highest similarity with the P1 gene sequence of the P1 type 1 M129
strain, while the sequences of the two P1 type 2 strains MAC and Mp1842
had the highest similarity with the P1 gene sequence of the P1 type 2 TW 7-5 strain. The P1 gene sequences of all five strains contained the
previously reported specific sequences characteristic for their
respective P1 types (26).
The P1 gene nucleotide sequence of P1 type 1 reference strain PI 1428 was completely identical to the P1 gene sequence of
strain M129
(
29). In strain Mp22 two synonymous point mutations
were
identified relative to the M129 P1 sequence: at nucleotide
position
(nt) 3451 (C

T) and at nt 3927 (G

A).
The P1 gene nucleotide sequences of P1 type 2 strain Mp1842 and of
strain TW 7-5 were almost identical. In strain Mp1842 one
nonsynonymous
mutation was identified at nt 3904 (G

A), resulting
in an amino acid
change at position 1302 from V to
I.
Novel sequence variation in the P1 gene of strain Mp4817.
In
the P1 gene of P1 type 1 strain Mp4817, six nonsynonymous nucleotide
substitutions were present. Relative to the M129 sequence, the changed
nucleotides were located at nt 688 and 689 (AC
CA), 748 (A
G), 3368 and 3369 (CG
GC), and 3370 (G
T). These changes resulted in amino
acid changes at positions 230 (T
H), 250 (L
G), and 1123 and
1124 (TV
SL). At nt 1957 an insertion of three AGT triplets resulted
in three additional serines, bordering a stretch of seven serines.
In addition, the P1 gene of strain Mp4817 contained a novel variable
region of 586 bp between nt 3402 and 3991 (region A in
Fig.
1). This new sequence was aligned with
the P1 sequences of
P1 type 1 strain M129 (
29) and P1 type
2 strains TW 7-5 (
26)
and 309 (
15) (Fig.
2). A 55-bp stretch within region A of
strain
Mp4817 and within the new sequence of the P1 gene of P1 type 2
strain 309 (
15) was identical (region B in Fig.
1 and
2)
and
differed from the corresponding sequences of strains M129 (P1
type
1) and TW 7-5 (P1 type 2) at 22 positions (40%).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of sequence divergence of
ADH3-ADH4 amplicons (nt 2268 to 4768 relative to the start codon AUG of
the P1 gene of strain M129 [29]) of the P1 genes of
three P1 type 1 and three P1 type 2 M. pneumoniae
strains. Sequence data for strain 309 are derived from reference
15. The figure is not drawn to scale.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Partial P1 nucleotide sequences of strains M129 (P1 type
1) and TW 7-5 (P1 type 2) and of the variable regions in strains Mp4817
(present study) and 309 (15), corresponding to region A in
Fig 1. Nucleotide positions are indicated relative to the start codon
AUG of the P1 genes of strain M129 (29) and strain
TW 7-5 (26). Identical nucleotides are indicated by dots,
and gaps are indicated by dashes. Differing nucleotides are shown.
Nucleotide differences between reference P1 type 1 and 2 strains are
marked with asterisks. The variable stretch which is identical in
strains Mp4817 and 309 (region B in Fig. 1) is underlined.
|
|
The major part of the novel variable region A in strain Mp4817 was
localized within the RepMP2/3 repeat region of the P1 gene.
Since
recombination with other RepMP2/3 regions outside the P1
gene may have
occurred, the entire genome of M129 (GenBank accession
no.
U00089) was
searched. This revealed an identical sequence
(100% identity) in the
M129 genome from nt 13953 to 14539. Sequences
homologous to region B,
the 55-bp stretch of the novel sequence
of strains Mp4817 and 309, were
found at three locations in the
M129 genome, at nt 76930 to 76985 (100% identity), nt 579414 to
579469 (one nucleotide mismatch), and nt
414624 to 414679 (one
nucleotide
mismatch).
P1 type 1 and 2 hybrid sequences in P1 type 1 strain Mp4817 and P1
type 2 strain MAC.
In the P1 gene nucleotide sequences of the P1
type 1 strain Mp4817 and of the P1 type 2 strain MAC, an identical
stretch of 261 bp (nt 2764 to 3025; region C in Fig. 1) was detected,
by which Mp4817 differed from the prototype P1 type 1 strain M129 and
strain MAC differed from the prototype P1 type 2 strain TW 7-5 (Fig. 1
and Table 1). At seven positions the P1
type 2 strain MAC had nucleotides characteristic for P1 type 1 strains
(open boxes in Table 1). Conversely, the P1 type 1 strain Mp4817 had nucleotides characteristic for the P1 type 2 strains at six positions (gray boxes in Table 1). One of these nucleotides was localized at nt
2823 within region C, the 261-bp stretch identical in strains Mp4817
and MAC. The other five P1 type 2-specific nucleotides were localized
in the sequence bordering region C, between nt 3093 and 3382 (Table 1).
In addition, strains MAC and MP4817 had four identical nucleotide
polymorphisms within region C, differing from both P1 type 1- and type
2-characteristic sequences (Fig. 1; boldface nucleotides in Table 1).
Searching the M129 genome for sequences homologous to region C revealed
one location (259 bp), from nt 14916 to 15175 (U00089), with two
mismatches at positions other than the polymorphisms in MAC and Mp4817
and one location (237 bp), from nt 77698 to 77935 (U00089), with four mismatches. Two of these mismatches were at nucleotide positions characteristic for type 1 or 2.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Polymorphisms in the P1 gene sequences of strains Mp4817
(P1 type 1) and MAC (P1 type 2) compared to the P1 gene sequences of
strains M129 (P1 type 1) and TW 7-5 (P1 type
2)a
|
|
Amino acid translation of the variable sequences and relation to
antigenic domains.
The deduced amino acid sequences of region A
(Fig. 1) of strains Mp4817 and 309 were compared to those of M129 (P1
type 1) and TW 7-5 (P1 type 2) (Fig. 3).
Differences between the Mp4817 and M129 sequences were found from
position 1140 through 1330. The amino acid sequences of Mp4817 and 309 were identical from position 1243 through 1257. Differences between the
translated amino acid sequences of region C, the 261-bp region of
identity of strains Mp4817 and MAC, and the corresponding predicted
amino acids for strains M129 and TW 7-5 are indicated in Table 1.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Deduced partial amino acid sequences of P1 proteins of
strains M129, TW 7-5, Mp4817, and 309. The regions shown correspond to
the nucleotide sequences from nt 3571 onwards in Fig 2. Amino acid
differences between reference P1 type 1 and 2 strains are marked with
asterisks. The variable stretch which is identical in Mp4817 and 309 (corresponding to region B in Fig. 1) is underlined. Amino acid
positions of the P1 proteins of M129 (29) and TW 7-5 (26) are indicated according to the published sequences.
|
|
The sites of variation resulting in a divergent amino acid translation
were compared to antigenic and cytadherence-mediating
epitopes
(
5,
7,
13,
14) in order to assess whether nonsynonymous
polymorphisms in the strains sequenced might affect these epitopes.
According to the P1 membrane topology model proposed by Jacobs
et al.
(
11), divergent amino acids at position 1302 in strain
Mp1842 and at positions 1112 and 1113 in strain Mp4817 are localized
within predicted membrane-spanning domains. In strain Mp4817 the
divergent amino acids at positions 230 and 250, the three additional
serines inserted adjacent to a stretch of seven serines at position
646 to 652, and the large new stretch of 190 amino acids (positions
1140 to
1330) at the C-terminal domain of the P1 protein are all
predicted to
be part of surface-exposed domains. They do not,
however, localize
within antigenic or adherence-mediating epitopes
identified until now
(
5,
7,
13,
14). The divergent amino
acids resulting from
nonsynonymous polymorphisms in the identical
stretch of strains Mp4817
and MAC encoded by region C (Table
1,
boldface) are localized in
predicted surface-exposed domains of
the P1 protein. The divergent
amino acid at position 1128 in strain
Mp4817 is localized within a
recognized antigenic epitope (
14).
 |
DISCUSSION |
Only two types of M. pneumoniae P1 genes were assumed
to exist, based on Southern blotting and the standard PCR-RFLP analysis of the P1 gene (2, 22, 27). However, recently a novel
variable region in P1 type 2 strains was reported (15).
Moreover, we have identified eight P1 subtypes among 23 M. pneumoniae isolates by applying an extended panel of restriction
enzymes in the P1 PCR-RFLP (6). We now report the
full-length sequence of the P1 cytadhesin genes of three P1 type 1 strains and two P1 type 2 strains. A novel sequence within the P1
cytadhesin gene was identified in P1 type 1 strain Mp4817. This
sequence comprised 586 bp and was located at the 3' end of the RepMP2/3
repeat region (region A in Fig. 1). A sequence completely identical to
this variable region of the new P1 gene was found within the M. pneumoniae P1 type 1 M129 genome sequence. Comparison with a
recently reported new variable sequence in the P1 gene of P1 type 2 strain 309 (15) revealed that both strains had a 55-bp
region of 100% identity (region B in Fig. 1). This 55-bp region was
present at three sites on the M. pneumoniae M129 genome; one
site was located within one of the RepMP1 repeat sequences, and the two
others were located in regions designated RepMP2/3-5 and RepMP2/3-6 by
Kenri et al. (15). This finding suggests that sequences
within repeat regions have been exchanged within the M. pneumoniae genome.
In strain Mp4817 and reference strain MAC, a region of full identity
was present in the central part of the RepMP2/3 region of the P1 gene
(region C in Fig. 1). This region of full identity appeared to be a
hybrid sequence, combining P1 type 1- and type 2-specific sequences. At
two locations outside the P1 gene locus within the M129 genome, regions
nearly identical to region C were found, within RepMP2/3 copies. In
contrast to the general contention, our data indicate that
recombination between sequences specific for P1 types 1 and 2 may
occur. The finding that these sequences are also present at other
locations in the genome, associated with repetitive sequences, strongly
supports a possible role for intragenomic recombination between
repetitive sequences in the P1 gene and those present elsewhere in the
genome (15, 24, 28, 31). Similar intragenomic repeat
recombinations may occur within other M. pneumoniae genes
encoding immunogenic surface proteins, such as the 30- and 90-kDa
proteins. It may be hypothesized that recombination events are a
general mechanism causing variation in immunogenic surface proteins of
M. pneumoniae, contributing to evasion of the host immune
response. Such mechanisms have also been described for the closely
related Mycoplasma genitalium (4), Mycoplasma hominis (32), and other bacterial
species such as Neisseria spp. (20) and group A
streptococci (9).
The five completely sequenced P1 genes encode full-length P1 proteins.
Mutations at the start of the P1 gene, such as the frameshift mutation
due to insertion of an adenine causing premature termination of
translation in a cytadherence-negative M. pneumoniae strain
(25), were not found. The first 59 amino acid residues of
the P1 translation product are assumed to be a leader sequence that is
processed to yield the mature P1 protein (10, 12). This
putative leader sequence was present in all five new P1 sequences and
in all cases was identical to that of strains M129 (P1 type 1) and TW
7-5 (P1 type 2), implying that the five P1 genes all encode P1 proteins
which can be processed to functional adhesins.
The P1 protein topology has been partly resolved by identification of
cytadherence-mediating and antigenic epitopes (5, 7, 13,
14) and by predicting membrane-associated helices (7,
11). A model has been proposed where three regions, an N-terminal domain (N-reg) (13), a middle domain (D1)
(13), and a C-terminal domain (D2) (5)
cooperate to form the cytadherence-mediating binding sites
(7). The N terminus of the mature P1 protein is considered
to be located outside the cell (12). According to this
model, one of the divergent amino acids in the P1 protein of our
strains was localized in a part of the P1 protein recognized as an
antigenic epitope (14), whereas several others were
localized in predicted surface-exposed loops. It therefore may well be
that these amino acid changes cause antigenic variation of the P1 proteins.
Recently, the C-terminal domain of the P1 protein of M. pneumoniae strain FH was found to be highly antigenic (M. Pedersen, S. Birkelund, and G. Christiansen, Abstr. 13th Int. Congr.
Int. Org. Mycoplasmol., p. 241, 2000). We identified sequence variation in this region. This may imply that the amino acid changes in the
C-terminal domain of the P1 protein in strain Mp4817 contribute to
evasion of the host immune response. Because of this variation, the use
of peptides derived from the corresponding region of the P1 protein for
development of a diagnostic test (Pedersen et al., Abstr. 13th Int.
Congr. Int. Org. Mycoplasmol.) should also be cautioned.
M. pneumoniae is notoriously lacking in genomic variation,
as only two genomic types have been distinguished by randomly amplified polymorphic DNA analysis (30), by RFLP analysis of long
PCR amplicons of interrepeat regions (6), and by
sequencing of the 16S-23S rRNA gene spacer region (6).
Only one additional genomic variant has recently been described
(3). Therefore, typing of M. pneumoniae based
on analysis of usual targets such as housekeeping genes
(19) presumably will not allow intraspecies differentiation. Genes encoding surface-exposed proteins, such as the
P1 cytadhesin gene, are expected to be more variable and therefore to
be more suitable as typing targets. We showed that in two of the five
strains studied, P1 type 1 and 2 hybrid sequences were present. In
addition, in four of the five strains several nucleotide polymorphisms
were identified in the P1 gene sequence. In order to enable more
refined strain differentiation, putative genotyping targets in the P1
gene may be derived from our sequence data. Direct sequencing of the
generated fragments will increase insight into the variability of these
sites in the P1 gene and can be used to study molecular epidemiology of
M. pneumoniae. In addition to the variable sequences within
the P1 gene, targets for typing through direct sequencing may be found
in other genes encoding surface-exposed proteins, such as the 30-kDa
protein (18). Ideally, a multilocus direct sequence typing
system (19, 23) could be developed for M. pneumoniae, using variable sequences of outer surface protein
genes as targets.
 |
ACKNOWLEDGMENTS |
We thank H. Boswijk and H. Kuijken for excellent technical
assistance and J. S. Jensen, Statens Serum Institut, Copenhagen, Denmark, for providing M. pneumoniae isolates.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medical Microbiology, Academic Medical Center, Meibergdreef 15, 1105 AZ
Amsterdam, The Netherlands. Phone: 31 20 5664863. Fax: 31 20 6979271. E-mail: S.A.Zaat{at}amc.uva.nl.
Editor:
A. D. O'Brien
 |
REFERENCES |
| 1.
|
Baseman, J. B.,
R. M. Cole,
D. C. Krause, and D. K. Leith.
1982.
Molecular basis for cytadhesion of Mycoplasma pneumoniae.
J. Bacteriol.
151:1514-1522[Abstract/Free Full Text].
|
| 2.
|
Cousin, A.,
B. de Barbeyrac,
A. Charron,
H. Renaudin, and C. Bebear.
1994.
Analysis of RFLPs of amplified cytadhesin P1 gene for epidemiological study of Mycoplasma pneumoniae.
IOM Lett.
3:494-495.
|
| 3.
|
Cousin, A. A.,
A. Charron,
B. de Barbeyrac,
G. Fremy,
J. S. Jewson,
H. Renaudin, and C. Bebear.
2000.
Molecular typing of Mycoplasma pneumoniae strains by PCR-based methods and pulsed-field gel electrophoresis. Application to French and Danish isolates.
Epidemiol. Infect.
124:103-111[CrossRef][Medline].
|
| 4.
|
Dallo, S. F., and J. B. Baseman.
1991.
Adhesin gene of Mycoplasma genitalium exists as multiple copies.
Microb. Pathog.
10:475-480[CrossRef][Medline].
|
| 5.
|
Dallo, S. F.,
C. J. Su,
J. R. Horton, and J. B. Baseman.
1988.
Identification of P1 gene domain containing epitope(s) mediating Mycoplasma pneumoniae cytoadherence.
J. Exp. Med.
167:718-723[Abstract/Free Full Text].
|
| 6.
|
Dorigo-Zetsma, J. W.,
J. Dankert, and S. A. J. Zaat.
2000.
Genotyping of Mycoplasma pneumoniae clinical isolates reveals eight P1 subtypes within two genomic groups.
J. Clin. Microbiol.
38:965-970[Abstract/Free Full Text].
|
| 7.
|
Gerstenecker, B., and E. Jacobs.
1990.
Topological mapping of the P1-adhesin of Mycoplasma pneumoniae with adherence-inhibiting monoclonal antibodies.
J. Gen. Microbiol.
136:471-476[Abstract/Free Full Text].
|
| 8.
|
Himmelreich, R.,
H. Hilbert,
H. Plagens,
E. Pirkl,
B. C. Li, and R. Herrmann.
1996.
Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae.
Nucleic Acids Res.
24:4420-4449[Abstract/Free Full Text].
|
| 9.
|
Hollingshead, S. K.,
V. A. Fischetti, and J. R. Scott.
1987.
Size variation in group A streptococcal M protein is generated by homologous recombination between intragenic repeats.
Mol. Gen. Genet.
207:196-203[CrossRef][Medline].
|
| 10.
|
Inamine, J. M.,
T. P. Denny,
S. Loechel,
U. Schaper,
C. H. Huang,
K. F. Bott, and P. C. Hu.
1988.
Nucleotide sequence of the P1 attachment-protein gene of Mycoplasma pneumoniae.
Gene
64:217-229[CrossRef][Medline].
|
| 11.
|
Jacobs, E.,
A. Bartl,
K. Oberle, and E. Schiltz.
1995.
Molecular mimicry by Mycoplasma pneumoniae to evade the induction of adherence inhibiting antibodies.
J. Med. Microbiol.
43:422-429[Abstract/Free Full Text].
|
| 12.
|
Jacobs, E.,
K. Fuchte, and W. Bredt.
1987.
Amino acid sequence and antigenicity of the amino-terminus of the 168 kDa adherence protein of Mycoplasma pneumoniae.
J. Gen. Microbiol.
133:2233-2236[Abstract/Free Full Text].
|
| 13.
|
Jacobs, E.,
B. Gerstenecker,
B. Mader,
C. H. Huang,
P. C. Hu,
R. Halter, and W. Bredt.
1989.
Binding sites of attachment-inhibiting monoclonal antibodies and antibodies from patients on peptide fragments of the Mycoplasma pneumoniae adhesin.
Infect. Immun.
57:685-688[Abstract/Free Full Text].
|
| 14.
|
Jacobs, E.,
A. Pilatschek,
B. Gerstenecker,
K. Oberle, and W. Bredt.
1990.
Immunodominant epitopes of the adhesin of Mycoplasma pneumoniae.
J. Clin. Microbiol.
28:1194-1197[Abstract/Free Full Text].
|
| 15.
|
Kenri, T.,
R. Taniguchi,
Y. Sasaki,
N. Okazaki,
M. Narita,
K. Izumikawa,
M. Umetsu, and T. Sasaki.
1999.
Identification of a new variable sequence in the P1 cytadhesin gene of Mycoplasma pneumoniae: evidence for the generation of antigenic variation by DNA recombination between repetitive sequences.
Infect. Immun.
67:4557-4562[Abstract/Free Full Text].
|
| 16.
|
Kokotovic, B.,
N. F. Friis,
J. S. Jensen, and P. Ahrens.
1999.
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species.
J. Clin. Microbiol.
37:3300-3307[Abstract/Free Full Text].
|
| 17.
|
Krause, D. C.
1996.
Mycoplasma pneumoniae cytadherence: unravelling the tie that binds.
Mol. Microbiol.
20:247-253[CrossRef][Medline].
|
| 18.
|
Layh, S. G.,
R. Himmelreich, and U. Leibfried.
1997.
The adhesin related 30-kDa protein of Mycoplasma pneumoniae exhibits size and antigen variability.
FEMS Microbiol. Lett.
152:101-108[CrossRef][Medline].
|
| 19.
|
Maiden, M. C.,
J. A. Bygraves,
E. Feil,
G. Morelli,
J. E. Russell,
R. Urwin,
Q. Zhang,
J. Zhou,
K. Zurth,
D. A. Caugant,
I. M. Feavers,
M. Achtman, and B. G. Spratt.
1998.
Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms.
Proc. Natl. Acad. Sci. USA
95:3140-3145[Abstract/Free Full Text].
|
| 20.
|
Meyer, T. F.,
C. P. Gibbs, and R. Haas.
1990.
Variation and control of protein expression in Neisseria.
Annu. Rev. Microbiol.
44:451-477[CrossRef][Medline].
|
| 21.
|
Razin, S., and E. Jacobs.
1992.
Mycoplasma adhesion.
J. Gen. Microbiol.
138:407-422[Free Full Text].
|
| 22.
|
Sasaki, T.,
T. Kenri,
N. Okazaki,
M. Iseki,
R. Yamashita,
M. Shintani,
Y. Sasaki, and M. Yayoshi.
1996.
Epidemiological study of Mycoplasma pneumoniae infections in Japan based on PCR-restriction fragment length polymorphism of the P1 cytadhesin gene.
J. Clin. Microbiol.
34:447-449[Abstract].
|
| 23.
|
Spratt, B. G.
1999.
Multilocus sequence typing: molecular typing of bacterial pathogens in an era of rapid DNA sequencing and the internet.
Curr. Opin. Microbiol.
2:312-316[CrossRef][Medline].
|
| 24.
|
Su, C. J.,
A. Chavoya, and J. B. Baseman.
1988.
Regions of Mycoplasma pneumoniae cytadhesin P1 structural gene exist as multiple copies.
Infect. Immun.
56:3157-3161[Abstract/Free Full Text].
|
| 25.
|
Su, C. J.,
A. Chavoya, and J. B. Baseman.
1989.
Spontaneous mutation results in loss of the cytadhesin (P1) of Mycoplasma pneumoniae.
Infect. Immun.
57:3237-3239[Abstract/Free Full Text].
|
| 26.
|
Su, C. J.,
A. Chavoya,
S. F. Dallo, and J. B. Baseman.
1990.
Sequence divergency of the cytadhesin gene of Mycoplasma pneumoniae.
Infect. Immun.
58:2669-2674[Abstract/Free Full Text].
|
| 27.
|
Su, C. J.,
S. F. Dallo, and J. B. Baseman.
1990.
Molecular distinctions among clinical isolates of Mycoplasma pneumoniae.
J. Clin. Microbiol.
28:1538-1540[Abstract/Free Full Text].
|
| 28.
|
Su, C. J.,
S. F. Dallo,
A. Chavoya, and J. B. Baseman.
1993.
Possible origin of sequence divergence in the P1 cytadhesin gene of Mycoplasma pneumoniae.
Infect. Immun.
61:816-822[Abstract/Free Full Text].
|
| 29.
|
Su, C. J.,
V. V. Tryon, and J. B. Baseman.
1987.
Cloning and sequence analysis of cytadhesin P1 gene from Mycoplasma pneumoniae.
Infect. Immun.
55:3023-3029[Abstract/Free Full Text].
|
| 30.
|
Ursi, D.,
M. Ieven,
H. van Bever,
W. Quint,
H. G. Niesters, and H. Goossens.
1994.
Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting.
J. Clin. Microbiol.
32:2873-2875[Abstract/Free Full Text].
|
| 31.
|
Yogev, D.,
R. Rosengarten,
R. Watson-McKown, and K. S. Wise.
1991.
Molecular basis of Mycoplasma surface antigenic variation: a novel set of divergent genes undergo spontaneous mutation of periodic coding regions and 5' regulatory sequences.
EMBO J.
10:4069-4079[Medline].
|
| 32.
|
Zhang, Q., and K. S. Wise.
1996.
Molecular basis of size and antigenic variation of a Mycoplasma hominis adhesin encoded by divergent vaa genes.
Infect. Immun.
64:2737-2744[Abstract].
|
Infection and Immunity, September 2001, p. 5612-5618, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5612-5618.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Schurwanz, N., Jacobs, E., Dumke, R.
(2009). Strategy To Create Chimeric Proteins Derived from Functional Adhesin Regions of Mycoplasma pneumoniae for Vaccine Development. Infect. Immun.
77: 5007-5015
[Abstract]
[Full Text]
-
Spuesens, E. B. M., Oduber, M., Hoogenboezem, T., Sluijter, M., Hartwig, N. G., van Rossum, A. M. C., Vink, C.
(2009). Sequence variations in RepMP2/3 and RepMP4 elements reveal intragenomic homologous DNA recombination events in Mycoplasma pneumoniae. Microbiology
155: 2182-2196
[Abstract]
[Full Text]
-
Maquelin, K., Hoogenboezem, T., Jachtenberg, J.-W., Dumke, R., Jacobs, E., Puppels, G. J., Hartwig, N. G., Vink, C.
(2009). Raman spectroscopic typing reveals the presence of carotenoids in Mycoplasma pneumoniae. Microbiology
155: 2068-2077
[Abstract]
[Full Text]
-
Degrange, S., Cazanave, C., Charron, A., Renaudin, H., Bebear, C., Bebear, C. M.
(2009). Development of Multiple-Locus Variable-Number Tandem-Repeat Analysis for Molecular Typing of Mycoplasma pneumoniae. J. Clin. Microbiol.
47: 914-923
[Abstract]
[Full Text]
-
Dumke, R., Jacobs, E.
(2009). Comparison of Commercial and In-House Real-Time PCR Assays Used for Detection of Mycoplasma pneumoniae. J. Clin. Microbiol.
47: 441-444
[Abstract]
[Full Text]
-
Musatovova, O., Kannan, T. R., Baseman, J. B.
(2008). Genomic Analysis Reveals Mycoplasma pneumoniae Repetitive Element 1-Mediated Recombination in a Clinical Isolate. Infect. Immun.
76: 1639-1648
[Abstract]
[Full Text]
-
Kenri, T., Okazaki, N., Yamazaki, T., Narita, M., Izumikawa, K., Matsuoka, M., Suzuki, S., Horino, A., Sasaki, T.
(2008). Genotyping analysis of Mycoplasma pneumoniae clinical strains in Japan between 1995 and 2005: type shift phenomenon of M. pneumoniae clinical strains. J Med Microbiol
57: 469-475
[Abstract]
[Full Text]
-
Pereyre, S., Charron, A., Renaudin, H., Bebear, C., Bebear, C. M.
(2007). First Report of Macrolide-Resistant Strains and Description of a Novel Nucleotide Sequence Variation in the P1 Adhesin Gene in Mycoplasma pneumoniae Clinical Strains Isolated in France over 12 Years. J. Clin. Microbiol.
45: 3534-3539
[Abstract]
[Full Text]
-
Dumke, R., Schurwanz, N., Lenz, M., Schuppler, M., Luck, C., Jacobs, E.
(2007). Sensitive Detection of Mycoplasma pneumoniae in Human Respiratory Tract Samples by Optimized Real-Time PCR Approach. J. Clin. Microbiol.
45: 2726-2730
[Abstract]
[Full Text]
-
Iverson-Cabral, S. L., Astete, S. G., Cohen, C. R., Rocha, E. P. C., Totten, P. A.
(2006). Intrastrain Heterogeneity of the mgpB Gene in Mycoplasma genitalium Is Extensive In Vitro and In Vivo and Suggests that Variation Is Generated via Recombination with Repetitive Chromosomal Sequences. Infect. Immun.
74: 3715-3726
[Abstract]
[Full Text]
-
Dumke, R., Luck, P. C., Noppen, C., Schaefer, C., von Baum, H., Marre, R., Jacobs, E.
(2006). Culture-Independent Molecular Subtyping of Mycoplasma pneumoniae in Clinical Samples.. J. Clin. Microbiol.
44: 2567-2570
[Abstract]
[Full Text]
-
Ginevra, C., Barranger, C., Ros, A., Mory, O., Stephan, J.-L., Freymuth, F., Joannes, M., Pozzetto, B., Grattard, F.
(2005). Development and Evaluation of Chlamylege, a New Commercial Test Allowing Simultaneous Detection and Identification of Legionella, Chlamydophila pneumoniae, and Mycoplasma pneumoniae in Clinical Respiratory Specimens by Multiplex PCR. J. Clin. Microbiol.
43: 3247-3254
[Abstract]
[Full Text]
-
Catrein, I., Dumke, R., Weiner, J. III, Jacobs, E., Herrmann, R.
(2004). Cross-complementation between the products of the genes P1 and ORF6 of Mycoplasma pneumoniae subtypes 1 and 2. Microbiology
150: 3989-4000
[Abstract]
[Full Text]