Previous Article | Next Article 
Infection and Immunity, September 2001, p. 5857-5863, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5857-5863.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
In Vivo and In Vitro Studies of Cytosolic Phospholipase
A2 Expression in Helicobacter pylori
Infection
Gerardo
Nardone,1,*
Eileen L.
Holicky,2
James R.
Uhl,3
Lina
Sabatino,4
Stefania
Staibano,5
Alba
Rocco,1
Vittorio
Colantuoni,4
Barbara A.
Manzo,6
Marco
Romano,6
Gabriele
Budillon,1
Franklin R.
Cockerill III,3 and
Laurence J.
Miller2
Department of Clinical and Experimental
Medicine,1 Department of Biochemistry and
Biothecnologie,4 and
Department of Biomorphological and Functional Science,
Pathology Unit,5 "Federico II" University of
Naples, and Gastroenterology Unit, Second University
of Naples,6 Naples, Italy, and Center
for Basic Research in Digestive Diseases2
and Department of Laboratory Medicine and
Microbiology,3 Mayo Clinic and Foundation,
Rochester, Minnesota
Received 13 October 2000/Returned for modification 20 February
2001/Accepted 11 June 2001
 |
ABSTRACT |
Modifications of mucosal phospholipids have been detected in
samples from patients with Helicobacter pylori-positive
gastritis. These alterations appear secondary to increased
phospholipase A2 activity (PLA2). The cytosolic
form of this enzyme (cPLA2), normally involved in cellular
signaling and growth, has been implicated in cancer pathogenesis. The
aim of this study was to investigate cPLA2 expression and
PLA2 activity in the gastric mucosae of patients with and
without H. pylori infection. In gastric biopsies from 10 H. pylori-positive patients, cPLA2 levels,
levels of mRNA as determined by reverse transcriptase PCR, levels of
protein as determined by immunohistochemistry, and total
PLA2 activity were higher than in 10 H. pylori-negative gastritis patients. To clarify whether H. pylori had a direct effect on the cellular expression of
cPLA2, we studied cPLA2 expression in vitro
with different human epithelial cell lines, one from a patient with
larynx carcinoma (i.e., HEp-2 cells) and two from patients with gastric
adenocarcinoma (i.e., AGS and MKN 28 cells), incubated with different
H. pylori strains. The levels of cPLA2, mRNA,
and protein expression were unchanged in Hep-2 cells independently of
cellular adhesion or invasion of the bacteria. Moreover, no change in
cPLA2 protein expression was observed in AGS or MKN 28 cells treated with wild-type H. pylori. In conclusion, our
study shows increased cPLA2 expression and PLA2
activity in the gastric mucosae of patients with H. pylori infection and no change in epithelial cell lines exposed to H. pylori.
 |
INTRODUCTION |
Helicobacter pylori
infection of the gastric mucosa is present worldwide and may be
associated with several pathologic alterations, including gastric
cancer (30). The relationship between this organism and
the development of gastric cancer has been postulated mainly on the
basis of epidemiological investigations and animal models of H. pylori infection (13, 15, 17, 21, 39, 40, 53). This
relationship is further supported by the finding that some patients
with H. pylori infection show the genetic abnormalities of
dysplasia and metaplasia in mucosal areas before the development of
carcinoma (35, 50). However, the molecular mechanisms
underlying the multistep process of gastric carcinogenesis related to
H. pylori infection remain undefined (57).
It has been shown that H. pylori damages the gastric barrier
function and induces a dramatic change in mucosal phospholipid composition (34). This is likely due to a local increase
in phospholipase A2 (PLA2) activity (4,
27). The cytosolic form (cPLA2), but not the
secretory form, of this enzyme is involved in cellular signaling and
growth (2, 25, 26, 28, 31, 38, 51) and has recently been
implicated in the pathogenesis of malignant transformation (11,
22, 32, 48, 49, 55, 56). Furthermore, many human tumors have
been reported to exhibit increased synthesis of prostaglandins, the
formation of which is dependent on an increase in cPLA2
activity (16, 18, 19, 29).
In this study, we analyzed cPLA2 expression in
gastric-mucosal biopsies from patients with chronic gastritis, with or
without H. pylori infection. We showed increases in
gastric levels of both cPLA2 mRNA and protein expression
and an increase in PLA2 activity in H. pylori-positive patients with respect to levels in H. pylori-negative patients. However, cPLA2 expression
in a number of epithelial cell lines exposed to a variety of
H. pylori strains remained unchanged.
 |
MATERIALS AND METHODS |
Patients.
Ten H. pylori-positive patients
with duodenal ulcers and 10 H. pylori-negative patients
with chronic gastritis, with ages ranging between 20 and 65 years, were
recruited. Entry criteria were the absence of antisecretory or
antibiotic drug therapy in the previous month, the absence of
anticoagulant drug therapy in the previous week, and the absence of
severe associated diseases (such as hepatic, renal, or cardiovascular
diseases). During upper gastrointestinal endoscopy, each patient had 12 biopsies taken from the gastric antrum. Four biopsies were fixed
immediately in buffered formalin for morphological and
immunohistochemical examinations, four were stored frozen at
20°C
until the time of detection of PLA2 activity, and four were
stored frozen at
80°C until RNA extraction. Serum samples of each
patient were stored frozen until the detection of anti-CagA antibody by
commercial Western blotting (Helico Blot 2.0; Genelabs Diagnostics,
Singapore). H. pylori status was assessed by the
concordance of the results of a breath test and Giemsa staining.
Histopathological diagnosis by hematoxylin and eosin staining was
performed according to the updated Sidney system (12).
Informed consent was obtained from all subjects, and the protocol was
approved by the local ethics committee (University of Naples School of Medicine).
Cell culture.
HEp-2 cells from a patent with human larynx
carcinoma were obtained from the American Type Culture Collection (ATCC
CCL 23) and were grown on tissue culture plasticware in basal Eagle's medium supplemented with Hanks' salts, 50 mM L-glutamine,
0.075% sodium bicarbonate, and 15% fetal bovine serum (FBS; Sigma
Chemical Co., S. Louis, Mo.). The cells were incubated at 37°C in 5%
CO2 and with 99% humidity, as described previously
(54).
Gastric epithelial cells derived from a patient with a poorly
differentiated human gastric adenocarcinoma (i.e., AGS cell
line)
(
3) or from a patient with a well-differentiated human
gastric adenocarcinoma (i.e., MKN 28 cell line) (
44,
45)
were
grown in Dulbecco's modified Eagle's medium (DMEM; Life
Technologies
Inc., Rockville, Md.) supplemented with 10% FBS and 1%
antibiotic-antimycotic
solution (Gibco BRL Laboratories, Grand Island,
N.Y.) at 37°C
in a humidified atmosphere of 5%
CO
2 in
air.
Bacterial infection.
HEp-2 cells were incubated for 3 h
with three different H. pylori strains designated ATCC
51652 (obtained from a patient of the Mayo Clinic with severe active
chronic gastritis and a duodenal ulcer), MC199 (obtained from a patient
of the Mayo Clinic with a large gastric ulcer secondary to a carcinoid
tumor), and MC31 (quality-control strain used for diagnostic testing at
the Mayo Clinic) (54). Cells were also incubated with one
strain of Shigella flexneri (SW1) (obtained from a patient
with clinically invasive disease) and, as a reference, a noninvasive
Escherichia coli strain (ATCC 35218). AGS or MKN 28 cells
were incubated from 3 to 18 h with H. pylori (ATCC
51652). For cocolture experiments, all bacterial strains were grown in
5% CO2 with 99% humidity for 48 h on sheep blood
agar. Just before use, the bacteria were harvested from the agar plate,
washed in Gey's solution, and resuspended at 1.5 × 108 to 3 × 108 cells/ml in
antibiotic-free DMEM supplemented with 10% FBS or Eagle's medium
supplemented with 15% FBS as appropriate.
PLA2 activity.
Total PLA2 activity
was calculated according to the release of arachidonic acid in a
reaction mixture containing [3H]arachidonate-labeled
E. coli membranes (about 30,000 cpm), 40 µmol of
Tris-HCl buffer (pH 7.5), 5 µmol of CaCl2, and 20 µg of gastric-mucosa proteins. The reaction mixture was incubated at 37°C in a shaking water bath for 3 h, and the reaction was
stopped by the addition of methanol-chloroform (2/1, vol/vol). Lipids were extracted according to the Bligh and Dyer procedure
(6) and separated by thin-layer chromatography.
Radiolabeled products were identified with a radioactivity scanner,
scraped off, and counted with a liquid scintillation counter, and their
radioactivities are expressed as percentages of the total radioactivity.
Preliminary experiments with different amounts of proteins, labeled
substrates, and incubation times were performed to set
up
optimal conditions (data not
shown).
RT-PCR of human biopsies.
The gastric biopsy specimens were
homogenized, and total RNA was extracted using TRIzol reagent (Gibco
BRL Laboratories). The quantity and quality of extracted total RNA were
analyzed on denaturing 1% agarose gel. Subsequently, first-strand
complementary DNA was synthesized using 1 µg of RNA and 200 U of
reverse transcriptase (RT) (SuperScript RT; Gibco BRL). The reaction
profile was 37°C for 10 min, followed by 42°C for 60 min. To
control for contamination by genomic DNA, all RNA samples were run in
duplicate with and without the addition of RT. Aliquots of the cDNAs
were PCR coamplified simultaneously with the following specific primers
for cPLA2 and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) as an internal control: for cPLA2,
5' CTCATGCCCAGACCTACGATT 3' (forward) and 5'
TAATACGACTCACTATAGGGCGTCAGGTTTGAC 3' (reverse), and for GAPDH, 5' CACCATCTTCCAGGAGCCAG 3' (forward) and 5'
TCACGCCACAGTTTCCCGGA 3' (reverse).
PCR conditions were as follows: denaturation at 94°C for 1 min,
annealing at 53°C for 1 min, and extension at 72°C for 1 min.
The
reaction proceeded for 32 cycles; the GAPDH primers were added
to the
reaction mixture after 10 cycles. At the end of the process,
a 10-min
extension step was included. The amplification conditions
were
established to obtain the linear reaction necessary for
semiquantitative
analysis. The amplified products were quantified by
densitometric
scanning, and the intensities of cPLA
2 bands
were related to that
of GAPDH in each
sample.
Immunohistochemistry.
For each sample, 4-µm-thick
serial sections from paraffin blocks were cut, dewaxed, and rehydrated.
The endogenous peroxidase was inhibited by incubation with 3%
H2O2 in methanol (20 min at room temperature).
To reduce nonspecific background staining, the slides were incubated
with 5% goat serum (15 min at room temperature). To enhance
immunostaining, sections were treated with an antigen retrieval
solution (10 mM citric acid monohydrate [pH 6.0], adjusted with 2 N
NaOH) and heated three times in a microwave oven at high power for 5 min. Finally, the slides were incubated overnight at 4°C in a moist
chamber with a mouse anti-human cPLA2 monoclonal antibody
(Santa Cruz Biotechnology, Santa Cruz, Calif.; dilution, 1:100). The
avidin-biotin-peroxidase complex procedure (ABC standard; Vector
Laboratories, Burlingame, Calif.) was then performed according to the
method of Hsu et al. (20). Peroxidase activity was
detected with diaminobenzidine as the substrate. Finally, sections were weakly counterstained with Harris' hematoxylin and mounted with a
synthetic medium was used as a coverslip. Two independent
approaches were used to confirm the specificity of the
immunohistochemical signal: (i) serial dilution of the primary antibody
was carried out until the signal disappeared and (ii) nonimmune mouse
immunoglobulin G (IgG) was used instead of primary antibody, which
failed to reveal relevant staining.
A case of colon adenocarcinoma was used as a positive control.
Sections were considered positively stained only when the relevant
cytoplasmic staining for cPLA
2 was
unequivocal.
The degree of immunopositivity was evaluated semiquantitatively. A
total of 400 cells was counted in random fields from representative
areas of the lesions, and the immunoreactive cells were roughly
assessed, expressed as percentages, and scored as follows: when
0 to
5% of cells were reactive, they were considered negative;
when 5 to
25% of cells were reactive, they were considered to
have low
positivity; when 25 to 50% of cells were reactive, they
were
considered to have moderate positivity; and when >50% of
cells were
reactive, they were considered to have high
positivity.
Northern blot analysis from cultured HEp-2 cells.
Total RNA
from either untreated HEp-2 cells or HEp-2 cells treated for 3 h with
three different strains of H. pylori, one strain of S. flexneri, and one strain of E. coli was extracted using
TRIzol reagent. The amount and quality of RNA extracted were evaluated
by ethidium bromide staining after running a denaturing agarose gel.
For each sample, 20 µg of RNA was loaded onto a denaturing 1.2%
agarose gel and subsequently blotted onto a nylon membrane (Hybond;
Amersham). After 4 h of prehybridization, hybridization was carried out
using the radioactively labeled PCR products corresponding to
cPLA2. To normalize the amount of RNA loaded in each lane, the same filter was hybridized with a GAPDH probe, obtained by radioactive labeling of the 360-bp PCR product. The bands obtained by
autoradiography were densitometrically scanned, and the intensities of
the cPLA2 bands were related to that of GAPDH.
Western blot analysis.
HEp-2, AGS, or MKN 28 cells either
not exposed or exposed to bacterial strains were lysed with a modified
radioimmunoprecipitation assay buffer in the presence of protease
inhibitors and freshly prepared phenylmethylsulfonyl fluoride. Protein
concentration was determined by a modified Bradford method (Biorad
assay kit) using bovine serum albumin as the standard. Equivalent
amounts of protein (25 µg) were loaded in each lane and separated by
electrophoresis on sodium dodecyl sulfate-7.5% polyacrylamide
gels. After electrophoresis for 150 min at 94 V, the proteins were
electroblotted to a nitrocellulose membrane at 22 V.
The cPLA protein was identified using a specific mouse anti-human
cPLA
2 monoclonal antibody (diluted 1/1,000; Santa Cruz)
as
the primary antibody and an anti-mouse IgG antibody (diluted
1/5,000)
as the secondary antibody. Visualization was obtained
with an ECL kit
(Amersham Pharmacia
Biotechnology).
Acridine orange internalization assay.
HEp-2 cells were
trypsinized, washed in FBS, and counted. Approximately
106 cells were placed in each well of a Lab-Tek
Permanox chamber slide (Nunc, Inc., Naperville, Ill.) with 100 µl of
BME and incubated overnight to allow cells to attach. One
hundred-microliter aliquots of the bacterial suspension (1.5 × 108 to 3 × 108 cells/ml) were added to
chamber wells of duplicate slides and incubated for 3 h.
After incubation, the chambers were gently washed three times with
Hanks' balanced salt solution (HBSS) to remove any bacteria not
adhering to the HEp-2 cells, and the chambers were thus removed.
Cells on the chamber slides were stained with 0.01% acridine orange in
Gey's solution for 45 s at room temperature and washed
with HBSS.
The cells were then stained with 0.05% crystal violet
in 0.155 M NaCl
for 45 s and washed with HBSS. Crystal violet
does not penetrate
the HEp-2 cells and cannot quench internalized
acridine orange-stained
bacteria. The slides were examined at
a magnification of ×1,000 with
switching between fluorescent and
phase-contrast optics. In each well,
50 HEp-2 cells were examined
to determine the number with visible
adherent and internalized
bacteria.
Northern and Western analyses and an acridine orange internalization
assay were performed in triplicate for each bacterial
isolate, and the
means and standard deviations were
determined.
Statistical analysis.
The unpaired t test was
used to compare RT-PCR levels of cPLA2 and PLA2
activities in H. pylori-positive and H. pylori-negative patients. The differences in the densitometric
values of Northern and Western blot analyses were evaluated by a
one-way analysis of variance test.
 |
RESULTS |
In vivo studies.
The H. pylori-negative
patients had nonactive chronic gastritis; of these, four had mild
or moderate atrophy restricted to the antrum. The H. pylori-positive patients had mild or moderate active gastritis
associated with peptic disease; 6 out of 10 showed mild-to-moderate
atrophy predominantly restricted to the antrum. Positivity for
anti-CagA antibody, detected by serum Western blot analysis, was
present in 7 out of 10 H. pylori-positive patients.
The inflammatory infiltrate consisted of neutrophils and lymphocytes in
H. pylori-positive patients and lymphocytes in
H. pylori-negative
patients.
Semiquantitative RT-PCR was performed by coamplifying cPLA
2
with GAPDH as an internal control. The results of the analysis
of two
bands of 360 and 570 bp, corresponding to GAPDH and cPLA
2,
respectively, are shown at the top of Fig.
1. The intensities
of the bands were
quantified by densitometric scanning, and the
relative ratio of the
intensity of the cPLA
2 band to that of the
GAPDH band was
determined and is reported in the histogram at
the bottom of Fig.
1.
The bands corresponding to cPLA
2 in
H. pylori-positive
patients were two- or threefold more intense than
those in
H. pylori-negative subjects (
P < 0.001).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of cPLA2 determined by RT-PCR
analysis in vivo. Shown is a representative RT-PCR analysis of
cPLA2 performed on gastric-mucosal specimens from patients
with chronic gastritis who were infected (n = 5) and
not infected (n = 5) with H. pylori.
GAPDH expression was used as the internal control. The sizes of the
amplified bands of 570 and 360 bp are indicated at the side. The
histogram at the bottom reports the densitometric values of the
cPLA2/GAPDH ratios grouped by H. pylori
status (unpaired t test, P < 0.001).
|
|
The immunohistochemical expression of cPLA
2 showed a
relevant cytosolic positivity (in the Golgi and cytoplasmic patterns)
that was restricted to epithelial cells only in the samples from
H. pylori-infected patients (Fig.
2);
H. pylori-negative
patients
showed only focal cPLA
2 immunoreactivity in a
Golgi pattern (Fig.
3). No
immunoreactivity for cPLA
2 was observed when nonimmune
mouse IgG was used as the primary antibody (data not shown).

View larger version (126K):
[in this window]
[in a new window]
|
FIG. 2.
Immunohistochemical expression of cPLA2.
Shown is a tissue section from a patient with H. pylori-positive chronic gastritis showing strong, definite
immunostaining for cPLA2 and Golgi and cytoplasmic
patterns, with sporadic membrane reinforcement of the signal (ABC
standard; magnification, ×400).
|
|

View larger version (114K):
[in this window]
[in a new window]
|
FIG. 3.
Immunohistochemical expression of cPLA2.
Shown is a tissue section from a patient with H. pylori-negative chronic gastritis showing only a focal positivity
for cPLA2 in glandular epithelial cells, with a Golgi
distribution pattern (avidin-biotin-peroxidase complex standard;
magnification, ×400).
|
|
Total PLA
2 activity, calculated as a percentage of
arachidonic acid released, was significantly higher in
H. pylori-positive
than in
H. pylori-negative
patients (61.1% ± 7.9% versus 32.9%
± 6.6%
P < 0.001) (Fig.
4).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 4.
PLA2 activity. Total PLA2
activity was calculated as a percentage of the amount of arachidonic
acid released in H. pylori-positive ( , anti-CagA
positive) and H. pylori-negative ( ) patients
(unpaired t test; P < 0.001).
|
|
In vitro studies.
To assess whether H. pylori
directly affected cPLA2 expression under conditions
independent of systemic factors, we used an in vitro system consisting
of HEp-2 cells exposed to different H. pylori strains.
We also used S. flexeneri and E. coli to assess whether any effect on cPLA2 expression was specifically
related to H. pylori. No significant difference in the
level of cPLA2 mRNA expression was found in cells treated
with H. pylori or other bacterial strains with respect
to that in control, untreated cells (Fig.
5). To correlate the steady-state mRNA
levels obtained with the levels of cPLA2 protein
expression, Western blot analysis was performed. As shown in Fig.
6, a band corresponding to a protein with
an apparent molecular mass of 110 kDa was detected. Similarly to the
results with mRNA previously shown, the intensity of this band did not
change, whatever the invasiveness of the bacteria in the coculture
system. To examine adherence and internalization of the bacterial
strains, HEp-2 cells were studied both morphologically and by the
acridine orange assay (54). Three hours after infection, the percentage of HEp-2 cells associated with or invaded by each of the
bacterial strains was determined. The results are shown in Table
1 and indicate that two of the
H. pylori strains (ATCC 51652 and MC199) demonstrated
substantial cellular invasion (98 and 12%, respectively) and
association (100 and 74%, respectively) of HEp-2 cells. H. pylori strain MC31 and S. flexneri strain SW1 adhered
to cells (34 and 24% of cells, respectively) and invaded cells to a
lesser degree (with both strains invading 6% of cells). No adherence
or penetration of HEp-2 cells was observed for the E. coli
strain used (ATCC 35218).

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 5.
cPLA2 mRNA expression in HEp-2 cells in
vitro. Northern blot analysis was carried out on total RNA extracted
from HEp-2 cells either not infected or infected with the various
bacterial strains indicated. The top panel shows a representative
autoradiograph from three experiments, with the bands corresponding to
cPLA2 mRNA (20 µg of RNA was loaded in each lane). The
histogram in the bottom panel reports the means ± standard
deviations of the densitometric values of the cPLA2/GAPDH
ratios obtained from three independent experiments. Hp-MC31,
H. pylori quality-control strain used for diagnostic
testing at the Mayo Clinic; Hp-ATCC 51652, H. pylori
strain obtained from a patient of the Mayo Clinic with severe active
chronic gastritis and a duodenal ulcer; Hp-MC199, H. pylori strain obtained from a patient of the Mayo Clinic with a
large gastric ulcer secondary to a carcinoid tumor;
Shigella-SW1, strain obtained from a patient with clinically
invasive disease; E. coli-ATCC 35218, a noninvasive
bacterium.
|
|

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 6.
Expression of cPLA2 protein in HEp-2 cells
in vitro. Western blot analysis was performed on cell lysates (25 µg)
from HEp-2 cells either mock infected (control) or infected with the
bacterial strains indicated. The top panel shows a representative
autoradiograph from three experiments; the band corresponds to
cPLA2, and the protein migrates with an apparent molecular
mass of 110 kDa. The histogram at the bottom reports the mean ± standard deviation of densitometric values for the cPLA2
bands obtained from three independent experiments. Hp-MC31,
H. pylori quality-control strain used for diagnostic
testing at the Mayo Clinic; Hp-ATCC 51652, H. pylori
strain obtained from a patient of the Mayo Clinic with severe active
chronic gastritis and a duodenal ulcer; Hp-MC199, H. pylori strain obtained from a patient of the Mayo Clinic with a
large gastric ulcer secondary to a carcinoid tumor;
Shigella-SW1, strain obtained from a patient with clinically
invasive disease; E. coli-ATCC 35218, a noninvasive
bacterium.
|
|
To rule out cell line-specific abnormalities, we also studied
the role of
H. pylori in cPLA
2 protein
expression by Western
blot analysis of human gastric epithelial cells
derived from poorly
differentiated (i.e., AGS cells) or
well-differentiated (i.e.,
MKN 28 cells) gastric adenocarcinomas. The
incubation of AGS or
MKN 28 cells with wild-type
H. pylori for up to 18 h did not exert
any significant effect on
cPLA
2 protein expression compared with
that in control
untreated cells (Fig.
7).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Expression of cPLA2 protein in AGS and MKN
28 cells in vitro. Western blot analysis was performed on cell lysates
(25 µg) from AGS and MKN 28 cells incubated for 3, 6, or 18 h
with H. pylori strain ATCC 51652 (obtained from a
patient of the Mayo Clinic with severe active chronic gastritis and a
duodenal ulcer) or with serum-free DMEM supplemented with 10% FBS
(control). A representative autoradiograph from three independent
experiments showing a cPLA2-immunoreactive band with an
apparent molecular mass of 110 kDa is shown.
|
|
 |
DISCUSSION |
PLA2 is an important enzyme and is expressed
in several types of human cells (1, 22, 24, 25, 28, 31,
37). This wide distribution has been correlated with the
important role it plays in several metabolic pathways, particularly the
transduction of cell growth signals (2, 25, 26, 28, 31, 38, 46, 51). The expression of cPLA2 in cells of the
intestinal tract has been thoroughly investigated (23, 36)
and has also been correlated with the development of several
inflammatory diseases (7, 41, 51, 52). Studies with
cellular systems have shown that the increase in cellular eicosanoid
production, promoted by cytokines and agents causing cell damage, is at
least in part due to the activation of cPLA2 and the
elevation of its cellular levels (18, 19, 29). It has also
been found that cPLA2 is a target of antiinflammatory
glucocorticoid drugs that attenuate eicosanoid synthesis in a number of
different cell types (33). Substantial evidence thus
indicates that cPLA2 may be an important component in the
cascade of events leading to the production of the proinflammatory and
injurious mediators of disease states (7, 52). Moreover,
elevated eicosanoid production has been observed in a number of tumor
cells and is likely to contribute to the altered growth conditions
leading to cell transformation (18). In line with this
evidence are the results of studies in which cPLA2 levels
have been correlated with the activation of Ras, a protooncogene with
well-established involvement in tumorigenesis and metastasis in several
animal and human model systems (9, 14, 16). This study was
undertaken to investigate cPLA2 tissue levels and activity
in gastric mucosa infected with H. pylori and to assess
whether any such increase might reflect the invasive nature of the
organism. The results reported in this study show that in human gastric
mucosal biopsies the levels of mRNA and protein expression of
cPLA2 were higher in H. pylori-positive patients than in H. pylori-negative patients (Fig. 1 to
3). Moreover, we found an increase in PLA2 enzymatic
activity in H. pylori-infected gastric mucosa compared
with that in noninfected mucosa (Fig. 4). This is in agreement with a
recent report by Pomorski et al., who found that activation of
cPLA2 was responsible for the increased production of PGE2
and arachidonic acid in AGS cells exposed to H. pylori
in vitro (42).
An increase in the expression of cPLA2 has been described
to occur in a variety of tumors of the gastrointestinal tract
(11, 22, 31, 48, 49, 55, 56). Therefore, our finding
suggests that cPLA2 up-regulation may play a role in the
development of H. pylori-related gastric cancer.
In partial support of this hypothesis, we observed by
immunohistochemistry enhanced cPLA2 positivity in
metaplastic areas of patients with H. pylori-positive
gastritis and in patients with gastric adenocarcinoma (data not shown). To investigate whether up-regulation of cPLA2 expression
was directly related to H. pylori infection and
bacterial invasiveness, we set up an in vitro model system consisting
of HEp-2 cells exposed to H. pylori cell suspensions.
The Hep-2 cell line has been extensively used to assess the effects of
H. pylori in epithelial cells in vitro (43,
54). Using several H. pylori and other bacterial strains with a wide spectrum of invasiveness, we demonstrated cellular
adhesion and invasion. However, we did not detect any change in either
cPLA2 mRNA or protein levels (Fig. 5 to 6), even when
longer incubation times were used. The longer incubation times
frequently resulted in HEp-2 lysis and the lifting of the HEp-2
monolayers (unpublished observation). We therefore conclude that
infection of Hep-2 cells by H. pylori as well as by
other bacterial strains does not promote cPLA2 expression.
To exclude cell line-specific effects, we studied cPLA2
protein expression in AGS or MKN 28 gastric epithelial cells treated with a wild-type H. pylori strain and found no
significant change versus what occurred in control, untreated cells.
Based on these results, we postulate that systemic events specifically
related to H. pylori infection, such as inflammatory
reaction and host immune response, are needed for the up-regulation of
cPLA2 to occur in vivo (5, 8, 10).
The increased cPLA2 activity described by Pomorski et al.
in AGS cells exposed to H. pylori is not in contrast
with the results of our in vitro studies. In fact, an increase in
cPLA2 activity may occur through mechanisms independent of
up-regulation of cPLA2 expression, e.g., in the
intracellular calcium-mediated pathway (25, 28, 47).
In conclusion, our study shows that cPLA2 expression and
PLA2 activity are up-regulated in patients with
H. pylori gastritis. The increase in cPLA2
expression in vivo but not in vitro suggests that systemic events
specifically related to H. pylori infection may play a
role in this up-regulation. We postulate that up-regulation of
cPLA2 might be involved in the cascade of H. pylori-related events implicated in gastric carcinogenesis.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dipartimento di
Medicina Clinica e Sperimentale, Cattedra di Gastroenterologia,
Università degli Studi di Napoli Federico II, Via Pansini 5, 80131 Naples, Italy. Phone: 39 081 7464293. Fax: 39 081 7462751. E-mail: genardo{at}tin.it.
Editor:
B. B. Finlay
 |
REFERENCES |
| 1.
|
Ackermann, E. J.,
E. S. Kempner, and E. A. Dennis.
1994.
Ca2+-independent cytosolic phospholipase A2 from macrophage-like p388D1 cells.
J. Biol. Chem.
269:9227-9233[Abstract/Free Full Text].
|
| 2.
|
Amandi-Burgermeister, E.,
U. Tibes,
B. M. Kaiser,
W. G. Friebe, and W. V. Scheuer.
1997.
Suppression of cytokine synthesis, integrin expression and chronic inflammation by inhibitors of cytosolic phospholipase A2.
Eur. J. Pharmacol.
326:237-250[CrossRef][Medline].
|
| 3.
|
Barranco, S. C.,
C. M. Townsend, Jr.,
C. Casartelli,
B. G. Macik,
N. L. Burger,
W. R. Boerwinkle, and W. K. Gourley.
1983.
Establishment and characterization of an in vitro model system for human adenocarcinoma of the stomach.
Cancer Res.
43:1703-1709[Abstract/Free Full Text].
|
| 4.
|
Berstad, K.,
R. Sjodahl, and A. Berstad.
1994.
Phosholipase A2 activity in gastric juice from patients with active and H. pylori-eradicated healed duodenal ulcer.
Aliment Pharmacol. Ther.
8:175-180[Medline].
|
| 5.
|
Blaser, M. J.
1992.
Hypothesis on the pathogenesis and natural history of Helicobacter pylori-induced inflammation.
Gastroenterology
107:720-727[Medline].
|
| 6.
|
Bligh, E. G., and W. J. Dyer.
1959.
A rapid method of total lipid extraction and purification.
Can. J. Biochem. Physiol.
37:911-917.
|
| 7.
|
Bomalaski, J. S.,
M. Fallon,
R. A. Turner,
S. T. Crooke,
P. C. Meunier, and M. A. Clark.
1990.
Identification and isolation of phospholipase A2 activating protein in human rheumatoid arthritis synovial fluid: induction of eicosanoid synthesis and an inflammatory response in joints injected in vivo.
J. Lab. Clin. Med.
116:814-825[Medline].
|
| 8.
|
Crabtree, J. E.
1996.
Gastric mucosal inflammatory response to Helicobacter pylori.
Aliment Pharmacol. Ther.
10:29-37.
|
| 9.
|
Davis, T. W.,
E. R. Boghaert,
C. J. Guthridge,
M. R. Steiner, and S. G. Zimmer.
1977.
The effect of group II phospholipase A2 on RAS-induced metastasis, p. 9-17.
In
K. V. Honn (ed.), Eicosanoids and other bioactive lipids in cancer, inflammation and radiation injury. Plenum Press, New York, N.Y.
|
| 10.
|
D'Elios, M. M.,
M. Manghetti,
M. De Carli,
F. Costa,
C. T. Baldari,
D. Burroni,
J. L. Telford,
S. Romagnani, and G. Del Prete.
1997.
Th1 effector cells specific for Helicobacter pylori in the gastric antrum of patients with peptic ulcer disease.
J. Immunol.
158:962-967[Abstract].
|
| 11.
|
Dimberg, J.,
A. Samuelsson,
A. Hugander, and P. Soderkvist.
1988.
Gene expression of cyclooxygenase-2, group II and cytosolic phospholipase A2 in human colorectal cancer.
Anticancer Res.
18:3283-3287.
|
| 12.
|
Dixon, M. F.,
R. M. Genta,
J. H. Yardley,
P. Correa, and the participants in the International Workshop on the Histopathology of Gastritis, Houston 1994.
1996.
Classification and grading of gastritis.
Am. J. Surg. Pathol.
20:1161-1118[CrossRef][Medline].
|
| 13.
|
The Eurogast Study Group.
1993.
An international association between Helicobacter pylori infection and gastric cancer.
Lancet
341:1359-1362[CrossRef][Medline].
|
| 14.
|
Field, J. K., and D. A. Spandidos.
1990.
The role of ras and myc oncogenes in human solid tumors and their relevance on diagnosis and prognosis.
Anticancer Res.
10:1-22[Medline]
|
| 15.
|
Forman, D.,
D. G. Newell, and F. Fullerton.
1991.
Association between infection with Helicobacter pylori and risk of gastric cancer: evidence from prospective investigation.
BMJ
302:1302-1305.
|
| 16.
|
Heasly, L. E.,
S. Thaler,
M. Nicks,
B. Price,
K. Skorecki, and R. A. Nemenoff.
1997.
Induction of cytosolic phospholipase A2 by oncogenic ras in human non-small cell lung cancer.
J. Biol. Chem.
272:14501-14504[Abstract/Free Full Text].
|
| 17.
|
Honda, S.,
T. Fujioka,
M. Tokieda,
A. Nishizono, and M. Nasu.
1998.
Development of Helicobacter pylori-induced gastric carcinoma in Mongolian gerbils.
Cancer Res.
58:4255-4259[Abstract/Free Full Text].
|
| 18.
|
Honn, K. V.,
R. S. Bockman, and L. J. Marnett.
1981.
Prostaglandin and cancer: a review of tumor initiation through tumor metastasis.
Prostaglandins
21:833-864[CrossRef][Medline].
|
| 19.
|
Hori, T.,
S. Shibamoto, and M. Hayakawa.
1993.
Stimulation of prostaglandin production by hepatocyte growth factor in human gastric carcinoma cells.
FEBS Lett.
334:331-334[CrossRef][Medline].
|
| 20.
|
Hsu, S. M.,
L. Raine,
L. Faine, and H. Fanger.
1981.
Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase technique: a comparison between ABC and unlabeled antibody (PAP) procedures.
J. Histochem. Cytochem.
29:577-580[Abstract].
|
| 21.
|
International Agency for Research on Cancer Working Group on the Evaluation of Carcinogenic Risks to Humans.
1994.
Helicobacter pylori, p. 177-240.
In
Schistosomes, liver flukes, and Helicobacter pylori: views and expert opinions of an IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. IARC, Lyon, France.
|
| 22.
|
Kiyohara, H.,
H. Egami,
H. Kako,
Y. Shibata,
K. Murata,
S. Ohshima,
K. Sei,
S. Suko,
R. Kurano, and M. Ogawa.
1993.
Immunohistochemical localization of group II phospholipase A2 in human pancreatic carcinomas.
Int. J. Pancreatol.
13:49-57[Medline].
|
| 23.
|
Kiyohara, H.,
H. Egami,
Y. Shibata,
K. Murata,
S. Ohshima, and M. Ogawa.
1992.
Light microscopy immunohistochemical analysis of the distribution of group II phospholipase A2 in human digestive organs.
J. Histochem. Cytochem.
40:1659-1664[Abstract].
|
| 24.
|
Kramer, R. M.,
E. F. Roberts,
J. V. Manetta,
J. R. Sportsman, and J. A. Jakubowski.
1993.
Ca2+-sensitive cytosolic phospholipase A2 (cPLA2) in human platelets.
J. Lipid Mediat.
6:209-216[Medline].
|
| 25.
|
Kramer, R. M., and J. D. Sharp.
1997.
Structure, function and regulation of Ca2+-sensitive cytosolic phopspholipase A2 (cPLA2).
FEBS Lett.
410:49-53[CrossRef][Medline].
|
| 26.
|
Kuwata, H.,
Y. Nakatani,
M. Murakami, and I. Kudo.
1998.
Cytosolic phospholipase A2 is required for cytokine-induced expression of type IIA secretory phospholipase A2 that mediates optimal cyclooxygenase-2-dependent delayed prostaglandin E2 generation in rat 3Y1 fibroblasts.
J. Biol. Chem.
273:1733-1740[Abstract/Free Full Text].
|
| 27.
|
Langton, S. R., and S. D. Cesareo.
1992.
Helicobacter pylori-associated phospholipase A2 activity: a factor in peptic ulcer production?
J. Clin. Pathol.
45:221-224[Abstract/Free Full Text].
|
| 28.
|
Mansbach, C. M., II.
1990.
Phospholipases: old enzymes with new meaning.
Gastroenterology
98:1369-1382[Medline].
|
| 29.
|
Marnett, L. J.
1992.
Aspirin and the potential role of prostaglandins in colon cancer. Perspectives in cancer research.
Cancer Res.
52:5575-5589[Free Full Text].
|
| 30.
|
Marshall, B. J.
1994.
Helicobacter pylori.
Am. J. Gastroenterol.
89:116-128[Medline].
|
| 31.
|
Mukherjee, A. B.,
L. Miele, and N. Pattabiraman.
1994.
Phospholipase A2 enzymes: regulation and physiological role.
Biochem. Pharmacol.
48:1-10[CrossRef][Medline].
|
| 32.
|
Murata, K.,
H. Egami,
H. Kiyohara,
S. Oshima,
T. Kurizaki, and M. Ogawa.
1993.
Expression of group-II phospholipase A2 in malignant and non-malignant human gastric mucosa.
Br. J. Cancer
68:103-111[Medline].
|
| 33.
|
Nakano, T.,
O. Ohara,
H. Teraoka, and H. Arita.
1990.
Glucocorticoids suppress group II phospholipase A2 production by blocking mRNA synthesis and post-transcriptional expression.
J. Biol. Chem.
265:12745-12748[Abstract/Free Full Text].
|
| 34.
|
Nardone, G.,
F. P. D'Armiento,
G. Corso,
P. Coscione, and G. Budillon.
1994.
Lipids of human gastric mucosa: effect of Helicobacter pylori infection and non alcoholic cirrhosis.
Gastroenterology
107:362-368[Medline].
|
| 35.
|
Nardone, G.,
S. Staibano,
A. Rocco,
E. Mezza,
F. P. D'Armiento,
L. Insabato,
A. Coppola,
G. Salvatore,
A. Lucariello,
N. Figura,
G. De Rosa, and G. Budillon.
1999.
Effect of Helicobacter pylori infection and its eradication on cell proliferation, DNA status, and oncogene expression in patients with chronic gastritis.
Gut
44:789-799[Abstract/Free Full Text].
|
| 36.
|
Nevalainen, T.,
J. M. Gronroos, and M. Kallajoki.
1995.
Expression of group II phospholipase A2 in the human gastrointestinal tract.
Lab. Investig.
72:201-208[Medline].
|
| 37.
|
Nevalainen, T. J.,
F. Marki,
P. T. Kortesuo,
M. G. Grutter,
S. Di Marco, and A. Shmitz.
1993.
Synovial type (group II) phospholipase A2 in cartilage.
J. Rheumatol.
20:325-330[Medline].
|
| 38.
|
Nishizuka, Y.
1992.
Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C.
Science
258:607-614[Abstract/Free Full Text].
|
| 39.
|
Nomura, A.,
G. N. Stemmermann,
P. H. Chyou,
I. Kato,
G. Perez-Perez, and M. J. Blaser.
1991.
Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii.
N. Engl. J. Med.
325:1132-1136[Abstract].
|
| 40.
|
Parsonnet, J.,
G. D. Friedman,
N. Oremtreich, and H. Vogelman.
1997.
Risk for gastric cancer in people with CagA positive or CagA negative Helicobacter pylori infection.
Gut
40:297-301[Abstract/Free Full Text].
|
| 41.
|
Peterson, J. W.,
W. D. Dickey,
S. S. Saini,
W. Gourley,
G. R. Klimpel, and A. K. Chopra.
1996.
Phospholipase A2 activating protein and idiopathic inflammatory bowel disease.
Gut
39:698-704[Abstract/Free Full Text].
|
| 42.
|
Pomorski, T.,
T. F. Meyer, and M. Naumann.
2001.
Helicobacter pylori-induced prostaglandin E2 synthesis involves activation of cytosolic phospholipase A2 in epithelial cells.
J. Biol. Chem.
5:804-810.
|
| 43.
|
Ricci, V.,
A. Galmiche,
A. Doye,
V. Necchi,
E. Solcia, and P. Boquet.
2000.
High cell sensitivity to Helicobacter pylori VacA toxin depends on a GPI-anchored protein and is not blocked by inhibition of the clathrin-mediated pathway of endocytosis.
Mol. Biol. Cell
11:3897-3909[Abstract/Free Full Text].
|
| 44.
|
Romano, M.,
M. Razandi,
S. Sekhon,
W. J. Krause, and K. J. Ivey.
1988.
Human cell line for the study of damage to gastric epitelial cells in vitro.
J. Lab. Clin. Med.
111:430-440[Medline].
|
| 45.
|
Romano, M.,
V. Ricci,
A. Memoli,
C. Tuccillo,
A. Di Popolo,
P. Sommi,
A. M. Acquaviva,
C. Del Vecchio Blanco,
C. B. Bruni, and R. Zarrilli.
1998.
Helicobacter pylori up-regulates cyclooxygenase-2 mRNA expression and prostaglandin E2 synthesis in MKN 28 gastric mucosal cells in vitro.
J. Biol. Chem.
273:28560-28563[Abstract/Free Full Text].
|
| 46.
|
Sharp, J. D., and D. White.
1993.
Cytosolic PLA2: mRNA levels and potential for transcriptional regulation.
J. Lipid Mediat.
8:183-189[Medline].
|
| 47.
|
Shier, W. T.
1979.
Activation of high levels of endogenous phospholipase A2 in cultured cells.
Proc. Natl. Acad. Sci. USA
76:195-199[Abstract/Free Full Text].
|
| 48.
|
Soydan, A. S.,
J. D. Gaffen,
P. K. Weech,
N. M. Tremblay,
S. Kargman,
G. O'Neil,
A. Bennett, and I. A. Tavares.
1997.
Cytosolic phospholipase A2, cyclooxygenases and arachidonate in human stomach tumors.
Eur. J. Cancer
33:1508-1512.
|
| 49.
|
Soydan, A. S.,
I. A. Tavares,
P. K. Weech,
N. M. Tremblay, and A. Bennett.
1996.
High molecular weight phospholipase A2 and fatty acid in human colon tumours and associated normal tissue.
Eur. J. Cancer
32A:1781-1787[CrossRef].
|
| 50.
|
Tahara, E.
1993.
Molecular mechanism of stomach carcinogenesis.
J. Cancer Res. Clin. Oncol.
119:265-272[CrossRef][Medline].
|
| 51.
|
Takakuwa, T.,
S. Endo,
K. Inada,
T. Kasai,
Y. Yamada, and M. Ogawa.
1997.
Assessment of inflammatory cytokines, nitrate/nitrite, type II phospholipase A2, and soluble adhesion molecules in systemic inflammatory response syndrome.
Res. Commun. Mol. Pathol. Pharmacol.
98:43-52[Medline].
|
| 52.
|
Vadas, P.,
J. Browning,
J. Edelson, and W. Pruzanski.
1993.
Extracellular phospholipase A2 expression and inflammation: the relationship with associated disease states.
J. Lipid Mediat.
8:1-30[Medline].
|
| 53.
|
Watanabe, T.,
M. Tada,
H. Nagai,
S. Sasaki, and M. Nakao.
1998.
Helicobacter pylori infection induces gastric cancer in Mongolian gerbils.
Gastroenterology
115:642-648[CrossRef][Medline].
|
| 54.
|
Wilkinson, S. M.,
J. R. Uhl,
B. C. Kline, and F. R. Cockerill, III.
1998.
Assessment of invasion frequencies of cultured HEp-2 cells by clinical isolates of Helicobacter pylori using an acridine orange assay.
J. Clin. Pathol.
51:127-133[Abstract].
|
| 55.
|
Yamashita, S.,
M. Ogawa,
T. Abe,
J. Yamashita,
K. Sakamoto,
H. Niwa, and K. Yamamura.
1994.
Group II phospholipase A2 in invasive gastric cancer cell line is induced by interleukin 6.
Biochem. Biophys. Res. Commun.
198:878-884[CrossRef][Medline].
|
| 56.
|
Yamashita, S.,
J. Yamashita,
K. Sakamoto,
K. Inada,
Y. Nakashima,
K. Murata,
T. Saishoji,
K. Nomura, and M. Ogawa.
1993.
Increased expression of membrane-associated phospholipase A shows malignant potential of human breast cancer cells.
Cancer
71:3058-3064[CrossRef][Medline].
|
| 57.
|
Zarrilli, R.,
V. Ricci, and M. Romano.
1999.
Molecular response of gastric epithelial cells to Helicobacter pylori-induced cell damage.
Cell. Microbiol.
1:93-99[CrossRef][Medline].
|
Infection and Immunity, September 2001, p. 5857-5863, Vol. 69, No. 9
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.69.9.5857-5863.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ceponis, P. J. M., McKay, D. M., Menaker, R. J., Galindo-Mata, E., Jones, N. L.
(2003). Helicobacter pylori Infection Interferes with Epithelial Stat6-Mediated Interleukin-4 Signal Transduction Independent of cagA, cagE, or VacA. J. Immunol.
171: 2035-2041
[Abstract]
[Full Text]