Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bohnsack, J. F. Articles by Adderson, E. E. Search for Related Content PubMed PubMed Citation Articles by Bohnsack, J. F. Articles by Adderson, E. E.

 Previous Article  |  Next Article 

Infection and Immunity, January 2002, p. 134-139, Vol. 70, No. 1
0019-9567/01/$04.00+0     DOI: 10.1128/IAI.70.1.134-139.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Long-Range Mapping of the Streptococcus agalactiae Phylogenetic Lineage Restriction Digest Pattern Type III-3 Reveals Clustering of Virulence Genes

John F. Bohnsack,^1* April A. Whiting,¹ Russell D. Bradford,¹ Brenna K. Van Frank,¹ Shinji Takahashi,² and Elisabeth E. Adderson³

Department of Pediatrics, University of Utah Health Sciences Center, Salt Lake City, Utah 84132,¹ Division of Microbiology, Joshi-Eiyoh University, Chiyoda, Sakado, Saitama 350-0288, Japan,² Department of Infectious Diseases, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105³

Received 10 July 2001/ Returned for modification 10 September 2001/ Accepted 18 October 2001

Top Abstract Introduction Materials and Methods Results Discussion References

 
Human isolates of serotype III Streptococcus agalactiae (group B streptococcus [GBS]) can be divided into three separate phylogenetic lineages based on analysis of the restriction digest patterns (RDPs) of chromosomal DNA. Nine DNA sequences that are present in all isolates of the RDP III-3 phylogenetic lineage, but not in the other lineages, were identified by genomic subtractive hybridization. A complete physical map of a III-3 chromosome was constructed. Six of the nine III-3-specific sequences mapped to a 340-kb Sse8387I fragment which contains or is located close to known GBS virulence genes. One of the III-3-specific probes, AW-10, encodes part of GBSi1, a group II intron that is inserted at two sites within the GBS genome. The second chromosomal site for GBSi1 was isolated, sequenced, and mapped to a location near the locus responsible for hemolysin production. These findings suggest that the genetic variation that distinguishes the RDP type III-3 strains from other serotype III strains occurs largely within localized areas of the genome containing known or putative virulence genes.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Streptococcus agalactiae bacteria (group B streptococci [GBS]) are the most common cause of serious bacterial disease in neonates and an important pathogen in pregnant women and adults with underlying illnesses (3). GBS are subclassified into nine serotypes based on the immunologic reactivity of the polysaccharide capsule. Types I, II, III, and V GBS cause the majority of neonatal human GBS diseases (3, 4). Serotype III GBS are of particular importance because these bacteria cause considerable early-onset (within the first week of life) and most late-onset (after the first week of life) disease in human neonates and the vast majority of neonatal GBS meningitis (3).

It was previously reported that serotype III GBS isolates from Tokyo, Japan, and Salt Lake City, Utah, can be subclassified by analysis of HindIII and Sse8387I restriction digest patterns (RDPs) of chromosomal DNA into three major phylogenetic lineages, or RDP types III-1, III-2, and III-3 (21, 22). The overwhelming majority (91%) of invasive isolates from neonates were RDP type III-3, suggesting that these strains are more virulent than the other RDP types (21).

Characterization of the genetic differences between virulent III-3 and less virulent III-2 strains will help us understand the phylogenetic relationships between different GBS strains. We used genomic subtractive hybridization to identify nine short DNA sequences that are found in all III-3 strains, but not in III-2 or III-1 strains, and thus appear to be markers of the RDP type III-3 phylogenetic lineage (5). In the present study, we constructed a physical map of the III-3 GBS chromosome and identified the location of the III-3-specific probes and other previously described GBS genes.

(This work was presented in part at the 14th Lancefield International Symposium on Streptococci and Streptococcal Diseases, 11 to 15 October 1999, Auckland, New Zealand.)

Top Abstract Introduction Materials and Methods Results Discussion References

 
Probes. The details of methods used to generate the III-3-specific probes AA3.8, AA3.14, AA3.16, AA4.1, AA4.13, AW-10, DY-1, DY-3, and DY-11 are described elsewhere (5). Probes from several previously described GBS genes were provided by other investigators (Table 1). Probes for cylA (14, 18), lmb (19), rib (22), and recA (15) were amplified by PCR from genomic DNA of GBS strain 874391. All amplifications were performed in 1x reaction buffer (Qiagen, Valencia, Calif.) containing 0.2 mM deoxynucleoside triphosphates, 3 mM MgCl₂, 5 U of DNA polymerase (Qiagen), and 500 ng of genomic DNA. The following primer pairs were used: for cylA, 5' sense GACATTTTCCACAACGTCC and 3' antisense TCTGATACCAACATCCTTCC; for lmb, 5' sense CCTGATGTGACGCCTAACC and 3' antisense TTTGCCTTGTTCCTGATCC; for rib, 5' sense AGTAGCCTTTGAAACTC and 3' antisense GACTTGCTGATCTTTA; and for recA, 5' sense GAAATTCGGTGATGAACG and 3' antisense GCCTACTTTTTCCCTTAGC. PCR conditions consisted of denaturation at 94°C for 1 min (lmb and cylA) or 30 s (rib and recA); annealing at 57°C for 1 min (cylA), 59°C for 1 min (lmb), or 51°C for 30 s (rib and recA); and extension at 72°C for 1 min. A GBS RDP type III-3 874391 genomic DNA library was constructed in Lambda ZAP phage (Stratagene) according to the manufacturer’s protocol. Anonymous probes were generated by mass excision of this library with ExAssist helper phage (Stratagene) to generate subclones in pBluescript SK(-) vectors. Fifty-nine anonymous probes were randomly selected from the library for use in the mapping experiments. One of the anonymous probes was homologous to rrs, which encodes 16S rRNA.

View this table: [in this window] [in a new window]

TABLE 1. Probes used in long-range mapping

PFGE. A physical map of the chromosome from III-3 GBS strain 874391 was generated by Southern blotting of restriction fragments separated by pulsed-field gel electrophoresis (PFGE). DNA was prepared and digested with SmaI, Sse8387I, EagI, SgrAI, BamHI, SalI, or SstI, and restriction fragments were separated by PFGE as previously described (22). Restriction fragments were transferred to membranes and hybridized with [³²P]dCTP-labeled DNA probes using standard techniques (2).

Isolation of the AW-10 genomic clone. A GBS RDP type III-3 874391 genomic DNA library was constructed in Lambda FIX II phage (Stratagene) according to the manufacturer’s protocol. Plaques that hybridized with the AW-10 sequence tag were purified. Two HindIII fragments of the AW-10 phage DNA clone, approximately 4 and 5 kb in size, were subcloned and sequenced by chromosome walking.

Nucleotide sequence accession number. The sequence of the AW-10 genomic clone is available from GenBank under accession no. AF380672.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Restriction fragments used to generate the physical map. The genome of GBS strain 874391 was digested with Sse8387I, SmaI, and EagI in order to construct a physical map of the III-3 GBS strain 874391 genome (Fig. 1). Complete digestion with Sse8387I produced nine fragments of 374, 340, 318, 289, 220 (two fragments), 194, 162, and 48.5 kb, as previously reported (Table 2) (21). Digestion with EagI produced 16 fragments, and SmaI produced 13 fragments (Table 2). Smaller fragments than those shown in Table 2 may have been generated but were not systematically identified. The sum of the fragments ranged from 1,996 kb for the EagI fragments to 2,174 kb for the Sse 8387I fragments, a genome size consistent with that previously reported by Dmitriev et al. (7).

View larger version (31K): [in this window] [in a new window]

FIG. 1. Physical and genetic map of the RDP type III-3 GBS isolate 874391. The sizes of the restriction fragments are shown. The hatched areas represent areas of the genome that contain additional restriction fragments not definitively mapped, including the area containing the six 16S rRNA operons. See text for details.

View this table: [in this window] [in a new window]

TABLE 2. Restriction fragments of GBS 874391 chromosome

Physical mapping of known GBS genes. Partial digestion with Sse8387I resulted in larger bands comprised of two or more Sse8387I fragments, enabling most segments to be definitively aligned. The rrs probe mapped to three separate Sse8387I fragments, six SmaI fragments, at least three EagI fragments, and six SgrAI fragments (the only other SgrAI fragment was approximately 1,700 bp; Table 2). Two probes were used to identify the location of the cps locus. One gene, cpsF, maps to a 15-kb SmaI fragment, while the other gene, cpsA, maps to the same 460-kb SmaI fragment to which hylB, scpB, and lmb hybridize (Fig. 1). This 460-kb SmaI fragment is therefore adjacent to the 15-kb SmaI fragment. The 140-kb EagI fragment, which contains hylB, scpB, and lmb, is next to the cps locus since hylB hybridizes to the 480-kb Sse8387I fragment, which also hybridizes with the cps genes (Fig. 2). The cylA and rib genes and the csp and recA genes mapped to two distinct areas of the genome, both removed from the cps locus (Fig. 2).

View larger version (11K): [in this window] [in a new window]

FIG. 2. Map of the AW-10 genomic clone. The arrowheads indicate the positions of HindIII restriction sites. The putative insertion site for the GBSi1 group II intron, consisting of an inverted repeat and poly(T) tail, is shown.

Mapping of the III-3 specific sequences. Southern hybridization demonstrated that the 874391 genome contains single copies of each of the III-3-specific probes except AW-10, which maps to two separate areas of the chromosome (Fig. 2). The nine III-3-specific probes mapped to three distinct areas of the chromosome. AA 4.13 and AA 3.14 mapped to a 400-kb EagI fragment which also hybridizes with the csp gene. This 400-kb fragment is juxtaposed to the region containing the rRNA operons. AA 4.1 maps to a 374-kb Sse8387I fragment proximal to the cyl locus and to the rib gene. The remaining III-3-specific probes DY-1, DY-3, AA 3.8, AA 3.16, and DY-11 and one copy of AW-10 hybridize with the 450-kb SmaI fragment that is adjacent to the cps locus. AW-10 and DY-3 hybridize to the 140-kb SmaI fragment that contains scpB, lmb, and hylB, while DY-11, AA 3.8, and AA 3.16 hybridize to a 98-kb EagI fragment. The 98-kb EagI fragment appears to be in the center of the 460-kb SmaI fragment because all of the sequences hybridizing to the 98-kb EagI fragment also hybridize with the 340-kb Sse8387I fragment, and not with the 440-kb Sse8387I fragment.

Identification of the second GBSi1 locus. The nucleotide sequence of AW-10, which was previously reported to be homologous to a maturase-related protein of Streptococcus pneumoniae (5, 7), is identical at the nucleotide level to GBSi1, the GBS group II intron recently described by Granlund et al. (9). These investigators reported that there are at least two copies of GBSi1 in the GBS chromosome and demonstrated that one copy lies between the scpB and lmb genes, the same site to which AW-10 maps. The other GBSi1 locus was not identified.

A 15-kb genomic DNA clone hybridizing with the AW-10 probe was isolated from a III-3 genomic lambda library, and 4- and 5-kb HindIII fragments hybridizing with the AW-10 probe were subcloned and sequenced. These subclones contain neither lmb nor scpB, demonstrating that this genomic clone contains the hitherto unidentified second GBSi1 locus. The 4-kb clone contained 100 bp of the 5' terminus of GBSi1, while the 5-kb fragment contained 953 bp of the 3' terminus. The intervening 475 bp region of GBSi1 was amplified by PCR using primers from the 4- and 5-kb clones.

The 9,331-bp region of the chromosome comprising the 4- and 5-kb and 475-bp HindIII fragments contains 10 open reading frames (ORFs), one of which is GBSi1 (Fig. 2 and Table 3). Eight ORFs were homologous to hypothetical genes of type M1 Streptococcus pyogenes that are located within 50 kb of each other on the S. pyogenes chromosome (6). Seven of these S. pyogenes ORFs (the homologs of ORFs 2, 3, 4, 6, 7, 8, and 10) are located within a 12-kb interval in the S. pyogenes chromosome (Table 3). Thus, both copies of GBSi1 are found within areas of the GBS genome that share significant homology with that of S. pyogenes. Granlund and coworkers (9) suggested that an inverted repeat and poly(T) sequences upstream of GBSi1 might be the target motif for streptococcal group II introns. Such a motif was also identified in the 4-kb AW-10 genomic clone (Fig. 2).

View this table: [in this window] [in a new window]

TABLE 3. AW-10 genomic clone ORFs and homologies to other bacterial proteins

Fine mapping of III-3-specific probes. Fine mapping of the location of the III-3-specific genomic DNA regions was performed using BamHI, SalI, and SstI digestion of GBS chromosomal DNA, which resulted in fragments between 4 and 140 kb in size. The III-3-specific probes mapped to different BamHI, SalI, or SstI fragments with two exceptions. Fine mapping of sequences found on the 140-kb EagI fragment revealed that DY-3, scpB, lmb, and AW-10 (GBSi1), but not hylB, mapped to the same 25-kb SalI fragment. A 13-kb SstI fragment contains scpB, lmB, and AW-10, but not DY-3, a finding consistent with the known location of GBSi1 between scpB and lmb; these data also imply that GBSi1 is not contained in a larger, contiguous III-3-specific sequence that also contains DY-3. Fine mapping of the sequences on the 98-kb EagI fragment revealed that AA 3.8, AA 3.16, and DY-11 mapped to identical 22-kb BamHI and 40-kb SalI fragments, while DY-1 mapped to distinct 42-kb BamHI, 20-kb SalI, and 15-kb SstI fragments.

Top Abstract Introduction Materials and Methods Results Discussion References

 
We recently used analysis of RDPs of chromosomal DNA to show that serotype III GBS isolates from Salt Lake City, Utah, and Tokyo, Japan, consist of three clonal populations, called RDP III-1, III-2, and III-3. The overwhelming majority of invasive disease in human neonates in this study were caused by III-3 strains (21). These findings are consistent with other reports that demonstrated that serotype III GBS consist of at least three distinct phylogenetic lineages (11, 13, 16, 17, 21, 22). We identified nine III-3-specific DNA sequences by genomic subtractive hybridization of a III-2 strain from a III-3 strain, and showed that these III-3-specific sequences are almost exclusively found in RDP type III-3 GBS, and not in strains from other GBS serotypes (5).

In the studies reported here, a physical and genetic map of the III-3 GBS chromosome was constructed in order to identify the locations of genomic DNA unique to virulent RDP III-3 strains. The resulting map resembles, in some respects, the only previously published map of the type III GBS chromosome, which was constructed by Dmitriev et al. using SmaI and SgrAI digests of serotype 1/6586 (7). In that study, the size of the GBS genome was estimated to be approximately 2,200 kb, similar to our figure of 1,921 to 2,174 kb. As in Dmitriev’s map, SgrAI digestion of strain 874391 identifies six rRNA operons grouped in one area of the chromosome, an organization also shared by a serotype II strain, 78/471 (7). We identified two SmaI fragments of approximately 460 kb and show that scpB maps to one of these fragments. In contrast, the previous map indicated that the scpB probe resided on a 945-kb restriction fragment. The studies reported here also mapped the rib gene, which encodes the Rib protein, a member of the family of alpha-like proteins expressed on many serotype III GBS (12, 20, 23). The location of rib near rrs corresponds to the site to which the alpha protein gene maps in serotype II 78/471 GBS (7), a finding consistent with the assertion made by Lachenauer et al. that members of the alpha protein family are encoded by variant genes at a single location in the GBS genome (12). Other than scpB, rib, and rrs genes, no other probes were used in either Dmitriev’s or our mapping studies, making it difficult to draw further conclusions about the similarity or differences of the chromosomes of these strains.

Six of the nine III-3-specific sequences were located on the same 340-kb Sse8387I fragment as the cps, hylB, scpB, and lmb loci and, therefore, are no further away than 340 kb (and in some cases much closer) from these known or putative virulence genes. One of the III-3-specific sequences, AW-10, is located at a second site on another part of the chromosome within 220 kb of another III-3-specific sequence, AA 4.1, and of genes encoding two other potential virulence factors, hemolysin, and the Rib protein. The remaining two III-3-specific sequences map to a 400-kb EagI fragment in a third part of the chromosome. These data raise the possibility that the genetic differences between the RDP type III-3 phylogenetic lineage and other GBS lineages are limited to relatively circumscribed areas of the bacterial chromosome and that a large part of the genetic differences occur in or near the region that contains scpB, lmb, hylB, and cps.

The presence of a group II intron in GBS was suggested to us by the homology of the III-3-specific AW-10 sequence to a putative maturase-related protein previously identified in S. pneumoniae (1), and confirmed by Granlund’s definitive identification of GBSi1, which contains the AW-10 probe sequence (9). Granlund reported that there are two copies of GBSi1 in the GBS genome and showed that one copy of GBSi1 was inserted between scpB and lmb. The site of the other copy of GBSi1 is characterized in this report. The sequence of the second copy of GBSi1 is virtually identical to the original GBSi1 insertion sequence (9). It is interesting that both GBSi1 introns are found within areas of the genome that are highly conserved between S. pyogenes and S. agalactiae, even though GBSi1 has not yet been identified in S. pyogenes (8).

Granlund et al. also demonstrated that IS1548, an insertion sequence with multiple chromosomal copies in some GBS strains (10), was present between the scpB and lmb genes 88 bp downstream of the GBSi1 insertion site. The authors showed that GBSi1 is present in three of three invasive GBS isolates analyzed and proposed that GBSi1 is a marker for the ET1 GBS phylogenetic lineage, a population of closely related, virulent GBS originally identified by Musser et al. (13). It was previously shown that AW-10 (GBSi1) is a marker for the RDP type III-3 phylogenetic lineage, and it was proposed that the III-3 and ET1 GBS phylogenetic lineages are identical, based on hyaluronate lysase expression, their genetic distance from other GBS, and their propensity to cause invasive disease in human neonates (5). Granlund also proposed that GBSi1 and IS1548 are present in mutually exclusive GBS populations because the two insertion sequences were never shared among 40 GBS isolates of various serotypes that were analyzed (9). Our finding that insertional inactivation of hylB by IS1548 is a marker for RDP type III-2 GBS further supports the assertion that IS1548 and GBSi1 are found in distinct GBS phylogenetic lineages. Further elucidation of the distribution and origin of these two insertional elements could shed light on the evolutionary origin of GBS population structure.

GBS strains from the ET1/III-3 phylogenetic lineage cause the overwhelming majority of neonatal serotype III GBS disease according to some studies and a large proportion of neonatal invasive serotype III disease according to all published studies on the subject (11, 13, 16, 17, 21, 22). We hypothesized that genomic subtractive hybridization would identify genes that contribute to the increased virulence of ET1/III-3 GBS, in addition to defining genetic differences between the serotype III GBS populations. Additional genomic clones that hybridize with the other III-3-specific sequences have been isolated and are being sequenced. We therefore believe that the approach we have taken will identify candidate virulence genes and provide insights into the evolutionary origin of pathogenic GBS populations. Complete delineation of the genetic differences between GBS populations will be greatly facilitated by comparative genomics based on complete GBS genomic sequences and will result in understanding of the genetic basis for the difference in virulence between GBS phylogenetic lineages.

 
This work was supported by USPHS NIH grant RO1 AI 40918 (to J.F.B. and E.E.A.), Cancer Center Support CORE Grant P30 CA 21765 (to E.E.A.), and a grant from the American Lebanese Syrian Associated Charities (to E.E.A.).

E. E. Adderson is an Established Investigator of the American Heart Association.

 
* Corresponding author. Mailing address: Department of Pediatrics, University of Utah Health Sciences Center, 50 North Medical Dr., Salt Lake City, UT 84132. Phone: (801) 581-5319. Fax: (801) 585-9314. E-mail: john.bohnsack{at}hsc.utah.edu.

Editor: V. J. DiRita

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Adderson, E. E., S. Takahashi, R. Bradford, D. Yin, A. Whiting, and J. F. Bohnsack. 2000. Chromosomal mapping of genes unique to the virulent III-3 subtype of type III group B streptococcus, p. 389–392. In D. R. Martin and J. R. Tagg (ed.), Proceedings of the 14th Lancefield International Symposium on Streptococci and Streptococcal Disease, Auckland, New Zealand, 11 to 15 October 1999. Institute of Environmental Science and Research, Porirua, New Zealand.
2
2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl, L. M. Albright, D. M. Coen, and A. Varki. 1994. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
3
3. Baker, C. J. 2000. Group B streptococcal infections, p. 222–237. In D. L. Stevens and E. L. Kaplan (ed.), Streptococcal infections. Clinical aspects, microbiology, and molecular pathogenesis. Oxford University Press, New York, N.Y.
4
4. Blumberg, H. M., D. S. Stephens, M. Modansky, M. Erwin, J. Elliot, R. R. Facklam, A. Schuchat, W. Baughman, and M. M. Farley. 1996. Invasive group B streptococcal disease: the emergence of serotype V. J. Infect. Dis. 173: 365–373.[Medline]
5
5. Bohnsack, J. F., S. Takahashi, S. R. Detrick, L. R. Pelinka, L. L. Hammitt, A. A. Aly, A. A. Whiting, and E. E. Adderson. 2001. Phylogenetic classification of serotype III group B streptococci based on hylB gene analysis and DNA sequences specific to RDP type III. J. Infect. Dis. 183: 1694–1697.[CrossRef][Medline]
6
6. Coffey, T. J., M. C. Enright, M. Daniels, J. K. Morona, R. Morona, W. Hryniewicz, J. C. Paton, and B. G. Spratt. 1998. Recombinational exchanges at the capsular polysaccharide biosynthetic locus lead to frequent serotype changes among natural isolates of Streptococcus pneumoniae. Mol. Microbiol. 27: 73.[CrossRef][Medline]
7
7. Dmitriev, A., A. Suvorov, and A. Totolian. 1998. Physical and genetic chromosomal maps of Streptococcus agalactiae, serotypes II and III; rRNa operon organization. FEMS Microbiol. Lett. 167: 33–39.[CrossRef][Medline]
8
8. Ferretti, J., W. McShan, D. Ajdic, D. Savic, G. Savic, K. Lyon, C. Primeaux, S. Sezate, A. Suvorov, S. Kenton, H. Lai, S. Lin, Y. Qian, H. Jia, F. Najar, Q. Ren, H. Zhu, L. Song, J. White, X. Yuan, S. Clifton, B. Roe, and R. McLaughlin. 2001. Complete genome sequence of an M1 strain of Streptococcus pyogenes. Proc. Natl. Acad. Sci. USA 98: 4658–4663.[Abstract/Free Full Text]
9
9. Granlund, M., F. Michel, and M. Norgren. 2001. Mutually exclusive distribution of IS1548 and GBSi1, an active group II intron identified in human isolates of group B streptococci. J. Bacteriol. 183: 2560–2569.[Abstract/Free Full Text]
10
10. Granlund, M., L. Oberg, M. Sellin, and M. Norgren. 1998. Identification of a novel insertion element, IS1548, in group B streptococci, predominantly in strains causing endocarditis. J. Infect. Dis. 177: 967–976.[Medline]
11
11. Hauge, M., C. Jespersgaard, K. Poulsen, and M. Kilian. 1996. Population structure of Streptococcus agalactiae reveals an association between specific evolutionary lineages and putative virulence factors but not disease. Infect. Immun. 64: 919–925.[Abstract]
12
12. Lachenauer, C., R. Creti, J. Michel, and L. Madoff. 2000. Mosaicism in the alpha-like protein genes of group B streptococci. Proc. Natl. Acad. Sci. USA 97: 9630–9635.[Abstract/Free Full Text]
13
13. Musser, J. M., S. J. Mattingly, R. Quentin, A. Goudeau, and R. K. Selander. 1989. Identification of a high-virulence clone of type III Streptococcus agalactiae (group B Streptococcus) causing invasive neonatal disease. Proc. Natl. Acad. Sci. USA 86: 4731–4735.[Abstract/Free Full Text]
14
14. Pritzlaff, C. A., J. C. W. Chang, S. P. Kuo, G. S. Tamura, C. E. Rubens, and V. Nizet. 2001. Genetic basis for the ß-hemolytic/cytolytic activity of group B Streptococcus. Mol. Microbiol. 39: 236–247.[CrossRef][Medline]
15
15. Puopolo, K., and L. Madoff. 2001. Coordinate expression of the DNA-3-methyladenine glycosylase I gene (tagI), competence-damage inducible protein gene (cinA) and RecA genes in group B Streptococcus. Pediatr. Res. 49: 302A.
16
16. Quentin, R., H. Huet, F. S. Wang, P. Geslin, A. Goudeau, and R. Selander. 1995. Characterization of Streptococcus agalactiae strains by multilocus enzyme genotype and serotype: identification of multiple virulent clone families that cause invasive disease. J. Clin. Microbiol. 33: 2576–2581.[Abstract]
17
17. Rolland, K., C. Marois, V. Siquier, B. Cattier, and R. Quentin. 1999. Genetic features of Streptococcus agalactiae strains causing severe neonatal infections, as revealed by pulsed-field gel electrophoresis and hylB gene analysis. J. Clin. Microbiol. 37: 1892–1898.[Abstract/Free Full Text]
18
18. Spellerberg, B., B. Pohl, G. Haase, S. Martin, J. Weber-Heynemann, and R. Lutticken. 1999. Identification of genetic determinants for the hemolytic activity of Streptococcus agalactiae by ISS1 transposition. J. Bacteriol. 181: 3212–3219.[Abstract/Free Full Text]
19
19. Spellerberg, B., E. Rozdzinksi, S. Martin, J. Weber-Heynemann, N. Schnitzler, R. Lutticken, and A. Podbielski. 1999. Lmb, a protein with similarities to the LraI adhesin family, mediates attachment of Streptococcus agalactiae to human laminin. Infect. Immun. 67: 871–878.[Abstract/Free Full Text]
20
20. Stalhammar-Carlemalm, M., L. Stenberg, and G. Lindahl. 1993. Protein Rib: a novel group G streptococcal cell surface protein that confers protective immunity and is expressed by most strains causing invasive infections. J. Exp. Med. 177: 1593–1603.[Abstract/Free Full Text]
21
21. Takahashi, S., E. E. Adderson, Y. Nagano, N. Nagano, M. R. Briesacher, and J. F. Bohnsack. 1998. Identification of a highly encapsulated, genetically related group of invasive type III GBS. J. Infect. Dis. 177: 1116–1119.[Medline]
22
22. Takahashi, S., Y. Nagano, N. Nagano, K. Fujita, F. Taguchi, and Y. Okuwaki. 1993. Opsonization of group B streptococci and restriction endonuclease digestion patterns of their chromosomal DNA. J. Med. Microbiol. 38: 191–196.[Abstract/Free Full Text]
23
23. Wastfelt, M., M. Stahlhammer, A.-M. Delisse, T. Cabezona, and G. Lindahl. 1996. Identification of a family of streptococcal surface proteins with extremely repetitive structure. J. Biol. Chem. 271: 18892–18897.[Abstract/Free Full Text]

---

Infection and Immunity, January 2002, p. 134-139, Vol. 70, No. 1
0019-9567/01/$04.00+0     DOI: 10.1128/IAI.70.1.134-139.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Seifert, K. N., Adderson, E. E., Whiting, A. A., Bohnsack, J. F., Crowley, P. J., Brady, L. J. (2006). A unique serine-rich repeat protein (Srr-2) and novel surface antigen ({varepsilon}) associated with a virulent lineage of serotype III Streptococcus agalactiae.. Microbiology 152: 1029-1040 [Abstract] [Full Text]  
• Lindahl, G., Stalhammar-Carlemalm, M., Areschoug, T. (2005). Surface Proteins of Streptococcus agalactiae and Related Proteins in Other Bacterial Pathogens. Clin. Microbiol. Rev. 18: 102-127 [Abstract] [Full Text]  
• Fleming, K. E., Bohnsack, J. F., Palacios, G. C., Takahashi, S., Adderson, E. E. (2004). Equivalence of high-virulence clonotypes of serotype III group B Streptococcus agalactiae (GBS). J Med Microbiol 53: 505-508 [Abstract] [Full Text]  
• Adderson, E. E., Takahashi, S., Wang, Y., Armstrong, J., Miller, D. V., Bohnsack, J. F. (2003). Subtractive Hybridization Identifies a Novel Predicted Protein Mediating Epithelial Cell Invasion by Virulent Serotype III Group B Streptococcus agalactiae. Infect. Immun. 71: 6857-6863 [Abstract] [Full Text]  
• Jones, N., Bohnsack, J. F., Takahashi, S., Oliver, K. A., Chan, M.-S., Kunst, F., Glaser, P., Rusniok, C., Crook, D. W. M., Harding, R. M., Bisharat, N., Spratt, B. G. (2003). Multilocus Sequence Typing System for Group B Streptococcus. J. Clin. Microbiol. 41: 2530-2536 [Abstract] [Full Text]  
• von Both, U., Ruess, M., Mueller, U., Fluegge, K., Sander, A., Berner, R. (2003). A Serotype V Clone Is Predominant among Erythromycin-Resistant Streptococcus agalactiae Isolates in a Southwestern Region of Germany. J. Clin. Microbiol. 41: 2166-2169 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bohnsack, J. F. Articles by Adderson, E. E. Search for Related Content PubMed PubMed Citation Articles by Bohnsack, J. F. Articles by Adderson, E. E.