Previous Article | Next Article 
Infection and Immunity, September 2001, p. 5742-5751, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5742-5751.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
dksA Is Required for Intercellular
Spread of Shigella flexneri via an
RpoS-Independent Mechanism
Scott A.
Mogull,
Laura J.
Runyen-Janecky,
Mei
Hong,
and
Shelley M.
Payne*
Section of Molecular Genetics and
Microbiology and Institute for Cellular and Molecular Biology, The
University of Texas at Austin, Austin, Texas 78712-1095
Received 1 February 2001/Returned for modification 13 April
2001/Accepted 31 May 2001
 |
ABSTRACT |
Pathogenesis of Shigella flexneri is dependent on
the ability of the bacterium to invade and spread within epithelial
cells. In this study, we identified dksA as a gene
necessary for intercellular spread in, but not invasion of, cultured
cells. The S. flexneri dksA mutant exhibited sensitivity
to acid and oxidative stress, in part due to an effect of DksA on
production of RpoS. However, an S. flexneri rpoS mutant
formed plaques on tissue culture monolayers, thus excluding DksA
regulation of RpoS as the mechanism responsible for the inability of
the dksA mutant to spread intercellularly. Intracellular
analysis of the dksA mutant indicates that it survived and divided within the Henle cell cytoplasm, but the
dksA mutant cells were elongated, and some
exhibited filamentation in the intracellular environment. Some
of the S. flexneri dksA mutant cells showed
aberrant localization of virulence protein IcsA, which may inhibit
spread between epithelial cells.
 |
INTRODUCTION |
Shigella flexneri
colonizes the colon and causes bacterial dysentery in humans (13,
27, 37). These bacteria are highly infectious, with as few as 10 cells being sufficient to cause disease in healthy adults
(6). This low infectious dose is partially due to a
significant resistance to acidic conditions, which permits survival
during transit through the acidic conditions encountered in the human
stomach (12, 38). In the colon, Shigella cells
cross the epithelial layer, attach to the basal surfaces of epithelial
cells in a receptor-specific process, and induce their own
internalization (29). Following internalization,
Shigella cells are temporarily located in a phagocytic
vacuole. Lysis of this vacuole occurs within minutes, and
Shigella cells initiate replication and cell to cell spread.
This process is accompanied by a complex pattern of protein induction
and suppression (16). Cell-to-cell spread requires that
Shigella protein IcsA (VirG) be targeted to the old pole of
the bacterium, where it induces assembly of F-actin by the epithelial
cell (2, 25, 26, 39). The process by which S. flexneri localizes IcsA to a polar location is unknown, but the
unipolar localization of IcsA when expressed in Escherichia
coli indicates that Shigella virulence plasmid proteins
are not involved in this process in E. coli
(36). Polymerization of actin at one pole is responsible
for propelling the bacterium through the host cytoplasm and into a
protrusion of a double-membrane barrier between two host cells.
Shigella lyses this membrane barrier, and, after being
released into the new epithelial cell, the bacteria repeat the process
of multiplication and spread. Progressive spread of these bacteria
leads to degradation of the epithelium and inflammation, resulting in
symptoms of disease. An in vitro model utilizing tissue culture
monolayers that mimics the process of S. flexneri invasion,
intercellular multiplication, and spread has been developed (14,
22, 31). Bacteria that form plaques on these tissue culture
monolayers are capable of performing these intracellular processes.
Using this model, we examined TnphoA mutants that were
deficient in intracellular multiplication or intercellular spread. One
gene, dksA, was identified here to be required for the
intercellular spread of S. flexneri.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
Bacterial strains
and plasmids used here are listed with their sources in Table
1. All strains were stored at
80°C in
tryptic soy broth plus 20% glycerol. S. flexneri strains
were grown on Congo red agar to screen colonies that bind Congo red
(33). E. coli strains were grown in Luria broth
(LB) or on Luria agar (L agar). Intracellular salts medium (ISM) was
used to mimic the intracellular conditions (16). All
strains were routinely cultured at 37°C unless otherwise noted.
Antibiotics were used as appropriate at the following concentrations:
carbenicillin, 250 µg/ml; chloramphenicol, 30 µg/ml; kanamycin, 50 µg/ml; tetracycline, 12.5 µg/ml.
Isolation and identification of the dksA
mutation.
TnphoA mutagenesis of wild-type S. flexneri 2a (SA100) Cmr derivative SA511 was
performed as described previously (19). Mutants that were
invasive but unable to form plaques on HeLa cell monolayers were
isolated, and the sites of the insertions were determined by inverse
PCR as described below.
The chromosomal DNA from the TnphoA insertion mutants was
digested with TaqI restriction endonuclease, which has a
site 403 bp downstream from the 5' end of TnphoA. DNA
fragments were circularized by ligation with T4 DNA ligase. The
ligation reaction mixtures were purified using the QIAquick PCR
purification kit (Qiagen, Valencia, Calif.). PCR was conducted on the
ligation reaction mixture using Taq polymerase (Qiagen) in
the reaction buffer supplied by the manufacturer and supplemented with
250 µM deoxynucleoside triphosphates and 1 µM concentrations of
primers TnphoA-1 (5'CAAAACGGGAAAGGTTCCG) and
TnphoA-2 (5'GCTCTGCGTGATTCTCTTAGCG). The reaction
conditions were 30 cycles of 94°C for 1 min, 51°C for 1 min, and
72°C for 1 min. The DNA sequences of the inverse PCR products were
determined with an ABI Prism 377 DNA sequencer (Perkin-Elmer Co.,
Applied Biosystems Division).
Cloning of the dksA gene.
The dksA
gene of S. flexneri SA100 was amplified by PCR using
chromosomal DNA and Pfu polymerase (Stratagene Cloning
Systems, La Jolla, Calif.) in the reaction buffer supplied by the
manufacturer and supplemented with 250 µM deoxynucleoside
triphosphate and 1 µM concentrations of primers dksA-1
(5'AGAACGCAGCCGTATTGAC) and dksA-2
(5'CAGAGAGCCAAAATGAAGC). The reaction conditions were 30 cycles of 95°C for 45 s, 55.9°C for 45 s, and 72°C for
200 s. This PCR fragment was cloned into low-copy-number vector
pWKS30 to generate pSAM1.
Construction of bacterial mutants.
The dksA
mutation from SA2287 was moved into wild-type SA100 by P1 transduction
(28) to generate SA5287. The presence of the
TnphoA insertion in dksA was confirmed by PCR.
S. flexneri rpoS mutant SA710 was constructed in SA100 by P1
transduction of the rpoS::kan allele
from E. coli ZK1000 (3). The presence of the
kan insertion in rpoS was confirmed by PCR.
Environmental stress resistance assays.
Resistance to either
acid or the oxidizing agent cumene hydroperoxide (CHP) (Sigma Chemical
Co.) was determined by a modification of the method of Waterman and
Small (46). Bacterial cultures containing the appropriate
antibiotics were incubated in LB for 19 h with aeration at 37°C.
Bacteria were then exposed to either acid or CHP as follows. In the
acid resistance assay, acidic medium was prepared by adjusting LB to pH
2.5 with HCl and filter sterilization. Overnight bacterial cultures
were diluted 1:50 into LB, pH 2.5. In the CHP resistance assay, the CHP
stock (approximately 80%) was diluted 1:10 in dimethyl sulfoxide. One
milliliter of each overnight culture was removed, and 3.8 µl of 8%
CHP was added to yield a final concentration of approximately 2 mM CHP.
Immediately following exposure to either acid or CHP, cultures were
briefly vortexed and an aliquot was removed, diluted in saline, and
plated on L agar to determine the initial CFU per milliliter. The
remaining culture was incubated without aeration at 37°C. At each
time point, an aliquot of the sample was removed, diluted, and plated
as described above. L plates were incubated overnight at 37°C, and
values of CFU per milliliter were calculated the following day. Percent survival is reported as CFU per milliliter at each time point divided
by CFU per milliliter at time zero.
Tissue culture, cell invasion, and plaque assays.
Henle 407 cell monolayers were used in all experiments and were cultured in
Earle's minimal essential medium plus 2 mM glutamine plus 10% fetal
calf serum (Life Technologies, Grand Island, N.Y.) and incubated in a
5% CO2 atmosphere at 37°C. Invasion assays to
examine the ability of S. flexneri to invade and multiply
within Henle cells were performed as described by Hale and Formal
(14) and as modified by Hong et al. (19).
Plaque assays were conducted to assay the intercellular spread of
S. flexneri as described by Oaks et al. (31)
and as modified by Hong et al. (19).
Phagocytic vacuole escape assay.
Henle cells were grown on
glass coverslips according to the invasion assay procedure
(19). Approximately 3 h prior to invasion, the medium
was removed and replaced with serum-free medium containing 0.015 mg of
5-(and 6)-carboxytetramethylrhodamine succinimidyl ester
(Molecular Probes, Eugene, Oreg.)/ml to label Henle cell membrane
proteins. Cells were incubated at 37°C for 1 h, washed four
times with phosphate-buffered saline (PBS) to remove excess rhodamine
probes, and incubated for 1 h in fresh serum-containing medium to
conjugate unbound rhodamine probes to serum proteins. The Henle cells
were then washed twice with PBS, and fresh medium was added. Bacterial
invasion was conducted as described previously (19) using
bacteria expressing green fluorescent protein (GFP) encoded by plasmid
pUC-GFP. At 1 h postinvasion, the glass coverslips were washed
four times with PBS, fixed for 10 min in 4% (wt/vol) paraformaldehyde
in PBS, washed twice with water, and sealed inverted on a glass slide.
Fluorescent images were visualized by excitation at either 488 or 568 nm on a Leica TCS 4D confocal laser scanning microscope. Images show
the excitation from only one wavelength to ensure that the fluorescence
signal results from only one signal. Each image was examined by
optically sectioning through the eukaryotic cell membrane and cytoplasm
to confirm that the bacteria were located intracellularly.
In vitro growth rate.
In vitro growth rate was determined by
diluting overnight LB cultures to approximately
106 CFU/ml in 25 ml of LB or ISM and incubating
them with aeration at 37°C. At each time point, CFU were determined
by diluting and plating.
IcsA localization assay.
IcsA (VirG) localization was
determined by modification of the indirect immunofluorescence procedure
of van den Bosch et al. (44). For localization of IcsA in
vitro, 1 ml of bacteria grown to late logarithmic phase in LB was fixed
in 4% paraformaldehyde for 10 min; this was followed by two washes
with PBS. The bacteria were resuspended in 100 µl of PBS, and rabbit
anti-IcsA antiserum 35 (obtained from Edwin Oaks) was added at a 1:50
dilution. The samples were incubated at room temperature for 1 h,
centrifuged, and washed two times with PBS. Samples were resuspended in
100 µl of fluorescein isothiocyanate (FITC)-conjugated goat
anti-rabbit IgG (ICN Pharmaceuticals, Inc., Aurora, Ohio) at a 1:100
dilution. After 1 h of incubation at room temperature, the samples
were centrifuged, washed two times with PBS, and resuspended in 20 µl
of PBS. One microliter of each sample was air dried on a glass slide
and mounted in 90% glycerol-10% PBS containing 1 mg of
p-phenylenediamine/ml (pH 8.0).
For localization of IcsA in vivo, invasion assays were done as
described above with Henle cells grown on glass coverslips. After
3 h, samples were fixed in 1% paraformaldehyde for 15 min, washed
two times with PBS, treated with PBS containing 50 mM
NH4Cl for 5 min, and washed two times with PBS.
Henle cells were permeabilized with 0.2% Triton X-100 for 10 min and then washed once with PBS for 5 min. Coverslips were incubated
cell side down on 50 µl of anti-IcsA antisera diluted 1:50 in PBS
containing 1 mg of bovine serum albumin(BSA)/ml for 1 h at room
temperature and washed three times for 5 min each with PBS. Coverslips
were incubated cell side down on 50 µl of FITC-conjugated goat
anti-rabbit antisera diluted 1:100 in PBS-1 mg of BSA/ml for 1 h
at room temperature, washed three times for 5 min each with PBS, and
mounted in 90% glycerol-10% PBS containing 1 mg of
p-phenylenediamine/ml (pH 8.0).
Samples were visualized on a Leica TCS 4D confocal laser scanning
microscope equipped with a 488-nm laser, FITC detection filters, and
differential interference contrast for phase-contrast imaging.
Nucleotide sequence accession number.
The DNA sequence of
the S. flexneri dksA gene has been submitted to the GenBank
database under accession no. AF323722.
 |
RESULTS |
Isolation of an S. flexneri dksA mutant defective in
plaque formation.
A library of S. flexneri
TnphoA mutants was previously constructed to identify
mutants that were defective in intracellular multiplication or
cell-to-cell spread by screening for mutants that were invasive but
unable to form plaques on tissue culture monolayers (19).
Although TnphoA mutagenesis was used primarily to identify
mutations in periplasmic or membrane proteins by screening for
PhoA+ colonies, some mutants with little or no
activity were isolated for further study. DNA sequencing of inverse PCR
products revealed that one mutant that had low alkaline phosphatase
activity, SA2287, contained a TnphoA insertion in
dksA, a gene originally identified in E. coli as
a suppressor of a dnaK mutation. The deduced amino acid
sequence of S. flexneri DksA has 98% amino acid identity to
the predicted E. coli and Salmonella enterica
serovar Typhimurium sequences.
The initial dksA::TnphoA mutation was
transduced with phage P1 into a wild-type SA100 background, generating
SA5287. This mutant exhibited the same invasive but plaque-deficient
phenotype as SA2287 (Table 2).
Transformation of SA5287 with plasmid pSAM1, containing the wild-type
S. flexneri dksA gene, restored plaque formation in the
dksA mutant (Table 2). These results indicated that the
dksA mutation was responsible for the plaque-deficient phenotype and that DksA is required for intracellular
multiplication or cell-to-cell spread, but not for invasion of
cultured cells, by S. flexneri.
Plaque assay of the rpoS mutant.
DksA has been
reported to be required for the optimal expression of sigma factor RpoS
(47), which regulates the stress and starvation response.
Therefore, we postulated that S. flexneri may require DksA
for survival of possible environmental stresses experienced in the
intracellular environment. To determine whether the defect in plaque
formation in the dksA mutant was due to reduced expression
of RpoS, we constructed an rpoS mutant by P1 transduction from an E. coli rpoS::kan mutant and
tested it for the ability to form plaques. S. flexneri rpoS
mutant SA710 formed plaques on tissue culture monolayers (Table 2).
Thus, the failure of the dksA mutant to spread on cultured
cell monolayers is independent of RpoS.
Acid sensitivity of the dksA and rpoS
mutants.
Although the rpoS plaque assay indicated that
DksA regulation of RpoS is not required for virulence in Henle cells,
this regulation may be important for survival of S. flexneri
during passage through the host stomach. S. flexneri is
highly resistant to acidic conditions and is capable of surviving at pH
2.5 for several hours (12, 38). This ability has been
attributed to expression of RpoS-dependent genes, and an
rpoS mutant is extremely acid sensitive (46). Since S. flexneri encounters acidic conditions during
transit through the stomach and possibly in other locations within the host, we compared the in vitro acid resistances of dksA and
rpoS mutants by examining the survival of stationary-phase
cultures in LB at pH 2.5.
Both the rpoS and dksA mutants were significantly
more sensitive to acid than the parental strain. The dksA
mutant exhibited a sharp reduction in acid survival during the first
hour of incubation in LB at pH 2.5 (Fig.
1) and was approximately 100 times more sensitive than the wild type. The rpoS mutant was even more
sensitive to acid than the dksA mutant, exhibiting
sensitivity below the detectable level of 0.001% survival. The
fact that the rpoS mutant was more acid sensitive than the
dksA mutant suggests that rpoS expression was not
completely blocked in the dksA mutant. This result was
confirmed by Western blot analysis, which showed that RpoS was present,
yet below wild-type levels, in the dksA mutant (data not
shown).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Effect of dksA and rpoS on
survival of S. flexneri in acid. Shown are percentages
of survival over time in LB-HCl, pH 2.5, for wild-type SA100 (circles)
and dksA mutant SA5287 (squares) S.
flexneri. The rpoS mutant SA710 (dashed line)
was below detectable levels of 0.001% survival at all time points and
is plotted as the theoretical maximal level of survival. The
averages of three experiments are shown with the standard deviations.
|
|
If the decrease in acid resistance in a dksA mutant was due
to decreased expression of rpoS, then increased expression
of rpoS should restore acid resistance in a dksA
mutant. Western blot analysis indicated that RpoS levels were greater
in the dksA mutant containing the cloned rpoS
gene than in the dksA mutant without the gene or in
the wild-type parent strain (data not shown). To test the effect of
overexpression of rpoS in the dksA mutant, we
examined the acid resistance at 1 h of mutants containing either the dksA or rpoS cloned genes (Fig.
2). Overexpressing rpoS in the
dksA mutant was not sufficient to restore acid resistance. The resistance of SA5287/pDEB2 was slightly higher than that of SA5287
(Fig. 2), but the difference was not significant (P = 0.19). Additionally, dksA carrried on a plasmid was
insufficient to restore acid resistance in an rpoS mutant
(Fig. 2). However, the wild-type dksA gene restored acid
resistance in the dksA mutant, and rpoS restored
acid resistance in the rpoS mutant.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of dksA and rpoS on
acid resistance. The indicated strains were exposed to LB, pH 2.5, for
1 h, and the percent survival was determined by plating. The
averages of at least three experiments are shown with the standard
deviations.
|
|
CHP sensitivity of the dksA and rpoS
mutants.
In addition to acid resistance, oxidative stress
resistance is another RpoS-dependent environmental response that
Shigella may induce in the host environment. To test the
sensitivity of the dksA mutant to this stress, we exposed
undiluted, stationary-phase cultures to oxidizing agent CHP. All tested
strains exhibited sensitivity to oxidative stress, but the
dksA and rpoS mutants were significantly more
sensitive than the wild type (Fig. 3). As
observed with exposure to acid stress, the rpoS mutant
exhibited greater sensitivity than the dksA mutant.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of dksA and rpoS on
survival of S. flexneri in CHP. Shown is percent
survival over time in oxidizing agent CHP at an approximately 2 mM
concentration. Wild-type SA100 (circles), dksA mutant
SA5287 (squares), and rpoS mutant SA710 (triangles)
strains of S. flexneri were examined for 4 h. The
rpoS mutant was below the detectable levels of
10 7% survival at 3 and 4 h, and therefore these
data points do not appear on the graph. The averages of three
experiments are shown with the standard deviations.
|
|
The ability of dksA and rpoS carried on
plasmids to restore CHP resistance in the mutant strains was
examined at 2 h (Fig. 4). As
expected, plasmid-expressed dksA complemented the
CHP-sensitive phenotype in the dksA mutant. However, the
dksA-expressing plasmid failed to restore CHP resistance in
the rpoS mutant. Interestingly, plasmid-expressed
rpoS not only complemented sensitivity to oxidative stress
in the rpoS mutant but also restored resistance to oxidative stress in the dksA mutant. These results suggest that DksA
and RpoS operate in the same pathway during oxidative stress and that DksA is required upstream of RpoS for oxidative resistance.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of dksA and rpoS on
CHP resistance. The indicated strains were exposed to 2 mM CHP for
2 h, and the percent survival was determined by plating. The
averages of at least three experiments are shown with the standard
deviations.
|
|
Phagocytic vacuole escape of the dksA mutant.
Increased sensitivity of the dksA mutant to acid and
oxidative stress appears to be due, at least in part, to the effects of
DksA on RpoS expression. However, the fact that rpoS mutant SA710 produced plaques on Henle cell monolayers indicates that DksA
operates in an RpoS-independent role in intracellular multiplication or
spread of Shigella. To determine the role of DksA in the
intracellular environment, we examined the effect of a dksA
mutation on the different stages of the intracellular life cycle of
S. flexneri. The possible stages include escape from the
phagocytic vacuole, intracellular survival and multiplication, and
spread to an adjacent epithelial cell.
The ability of the dksA mutant to escape the phagocytic
vacuole was determined by infecting rhodamine-labeled Henle cells with
GFP-expressing bacteria (Fig. 5). The
5-(and 6)-carboxytetramethylrhodamine succinimidyl ester probe used in
this study forms peptide bonds with cellular proteins located on the
outer surfaces of eukaryotic cell plasma membranes (10,
32). The probe does not cross the plasma membrane and thus does
not label intracellular proteins. Phagocytic vacuoles that result from
the internalization of the plasma membrane are specifically labeled
with the rhodamine probe. Labeling the Henle cells with the rhodamine
probe did not affect bacterial invasion (data not shown). Following
invasion, we visualized GFP-expressing bacteria and rhodamine-labeled
Henle cell membranes by confocal scanning laser microscopy.
Intracellular bacteria that were unable to lyse the phagocytic
vacuole (E. coli DH5
/pLR56/pUC-GFP) were
surrounded by a rhodamine-labeled membrane (Fig. 5). This strain
expresses the Yersinia enterocolitica invA gene, which confers on E. coli the ability to attach to Henle cells and
be internalized but not to lyse the phagocytic vacuole. In
contrast, wild-type S. flexneri cells, which lyse the
vacuole, were located in the Henle cell cytoplasm and were not
surrounded by a rhodamine-labeled membrane (Fig. 5). Similarly, no
colocalization of GFP and rhodamine in Henle cells infected with the
dksA mutant was noted (Fig. 5). These results indicate that
the dksA mutant is capable of lysing the phagocytic vacuole
and gaining access to the host cell cytoplasm.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
Escape of wild-type and dksA mutant
bacteria from the Henle cell vacuole. Henle cells in which the cell
membrane had been labeled with 5- and 6-carboxytetramethylrhodamine
succinimidyl ester were infected with E. coli
DH5 /pLR56 (InvA+), wild-type S. flexneri
SA100, or dksA mutant SA5287. Each strain contained
plasmid pUC-GFP to provide constitutive production of GFP. (A)
GFP-labeled intracellular bacteria. (B) Rhodamine labeling of the Henle
cell and vacuole membrane. (C) Overlay of the two images created in
Adobe Photoshop.
|
|
Growth rate and in vivo multiplication of the dksA
mutant.
Although the dksA mutant gained access to the
Henle cell cytoplasm, the ability of the mutant to grow in the
intracellular environment could affect its ability to spread. Initial
observations indicated that the dksA mutant exhibited a
slightly reduced growth rate in LB at 37°C (Fig.
6) and a very long lag in ISM, which contains ions at concentrations comparable to those found in the eukaryotic cell cytoplasm (Fig. 7).
Following the extended lag in ISM, however, the growth rate of the
dksA mutant appeared to be approximately the same as that of
wild-type S. flexneri (Fig. 7). When the dksA
mutant population was subcultured from late-exponential or
stationary-phase growth in ISM, these cultures also exhibited a 25-h
lag (data not shown). Thus, the growth observed in ISM following the
delay was not the result of outgrowth of revertants or mutants that had
suppressors of the original dksA mutation.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro growth rates of S.
flexneri wild-type SA100 (circles) and dksA
mutant SA5287 (squares) in LB. The averages of three experiments
are shown with the standard deviations.
|
|

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 7.
Growth of S. flexneri in ISM. Wild-type
(circles) and the dksA mutant (squares) bacteria were
grown in ISM, and the numbers of bacteria at each time point were
determined by plating. The averages of three experiments are shown.
|
|
Since the dksA mutant exhibited a long lag in ISM, we
examined whether impaired intracellular growth could account for the failure of the mutant to spread intercellularly. Intracellular growth
rate was determined by counting the number of intracellular bacteria
per infected Henle cell at various times following invasion. In
contrast to the delayed onset of growth in ISM in vitro, the dksA mutant multiplied normally within Henle cells, and the
average growth rate of the dksA mutant was similar to that
of the wild type (Fig. 8).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 8.
In vivo growth rate of S. flexneri.
Wild-type SA100 (circles) and dksA mutant SA5287
(squares) strains of S. flexneri were isolated from
Henle cells at the indicated times, and the numbers of intracellular
bacteria were determined by plating. The average numbers of
intracellular bacteria in three independent experiments are shown.
|
|
Filamentation of the dksA mutant.
During
examination of intracellular growth, we observed elongation and
filamentation of the dksA mutant. The dksA mutant
bacteria appeared elongated compared to the wild type in the
intracellular environment during the first 2 h postinvasion (Fig.
9). At 3 h postinvasion, the
elongation was more pronounced and filamentation of some of the
dksA mutant cells was observed. Less filamentation was noted
at 4 h (Fig. 9), suggesting that this may be a transient phenomenon. Filamentation of the dksA mutant may impede
bacterial spread to an adjacent cell, but this phenomenon is unlikely
to be solely responsible for the inability of the dksA
mutant to form wild-type plaques, since only a portion of the cells
showed filamentation and since fewer filaments were observed at 4 h than at 3 h postinvasion.

View larger version (100K):
[in this window]
[in a new window]
|
FIG. 9.
Growth of the S. flexneri dksA mutant in
Henle cells. Henle cells infected with wild-type SA100 and
dksA mutant SA5287 bacteria were stained with
Wright-Giemsa stain and observed at 1,000× magnification at 2, 3, and
4 h postinvasion. Representative images are shown.
|
|
IcsA localization in the dksA mutant.
Because
the dksA mutant survived and multiplied in Henle cells but
did not form wild-type plaques, we examined the localization of IcsA on
the bacterial cells. The failure of S. flexneri to express
or properly localize IcsA, especially on filamentous bacteria, could
impede intercellular spread and the ability to form plaques (11). IcsA was observed at a polar location in wild-type
S. flexneri bacteria grown in vitro (Fig.
10B). The dksA mutant grown in broth showed examples of aberrant IcsA surface expression or localization, and fewer mutant cells bound the IcsA antibody than did
wild-type bacteria (Fig. 10D and data not shown). IcsA was localized to
one pole on some of the mutant bacteria, but others had IcsA located
over the entire cell surface or at both poles. The dksA
cells grown in vitro, like those growing intracellularly, were
elongated compared to the wild type, and some filamentation was
observed (Fig. 10C). However, there was no clear correlation between
elongation or filamentation and aberrant IcsA localization (Fig. 10C
and D, and data not shown).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 10.
Localization of IcsA on S. flexneri
grown in vitro. Phase-contrast and immunofluorescence images of SA100
(A and B) and SA5287 (C and D) followed staining with anti-IcsA are
shown. Cells were observed at 1,000× magnification. The SA100 images
are from 5-h cultures, and the SA5287 images are from two separate
fields at 4 and 5 h. Arrowheads, representative bacteria with
polarized IcsA; diamonds, representative bacteria with aberrant
localization of IcsA (either partially polarized or nonpolarized).
|
|
IcsA expression in intracellular bacteria was also examined (Fig.
11). The wild-type bacteria growing
within Henle cells showed polar localization of IcsA (Fig. 11A), but
the intracellular dksA mutant population was a mixture of
cells with polar and nonpolar IcsA localization (Fig. 11B). While DksA
may have other important functions in the cell, the requirement for
consistent polar localization of IcsA may be sufficient to account for
the aberrant plaque formation by the dksA mutant.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 11.
Localization of IcsA on Shigella
growing within Henle cells. Phase-contrast and immunofluorescence
images of SA100- (A) and SA5287-infected (B) Henle cells were
overlaid using Adobe Photoshop. Cells were observed at 1,000×
magnification. White arrowheads, representative bacteria with
polarized IcsA; black arrowheads, representative bacteria with aberrant
localization of IcsA (either partially polarized or nonpolarized).
|
|
 |
DISCUSSION |
Here, we identify DksA as a protein necessary for intercellular
spread of S. flexneri. DksA appears to influence or function in a variety of pathways in enteric bacteria. The phenotypes include a
failure to properly localize IcsA, sensitivity to environmental stress,
and cell elongation or filamentation. Two-dimensional gel analysis of
the S. flexneri dksA mutant showed that expression of
several proteins is altered compared to that for the wild type (data
not shown), which is in agreement with a previous report for S. enterica serovar Typhimurium (47). Because
the dksA mutant exhibited phenotypic deficiencies in
several assays and exhibited altered protein expression relative to
that of the wild type, we hypothesize that DksA may function in a
central pathway within the cell.
The dksA gene was initially isolated in E. coli
as part of a locus that, when overexpressed, could suppress the
temperature-sensitive growth of a dnaK deletion strain at
40.5°C (20). The dksA gene (dnaK
suppressor) encodes a 17.5-kDa protein that comprises 151 amino
acids and that has a pI of 4.87. Construction of an E. coli dksA deletion mutant indicated that dksA is not
an essential gene (20). The C terminus of DksA is similar,
and possibly related, to that of the F plasmid-encoded TraR
protein (5). This region of homology contains a
zinc finger domain common to many regulatory proteins, which may give
insight into the function of the protein (5). Support for
a regulatory role of DksA is provided by two-dimensional gel analysis
of proteins expressed by an exponentially growing culture of an
S. enterica serovar Typhimurium dksA mutant.
There is differential expression of at least 14 proteins compared to expression by the wild type (47).
Genetic analysis indicates that DksA is required for the optimal
translation of RpoS (sigma S), and an S. enterica serovar Typhimurium dksA mutant has a reduced amount of RpoS in
stationary phase (47). Our Western blot analysis indicates
that a similar effect is observed in the S. flexneri dksA
mutant (data not shown). RpoS is the sigma factor serving as a master
regulator of stationary-phase and stress response gene expression
(23), including genes required for survival during low pH
(24, 46), oxidative stress (8), UV radiation
(42, 43), and hyperosmolarity (17, 18). Thus, the decreased survival in harsh environmental conditions of the dksA mutant may partially be due to decreased levels of RpoS.
The role of RpoS in virulence appears to be dependent on the pathogen
as well as the stage of the infection process. RpoS is required for the
intracellular survival of Legionella pneumophila in its host
amoeboid species (15) as well as for virulence in S. enterica serovar Typhimurium (1, 4, 9, 48). However, the role of RpoS in virulence is rarely due to the regulation of
specific virulence genes. For example, fewer E. coli rpoS
mutant than wild-type cells are isolated following passage
through mouse and bovine hosts (35). This observation is
proposed to be due to the significant reduction in acid resistance of
the bacterium (35). RpoS has been reported to be important
during the initial colonization of S. enterica serovar
Typhimurium of the gut-associated lymphoid tissue, but RpoS does not
affect the ability of the bacterium to attach to and invade Int-407
cells and J774 macrophage-like cells or the ability to survive in
macrophages (30). RpoS has been excluded from any role
during the long-term colonization by E. coli of the mouse
large intestine (21). Interestingly, the presence of this
sigma factor appears to inhibit the virulence of Pseudomonas
aeruginosa since an rpoS mutant survives as well as
wild-type bacteria in rat lungs yet causes greater damage to lung
tissue (40).
DksA is necessary for S. enterica serovar Typhimurium
colonization of 3-week-old chicks and for virulence in 1-day-old
chicks, which lack a complex intestinal flora (41). There
also is a significant increase in the 50% lethal dose values for oral
infection of mice by the S. enterica serovar Typhimurium
dksA mutant (47). To date, the avirulent
phenotype of dksA mutants has only been examined in animal
models, and the molecular mechanism responsible has not been
investigated. However, it has been proposed that the avirulence of an
S. enterica serovar Typhimurium dksA mutant is
partially due to DksA regulation of RpoS (47).
Since the dksA mutant has reduced resistance to
environmental stresses, it is likely that DksA regulation of RpoS may
be required for full virulence of S. flexneri during
infection of the host, particularly during passage through the acidic
human stomach. However, the ability of the S. flexneri
rpoS mutant to form plaques on Henle cell monolayers excluded DksA
regulation of RpoS as the molecular mechanism responsible for failure
of the dksA mutant to spread in Henle cell monolayers.
Additionally, since the rpoS mutant is extremely sensitive
to environmental stresses, the results of the rpoS plaque
assay suggest that S. flexneri does not experience extreme
acid or oxidative stress during invasion, growth in the intracellular
environment, or intercellular spread in cultured cells. Thus, the
sensitivity of the dksA mutant to environmental stress, even
in an RpoS-independent pathway, is not responsible for the inability of
the mutant to spread intercellularly. These results are supported by
experiments in which we were able to isolate viable dksA
mutant bacteria from infected Henle cells (data not shown).
The dksA mutant, like wild-type Shigella, was
able to lyse the phagocytic vacuole and is capable of dividing in the
intracellular environment. Unlike the wild type, however, the
dksA mutant did not show consistent polar location of IcsA.
IcsA induces the continuous polymerization of F-actin. This process is
responsible for propelling the bacterium into an adjacent epithelial
cell. The mechanics of this type of movement necessitate a single focus
of IcsA to produce unidirectional forces. Therefore, polymerization of
actin around the entire surface or at both poles of the dksA
mutant would prevent net movement of the bacterium in one direction
through the host cell cytoplasm and thus prevent spread into an
adjacent epithelial cell.
The specific mechanism by which DksA affects IcsA localization is
unknown, although it may be related to the effect of the dksA mutation on cell division and filamentation. SopA
(IcsP), which cleaves IcsA on the entire bacterial surface, may play a role in the polar localization of IcsA (7). However, IcsA, when expressed in E. coli in the absence of SopA, exhibited
polar localization (36), indicating that SopA is not
necessary for this process in E. coli. IcsA appears to be
targeted directly to the old pole of the bacterium in an unknown
process in both S. flexneri and E. coli
(39). Here, we have identified DksA as a protein necessary
for this process. The inability of a dksA mutant to
properly localize IcsA likely contributes to the inability of the
dksA mutant to form wild-type plaques on tissue culture monolayers.
 |
ACKNOWLEDGMENTS |
We gratefully acknowledge Elizabeth Wyckoff for her insight
throughout this investigation and for a critical reading of
the manuscript. We thank John Mendenhall and Barbara Goettgens for technical assistance with the confocal laser scanning microscope. Finally, we are very grateful to Edwin Oaks for his generous gift of
polyclonal rabbit anti-IcsA antiserum 35, which contributed significantly to these results.
This study was supported by grant AI16935 from the National Institutes
of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Section of
Molecular Genetics and Microbiology, The University of Texas, Austin,
TX 78712-1095. Phone: (512) 471-9258. Fax: (512) 471-7088. E-mail: payne{at}mail.utexas.edu.
Present address: DoubleTwist Inc., Oakland, CA 94612.
Editor:
A. D. O'Brien
 |
REFERENCES |
| 1.
|
Bearson, S. M. D.,
J. W. H. Benjamin,
W. E. Swords, and J. W. Foster.
1996.
Acid shock induction of RpoS is mediated by the mouse virulence gene mviA of Salmonella typhimurium.
J. Bacteriol.
178:2572-2579[Abstract/Free Full Text].
|
| 2.
|
Bernardini, M. L.,
J. Mounier,
H. d'Hauteville,
M. Coquis-Rondon, and P. J. Sansonetti.
1989.
Identification of icsA, a plasmid locus of Shigella flexneri that governs bacterial intra- and intercellular spread through interaction with F-actin.
Proc. Natl. Acad. Sci. USA
86:3867-3871[Abstract/Free Full Text].
|
| 3.
|
Bohannon, D. E.,
N. Connell,
J. Keener,
A. Tormo,
M. Espinosa-Urgel,
M. M. Zambrano, and R. Kolter.
1991.
Stationary-phase-inducible "gearbox" promoters: differential effects of katF mutations and role of 70.
J. Bacteriol.
173:4482-4492[Abstract/Free Full Text].
|
| 4.
|
Coynault, C.,
V. Robbe-Saule, and F. Norel.
1996.
Virulence and vaccine potential of Salmonella typhimurium mutants deficient in the expression of the RpoS ( S) regulon.
Mol. Microbiol.
22:149-160[Medline].
|
| 5.
|
Doran, T. J.,
S. M. Loh,
N. Firth, and R. A. Skurray.
1994.
Molecular analysis of the F plasmid traVR region: traV encodes a lipoprotein.
J. Bacteriol.
176:4182-4186[Abstract/Free Full Text].
|
| 6.
|
DuPont, H. L.,
M. M. Levine,
R. B. Hornick, and S. B. Formal.
1989.
Inoculum size in shigellosis and implications for expected mode of transmission.
J. Infect. Dis.
159:1126-1128[Medline].
|
| 7.
|
Egile, C.,
H. d'Hauteville,
C. Parsot, and P. J. Sansonetti.
1997.
SopA, the outer membrane protease responsible for polar localization of IcsA in Shigella flexneri.
Mol. Microbiol.
23:1063-1073[CrossRef][Medline].
|
| 8.
|
Eisenstark, A.,
M. J. Calcutt,
M. Becker-Hapak, and A. Ivanova.
1999.
Role of Escherichia coli rpoS and associated genes in defense against oxidative damage.
Free Rad. Biol. Med.
21:975-993.
|
| 9.
|
Fang, R. C.,
S. J. Libby,
N. A. Buchmeier,
P. C. Loewen,
J. Switala,
J. Harwood, and D. G. Guiney.
1992.
The alternative factor KatF (RpoS) regulates Salmonella virulence.
Proc. Natl. Acad. Sci. USA
89:11978-11982[Abstract/Free Full Text].
|
| 10.
|
Fuller, M. E.,
S. H. Streger,
R. K. Rothmel,
B. J. Mailloux,
J. A. Hall,
T. C. Onstott,
J. K. Fredrickson,
D. L. Balkwill, and M. F. DeFlaun.
2000.
Development of a vital fluorescent staining method for monitoring bacterial transport in subsurface environments.
Appl. Environ. Microbiol.
66:4486-4496[Abstract/Free Full Text].
|
| 11.
|
Goldberg, M. B., and J. A. Theriot.
1995.
Shigella flexneri surface protein IcsA is sufficient to direct actin-based motility.
Proc. Natl. Acad. Sci. USA
92:6572-6576[Abstract/Free Full Text].
|
| 12.
|
Gorden, J., and P. L. C. Small.
1993.
Acid resistance in enteric bacteria.
Infect. Immun.
61:364-367.
|
| 13.
|
Hale, T. L.
1991.
Genetic basis of virulence in Shigella species.
Microbiol. Rev.
55:206-224[Abstract/Free Full Text].
|
| 14.
|
Hale, T. L., and S. B. Formal.
1981.
Protein synthesis in HeLa or Henle 407 cells infected with Shigella dysenteriae 1, Shigella flexneri 2a, or Salmonella typhimurium W118.
Infect. Immun.
32:137-144[Abstract/Free Full Text].
|
| 15.
|
Hales, L. M., and H. A. Shuman.
1999.
The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii.
J. Bacteriol.
181:4879-4889[Abstract/Free Full Text].
|
| 16.
|
Headley, V. L., and S. M. Payne.
1990.
Differential protein expression by Shigella flexneri in intracellular and extracellular environments.
Proc. Natl. Acad. Sci. USA
87:4179-4183[Abstract/Free Full Text].
|
| 17.
|
Hengge-Aronis, R.
1996.
Back to log phase: S as a global regulator in the osmotic control of gene expression in Escherichia coli.
Mol. Microbiol.
21:887-893[CrossRef][Medline].
|
| 18.
|
Hengge-Aronis, R.,
R. Lange,
N. Henneberg, and D. Fischer.
1993.
Osmotic regulation of rpoS-dependent genes in Escherichia coli.
J. Bacteriol.
175:259-265[Abstract/Free Full Text].
|
| 19.
|
Hong, M., and S. M. Payne.
1997.
Effect of mutations in Shigella flexneri chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and serum resistance.
Mol. Microbiol.
24:779-791[CrossRef][Medline].
|
| 20.
|
Kang, P. J., and E. A. Craig.
1990.
Identification and characterization of a new Escherichia coli gene that is a dosage-dependent suppressor of a dnaK deletion mutation.
J. Bacteriol.
172:2055-2064[Abstract/Free Full Text].
|
| 21.
|
Krogfelt, K. A.,
M. Hjulgaard,
K. Sorensen,
P. S. Cohen, and M. Givskov.
2000.
rpoS gene function is a disadvantage for Escherichia coli BJ4 during competitive colonization of the mouse large intestine.
Infect. Immun.
68:2518-2524[Abstract/Free Full Text].
|
| 22.
|
LaBrec, E. H.,
H. Schneider,
T. J. Magnani, and S. B. Formal.
1964.
Epithelial cell penetration as an essential step in the pathogenesis of bacillary dysentery.
J. Bacteriol.
88:1503-1518[Abstract/Free Full Text].
|
| 23.
|
Lange, R., and R. Hengge-Aronis.
1991.
Identification of a central regulator of stationary-phase gene expression in Escherichia coli.
Mol. Microbiol.
5:49-59[Medline].
|
| 24.
|
Lee, I. S.,
J. Lin,
H. K. Hall,
B. Bearson, and J. W. Foster.
1995.
The stationary-phase sigma factor S (RpoS) is required for a sustained acid tolerance response in virulent Salmonella typhimurium.
Mol. Microbiol.
17:155-167[Medline].
|
| 25.
|
Lett, M. C.,
C. Sasakawa,
N. Okada,
T. Sakai,
S. Makino,
M. Yamada,
K. Komatsu, and M. Yoshikawa.
1989.
virG, a plasmid-coded virulence gene of Shigella flexneri: identification of the virG protein and determination of the complete coding sequence.
J. Bacteriol.
171:353-359[Abstract/Free Full Text].
|
| 26.
|
Makino, S.,
C. Sasakawa,
K. Kamata,
T. Kurata, and M. Yoshikawa.
1986.
A genetic determinant required for continuous reinfection of adjacent cells on large plasmid in S. flexneri 2a.
Cell
46:551-555[CrossRef][Medline].
|
| 27.
|
Menard, R.,
C. Dehio, and P. J. Sansonetti.
1996.
Bacterial entry into epithelial cells: the paradigm of Shigella.
Trends Microbiol.
4:220-226[CrossRef][Medline].
|
| 28.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
Nhieu, G. T. V., and P. J. Sansonetti.
1999.
Mechanism of Shigella entry into epithelial cells.
Curr. Opin. Microbiol.
2:51-55[CrossRef][Medline].
|
| 30.
|
Nickerson, C. A., and R. Curtiss, III.
1997.
Role of sigma factor RpoS in initial stages of Salmonella typhimurium infection.
Infect. Immun.
65:1814-1823[Abstract].
|
| 31.
|
Oaks, E. V.,
M. E. Wingfield, and S. B. Formal.
1985.
Plaque formation by virulent Shigella flexneri.
Infect. Immun.
48:124-129[Abstract/Free Full Text].
|
| 32.
|
Parish, C. R.
1999.
Fluorescent dyes for lymphocyte migration and proliferation studies.
Immunol. Cell Biol.
77:499-508[CrossRef][Medline].
|
| 33.
|
Payne, S. M., and R. A. Finkelstein.
1977.
Detection and differentiation of iron-responsive avirulent mutants on Congo red agar.
Infect. Immun.
18:94-98[Abstract/Free Full Text].
|
| 34.
|
Payne, S. M.,
D. W. Niesel,
S. S. Peixotto, and K. M. Lawlor.
1983.
Expression of hydroxamate and phenolate siderophores by Shigella flexneri.
J. Bacteriol.
155:949-955[Abstract/Free Full Text].
|
| 35.
|
Price, S. B.,
C.-M. Cheng,
C. W. Kaspar,
J. C. Wright,
F. J. DeGraves,
T. A. Penfound,
M.-P. Castanie-Cornet, and J. W. Foster.
2000.
Role of rpoS in acid resistance and fecal shedding of Escherichia coli O157:H7.
Appl. Environ. Microbiol.
66:632-637[Abstract/Free Full Text].
|
| 36.
|
Sandlin, R. C., and A. T. Maurelli.
1999.
Establishment of unipolar localization of IcsA in Shigella flexneri 2a is not dependent on virulence plasmid determinants.
Infect. Immun.
67:350-356[Abstract/Free Full Text].
|
| 37.
|
Sansonetti, P. J.
1992.
Molecular and cellular biology of Shigella flexneri invasiveness: from cell assay systems to shigellosis.
Curr. Top. Microbiol. Immunol.
180:1-19[Medline].
|
| 38.
|
Small, P.,
D. Blankenhorn,
D. Welty,
E. Zinser, and J. L. Slonczewski.
1994.
Acid and base resistance in Escherichia coli and Shigella flexneri: role of rpoS and growth pH.
J. Bacteriol.
176:1729-1737[Abstract/Free Full Text].
|
| 39.
|
Steinhauer, J.,
R. Agha,
T. Pham,
A. W. Varga, and M. B. Goldberg.
1999.
The unipolar Shigella surface protein IcsA is targeted directly to the bacterial old pole: IcsP cleavage of IcsA occurs over the entire bacterial surface.
Mol. Microbiol.
32:367-377[CrossRef][Medline].
|
| 40.
|
Suh, S.-J.,
L. Silo-Suh,
D. E. Woods,
D. J. Hassett,
S. E. H. West, and D. E. Ohman.
1999.
Effect of rpoS mutation on the stress response and expression of virulence factors in Pseudomonas aeruginosa.
J. Bacteriol.
181:3890-3897[Abstract/Free Full Text].
|
| 41.
|
Turner, A. K.,
M. A. Lovell,
S. D. Hulme,
L. Zhang-Barber, and P. A. Barrow.
1998.
Identification of Salmonella typhimurium genes required for colonization of the chicken alimentary tract and for virulence in newly hatched chicks.
Infect. Immun.
66:2099-2106[Abstract/Free Full Text].
|
| 42.
|
Tuveson, R. W.
1981.
The interaction of a gene (nur) controlling near-UV sensitivity and the polA1 gene in strains of E. coli K12.
Photochem. Photobiol.
33:919-923[Medline].
|
| 43.
|
Tuveson, R. W., and R. B. Jonas.
1979.
Genetic control of near-UV (300-400 nm) sensitivity independent of the recA gene in strains of Escherichia coli K12.
Photochem. Photobiol.
30:667-676[Medline].
|
| 44.
|
van den Bosch, L.,
P. A. Manning, and R. Morona.
1997.
Regulation of O-antigen chain length is required for Shigella flexneri virulence.
Mol. Microbiol.
23:765-775[CrossRef][Medline].
|
| 45.
|
Wang, R. F., and S. R. Kushner.
1991.
Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli.
Gene
100:195-199[CrossRef][Medline].
|
| 46.
|
Waterman, S. R., and P. L. C. Small.
1996.
Identification of S-dependent genes associated with the stationary-phase acid-resistance phenotype of Shigella flexneri.
Mol. Microbiol.
21:925-940[CrossRef][Medline].
|
| 47.
|
Webb, C.,
M. Moreno,
M. Wilmes-Riesenberg,
R. Curtiss III, and J. W. Foster.
1999.
Effects of DksA and ClpP protease on sigma S production and virulence in Salmonella typhimurium.
Mol. Microbiol.
34:112-123[CrossRef][Medline].
|
| 48.
|
Wilmes-Riesenberg, M. R.,
J. W. Foster, and R. Curtiss, III.
1997.
An altered rpoS allele contributes to the avirulence of Salmonella typhimurium LT2.
Infect. Immun.
65:203-210[Abstract].
|
Infection and Immunity, September 2001, p. 5742-5751, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5742-5751.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yun, J., Jeon, B., Barton, Y.-W., Plummer, P., Zhang, Q., Ryu, S.
(2008). Role of the DksA-Like Protein in the Pathogenesis and Diverse Metabolic Activity of Campylobacter jejuni. J. Bacteriol.
190: 4512-4520
[Abstract]
[Full Text]
-
Zeller, T., Moskvin, O. V., Li, K., Klug, G., Gomelsky, M.
(2005). Transcriptome and Physiological Responses to Hydrogen Peroxide of the Facultatively Phototrophic Bacterium Rhodobacter sphaeroides. J. Bacteriol.
187: 7232-7242
[Abstract]
[Full Text]
-
Paul, B. J., Berkmen, M. B., Gourse, R. L.
(2005). From the Cover: DksA potentiates direct activation of amino acid promoters by ppGpp. Proc. Natl. Acad. Sci. USA
102: 7823-7828
[Abstract]
[Full Text]
-
Lucchini, S., Liu, H., Jin, Q., Hinton, J. C. D., Yu, J.
(2005). Transcriptional Adaptation of Shigella flexneri during Infection of Macrophages and Epithelial Cells: Insights into the Strategies of a Cytosolic Bacterial Pathogen. Infect. Immun.
73: 88-102
[Abstract]
[Full Text]
-
Jude, F., Kohler, T., Branny, P., Perron, K., Mayer, M. P., Comte, R., van Delden, C.
(2003). Posttranscriptional Control of Quorum-Sensing-Dependent Virulence Genes by DksA in Pseudomonas aeruginosa. J. Bacteriol.
185: 3558-3566
[Abstract]
[Full Text]
-
Wei, J., Goldberg, M. B., Burland, V., Venkatesan, M. M., Deng, W., Fournier, G., Mayhew, G. F., Plunkett, G. III, Rose, D. J., Darling, A., Mau, B., Perna, N. T., Payne, S. M., Runyen-Janecky, L. J., Zhou, S., Schwartz, D. C., Blattner, F. R.
(2003). Complete Genome Sequence and Comparative Genomics of Shigella flexneri Serotype 2a Strain 2457T. Infect. Immun.
71: 2775-2786
[Abstract]
[Full Text]