![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Infection and Immunity, January 2002, p. 380-388, Vol. 70, No. 1
0019-9567/01/$04.00+0 DOI: 10.1128/IAI.70.1.380-388.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Department of Diagnostic Medicine/Pathobiology, College of Veterinary Medicine,1 Division of Biology, College of Arts and Sciences, Kansas State University, Manhattan, Kansas 665062
Received 5 September 2001/ Accepted 3 October 2001
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
30 days. In the absence of MHC-II alleles, E. chaffeensis infections persisted throughout the entire 3-month evaluation period. Together, these data suggest that macrophage activation and cell-mediated immunity, orchestrated by CD4+ T cells, are critical for conferring resistance to E. chaffeensis. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Members of the class Ehrlichiales, including E. chaffeensis, persist in their vertebrate hosts for long periods of time, despite active host immune responses (1, 18, 45, 66). The relationship between E. chaffeensis and its targeted host cells, macrophages and monocytes, is critical because contrary to their natural function, these cells fail to clear E. chaffeensis, allowing them to establish persistence by undefined evasion mechanisms. Thus, studies to determine host immune responses to E. chaffeensis in an experimental host are useful to understand the immune evasion strategies used by this and other rickettsiales and by other macrophage-tropic pathogens.
The mouse has been utilized to determine the impact of the host response on resistance to E. chaffeensis infections (55, 62, 63). Wild-type immunocompetent mice clear infections in 16 days (62), while the absence of the macrophage-regulating tlr4 gene results in persistence of up to 28 days (55). E. chaffeensis infections in severely immunocompromised SCID mice (deficient for T and B cells) results in severe multiorgan infections, and the infected animals become moribund around 24 days postinfection (62). The role of T cells for conferring protective immunity to Cowdria ruminantium, a closely related pathogen of E. chaffeensis, has been reported recently (10). An important role for T cells also is implicated by the T-cell response against a major surface protein of the genogroup II Ehrlichia, Anaplasma marginale (9).
Because macrophages and T cells appear important in the control of this macrophage-tropic rickettsia, we proposed the hypothesis that gene disruptions in important macrophage and T-cell regulatory genes would impact the course of E. chaffeensis infection. We tested the hypothesis by following the course of infection and measuring several immunological and pathological responses in mice with genetic backgrounds ranging from wild type to mutants for tlr4 and major histomcompatibility complex class II (MHC-II) genes that impact macrophage and T-cell function. The tlr4 gene product, responsible for the stimulatory effects of gram-negative bacterial lipopolysaccharide (LPS), is an important regulator of macrophage responsiveness (58). The MHC-II gene complex encodes heterodimeric molecules that bind antigenic peptides for presentation to T cells and serve as the signal transduction molecules to regulate macrophage function (26, 27, 38, 39, 41, 56). The expression of the MHC-II molecules is also necessary for the T-cell maturation to CD4+ T cells (25).
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(ii) Mice used for analysis of MHC-II impact. The C2D mouse (B6.129-Abbtm1 N5F20) has the MHC-II genes deleted (25). It has been backcrossed five times at Taconic to the B6 (C57BL/6) mouse background. The C2D mouse has been brother-sister mated for more than 20 generations over the last 8 years at Kansas State University (KSU). Because the B6 mouse strain is the only inbred strain that the C2D mice have been backcrossed to, this incipient congenic mouse pair is routinely used for congenic comparisons to determine the impact of MHC-II genes (5, 57).
The recently created hybrid mouse strain FeJ x C2D also carries mutations for MHC-II genes (MHC-II-/-), while the HeJ x C2D strain is a mutant for both tlr4 and MHC-II genes (12, 63). These hybrid mouse strains were included in the study to understand the impact of these genes in outbred populations like humans. All mice were bred in the rodent facility of the Division of Biology, Kansas State University, and housed in isolators under specific-pathogen-free conditions. Recombinant breeder mice were treated with sulfamethoxazole and trimethoprim (Sulfatrim, 1 ml/100 ml of H2O) for 1 week once per month to inhibit infections. Weaned mice did not receive antibiotics. All mouse experiments were approved by the institutional animal care and use committee.
E. chaffeensis mouse infections.
E. chaffeensis Arkansas (14) isolates obtained from the Centers for Disease Control and Prevention (CDC&P), Atlanta, Ga., were cultivated in DH82 cells as described previously (13, 54). Cultured bacteria from T75 flasks were harvested (13) when 80 to 100% of the confluent DH82 cells were infected. The cell suspension was diluted 1:1 in phosphate-buffered saline (PBS), and 0.5 ml of the suspension (
5 x 106 cells) was injected intraperitoneally (i.p.) per mouse as described previously (61). Control mice received 0.5-ml i.p. injections containing uninfected DH82 cell suspension. E. chaffeensis-infected mice and control mice were sacrificed and evaluated on days 3, 8, 16, 23, 30, 50, and 92 postinfection.
Blood collection.
Mice were anesthetized i.p. with ketamine (80 mg/kg of body weight) and xylazine (10 mg/kg). Blood was collected from the retro-orbital sinus using a Pasteur pipet containing approximately 25 µl of 14% EDTA. Collected blood (300 µl per mouse) was transferred to microcentrifuge tubes containing 50 µl of 14% EDTA and stored at 4°C. Within 2 to 4 h after collection, blood samples were centrifuged at 3,000 x g and plasma was collected and stored at -70°C. Plasma samples were assayed for the presence of E. chaffeensis-specific immunoglobulin G (IgG) antibodies and selected cytokines.
Peritoneal macrophage collection. Peritoneal cells containing predominantly macrophages were collected from infected and control mice by peritoneal lavage with 20 ml of ice-cold, sterile PBS. Approximately 2 x 107 cells per sample were seeded into wells of 24-well culture plates in 2-ml volumes. Cells were incubated for 18 h, culture supernatants were collected, and cell supernatant was stored at -20°C until cytokine assays were performed. Two milliliters of peritoneal exudate cells was also used to determine the presence of viable rickettsiae in infected and control mice by in vitro culture assay (described below).
Culture isolation of E. chaffeensis from peritoneal cells of infected mice. Cells from 2 ml of peritoneal exudate were harvested by centrifugation at 3,000 x g for 5 min in a SERO-FUGE centrifuge (Becton Dickinson, Franklin Lakes, N.J.). The cell pellet was resuspended in 1 ml of culture medium containing DH82 cells, transferred to 24-well, sterile culture plates, and incubated with 5% CO2 at 37°C under humidified conditions. Cultures were monitored for growth every three to four days until the recovery of viable organisms, or up to 8 weeks. Monitoring was done by light-microscopic examination of culture fluid transferred onto a Cytospin slide (Shadon Southern Products Ltd., Chessire, England) stained with Hema 3 stain (Biochemical sciences, Inc., Swedesboro, N.J.). Detection of viable rickettsiae by culture usually required a two week incubation period. Culture positives were verified by PCR assay (described below) using the genomic DNA isolated from the cultured organisms. All culture-negative samples were monitored for up to 8 weeks before being classified as negatives.
Genomic DNA isolation and E. chaffeensis rRNA gene-specific PCR.
Genomic DNA from liver and spleen tissue samples was extracted by the sodium dodecyl sulfate-proteinase K-phenol-chloroform-isoamyl alcohol method (37). PCR assay was performed using 1 µg of genomic DNA and E. chaffeensis rRNA gene-specific primer pair (E. chaffeensis species-specific forward primer, RRG3: 5'CAATTGCTTATAACCTTTTGGTTATAAAT; Ehrlichia genus-specific reverse primer, RRG2: 5'CTATAGGTACCGTCATTATCTTCCC). The primers were designed based on the published sequence available in the GenBank (under accession no. U60476). Amplicons of 0.39 kb were identified by hybridization with an rRNA gene-specific probe. The hybridization step was included to rule out the false positives resulting from nonspecifically amplified, predicted size products. DNA isolation and PCR setup were performed in a DNA isolation laboratory, while PCRs and the product analyses were done in a separate, PCR analysis laboratory. PCRs were prepared in a Clean Spot PCR UV work station (Coy Laboratory Products, Grass Lake, Mich.). A master mix containing all PCR ingredients except Taq DNA polymerase and DNA template was prepared, divided into multiple aliquots, and stored at -20°C for use in the assays. PCRs were performed after adding Taq DNA polymerase (Applied Biosystems, Foster City, Calif.) to freshly thawed aliquots. All PCR assays included a negative control containing no template DNA and a positive control containing purified, culture-derived E. chaffeensis genomic DNA. PCR cycles were performed in a GenAmp9700 (Applied Biosystems) using one initial denaturing cycle of 94°C for 4 min followed by 35 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min and one cycle of 72°C for 5 min. PCR products were stored briefly at 4°C and transferred to -20°C until use. Twenty percent of the PCR products were resolved on a 1.5% agarose gel, transferred to a nylon membrane, and hybridized with a random primer 32P-labeled ribosomal DNA probe generated from culture-derived E. chaffeensis DNA. The conditions for hybridization and washes were as previously described (47). Kodak X-Omat film was exposed to the hybridized membranes for 2 to 3 h at -70°C. Whenever a strong hybridization signal was noted, the data were verified by exposing the blot for shorter exposure times.
Histopathology and immunohistochemistry. Liver and spleen samples were collected from infected and control mice and stored at -20°C or used immediately for isolating total genomic DNA. Sections of liver were also placed in formalin or Histochoice for histopathological and immunohistochemical analysis, respectively. Formalin-fixed samples were processed routinely, embedded in paraffin, cut at a 5-µm thickness, and stained with hematoxylin and eosin (H&E). Two cross-sectional areas of liver obtained from each mouse were evaluated for inflammatory foci, and the average of the two slides was used to assign a score for the inflammatory lesion as follows: score 0, no inflammatory foci; score 1, neutrophilic foci associated with rare apoptosis; score 2, 2 to 6 neutrophilic foci with apoptosis; score 3, 6 to 15 foci containing neutrophils with apoptotic hepatocytes; score 4, >15 neutrophilic foci with apoptosis; score 5, 1 to 15 foci of principally epithelioid macrophages with few mononuclear cells and neutrophils; score 6, >15 principally epithelioid macrophages with few mononuclear cells and neutrophils.
Immunohistochemical analysis was performed as described (61) with minor changes. Primary E. chaffeensis-specific antiserum was obtained from an HME patient (courtesy of Chris Paddock, CDC&P). E. chaffeensis-specific antibody-antigen complexes were detected using biotinylated goat anti-human secondary antibodies and avidin-biotin-alkaline phosphatase. Fast Red TR/napthol AS-MX (Sigma Chemical Co., St Louis, Mo.) was used to detect the alkaline phosphatase reaction. Normal human serum was used as the primary antibody for a negative control. Counterstaining of hepatocytes was performed with hematoxylin II.
Western blot analysis.
Plasma from E. chaffeensis-infected and control mice was assayed for the presence of E. chaffeensis 28-kDa outer membrane protein-specific antibody. Antigen for the assay was an expressed copy of the E. chaffeensis Arkansas isolate 28-kDa outer membrane protein (Omp) gene, open reading frame 5 (47) (also known as the Omp-1g [42] or p28-19 [64]). The recombinant antigen was synthesized and purified as previously described (46). The blot assay was performed using the ECL Western blotting system according to manufacturer protocols (Amersham/Pharmacia Biotech Inc., Piscataway, N.J.). Briefly, equal amounts of purified recombinant protein (3 µg/well) were resolved on a sodium dodecyl sulfate-10% polyacrylamide gel (37), transferred to a Hybond-N nitrocellulose membrane and blocked with 5% nonfat dairy milk. Membranes were assembled in a multichannel Western blot apparatus (Immunogenetics, Cambridge, Mass.) and incubated with 1:128-diluted mouse plasma for 2 h at room temperature. Following three washes for 10 min each in Tris-buffered saline solution containing 0.1% Tween 20 at room temperature, blots were incubated with 1:2,000-diluted horseradish peroxidase (HRPO)-conjugated antimouse IgG (Caltag, Burlingame, Calif.). Antigen-antibody complexes were detected by exposing X-ray film (Amersham Hyperfilm) for 2 min using the HRPO chemiluminescent substrate, Luminol (Amersham/Pharmacia Biotech., Inc.).
Quantitative ELISA to measure IgG subclasses. Quantitative enzyme-linked immunosorbent assays (ELISA) were performed to measure the concentrations of E. chaffeensis 28-kDa Omp-specific IgG subclass antibodies by following the protocol described previously (48) with some modifications. Briefly, the 96-well ELISA plates (Dynatech Laboratories, Inc., Chantilly, Va.) were coated with the purified recombinant 28-kDa Omp antigen (46) at a concentration of 20 ng/well using 50 mM sodium carbonate buffer, pH 9.6. One-hundred microliters of each plasma sample diluted 1:64 was added to antigen-coated wells and incubated for 2 h at room temperature. The wells were washed thrice with PBS containing 0.05% Tween 20 (PBST) and incubated with HRPO-conjugated goat anti-mouse IgG subclass antibodies, IgG1, Ig2a, IgG2b, and IgG3 (Caltag), at a dilution of 1:2,000. Unbound secondary antibodies were removed by washing with PBST, and the color was developed using TMB (3,3',5,5'-tetramethyl benzidine) (Calbiochem, San Diego, Calif.) as a substrate. After 10 min of incubation with the substrate, the reaction was stopped by the addition of phosphoric acid to a final concentration of 333 mM, and the color developed was measured by using an ELISA plate reader at 450 nm. For determining the concentrations of IgG subclasses, serial dilutions of purified mouse IgG1, IgG2a, IgG2b, and IgG3 were added to plates coated with anti-mouse immunoglobulins. Color developed from the standards incubated with anti-goat-IgGs and TMB were used to determine concentration of each of the four IgG subclasses by linear regression analysis. All assays, including the serial dilution standards, were performed in triplicate wells and the average values were used for analysis.
Nitric oxide assessment.
As a measure of NO production, we measured peritoneal macrophage secretion of NO2, a stable end product of the NO synthesis pathway (51), by using the Griess reaction (53). The sensitivity of the assay was approximately 200 nM. IL-6 and IL-10 were assayed using a capture ELISA in 96-well polyvinyl chloride plates (11). Tumor necrosis factor alpha (TNF-
) concentrations were determined using TNF--sensitive LM-929 cells as described previously, except MTT was used to quantitate cell death (21).
Statistical analysis. Mann-Whitney U tests and chi-square analyses were done as indicated to determine differences between mouse groups. To determine the impact of individual gene deficiencies, animals with similar MHC-II and tlr4 genotypes were pooled and assessed for differences using nonparametric statistics tests which did not depend on normal distribution of the pooled data. Statistical analyses were performed using the StatMost Statistical Software Package (Data Most, Salt Lake City, Utah).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
The PCR analyses revealed the presence of E. chaffeensis less frequently than the culture recovery of the organism from peritoneal wash cells (comparison of culture and PCR data in Fig. 1). These differences may be explained as a result of lower sensitivity of the detection by PCR assay or may reflect the lower abundance of E. chaffeensis in the liver and spleen compared to the peritoneum. To address this issue, and to verify the results from the culture isolation method, genomic DNA was isolated from peritoneal exudate cells collected 50 and 92 days after infection and was evaluated for the presence of E. chaffeensis by the PCR assay. All samples that were culture positive for rickettsiae were also positive by PCR assay (data not shown), suggesting that the peritoneal cavity had significantly more E. chaffeensis-infected macrophages than the liver or the spleen.
Impact of individual gene mutations on clearance of E. chaffeensis.
The assessment of individual mouse strains implicated an important role for both MHC-II and tlr4 in murine resistance to E. chaffeensis in comparing congenic strains B6 and C2D for the MHC-II gene and FeJ and HeJ or B6 and B10 for the tlr4 gene (Fig. 1). To confirm the impact of individual gene mutations on the clearance of E. chaffeensis, mouse infections were analyzed according to their individual MHC-II or tlr4 genotypes independently of other gene expression (Tables 1 and 2). All mice that carried functional MHC-II alleles cleared E. chaffeensis infections, while the mice lacking functional MHC-II genes had persistent infections throughout the study period (Table 1). Mice carrying mutations only in the tlr4 gene (tlr4d/d) had persistent infections for 30 days and subsequently cleared the infections (Table 2). The presence of functional tlr4 genes also had no influence in overcoming the effects of MHC-II mutation in clearing E. chaffeensis infections (Table 1).
|
|
|
|
Wild-type and tlr4 mutant mice induced IgG response against E. chaffeensis. Previous studies found that antibody has the ability to reduce the rickettsial load but not clear E. chaffeensis infections completely (34, 62). Because our histopathological assessment revealed that all mice, including MHC-II mutants, ameliorated the hepatic infection after 16 days, we assayed for the E. chaffeensis-specific IgG response. IgG antibodies specific for an expressed E. chaffeensis 28-kDa outer membrane protein were detected in plasma from all MHC-II+/+ mice beginning 16 days postinfection (Fig. 4). Plasma samples from all MHC-II-/- mice, independent of the presence or absence of functional tlr4 genes, were negative for IgG. The concentrations of individual IgG subclass antibodies in MHC-II+/+ mice were estimated by quantitative ELISA (Fig. 5). The data for all mice were presented for 16 to 92 days postinfection. In addition, the average values for all postinfection days from 16 to 92 days were presented (Fig. 5). Consistent with the Western blot data, Ehrlichia-specific IgG concentrations were low or undetectable in samples collected at 3 and 7 days postinfection (not shown). Independent of the time after infection or the presence of a functional tlr4 gene, only low levels of IgG1 (5 to 8% of total IgG) were made by any mouse strain. The predominant expression of complement-fixing IgG molecules IgG2a, -2b, and -3 (22, 31) constituted 92 to 95% of the total IgG made.
|
|
were not made in notable concentrations (data not shown).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Persistence of E. chaffeensis for the entire 3-month study period in MHC-II-/- mice suggests that functional MHC-II molecules are essential for clearance of the organisms from the murine host. Consistent with recent reports that passively acquired E. chaffeensis-specific antibodies transiently protect SCID mice from fatal infection (34, 62), our data support the hypothesis that complete suppression of this intracellular rickettsia infection requires the presence of functional CD4+ T cells.
Mice with functional MHC-II genes had predominant expression of IgG2a, -2b, and -3 (92% of total IgG made). These three IgG subclasses are TH1-type, complement-fixing antibodies (22, 31). The fluctuations in the type of IgGs made with time postinfection may have resulted from differences in the gamma interferon (IFN-
) concentrations (49, 50). Because the expansion of IgG2a-, IgG2b-, and IgG3-secreting clones is IFN- dependent (50, 52), a protective immune response against E. chaffeensis may be associated with IFN- secretion and a TH1 type cellular response. This hypothesis is supported by the earlier observation by Barnewall and Rikihisa (4) that the activation with IFN- inhibits monocyte infections with E. chaffeensis in vitro. The lower abundance of IgG1, a TH2 antibody (23), further supports this hypothesis. A recent study of Li et al. (34), using monoclonal IgG2a or IgG3 antibodies specific to the 28-kDa outer membrane protein of E. chaffeensis, reported that the IgG2a subclass has a greater efficacy in rescuing SCID mice from fatal infection than IgG3, suggesting that IgG2a may be a more effective in promoting host resistance. In the present study, we did not detect the differences in the clearance of the organisms relative to IgG subclasses expression in MHC-II+/+ mice.
Our cytokine analysis did not reveal changes in the concentrations of TNF- and IL-10 secreted by macrophages between controls and E. chaffeensis-infected mice, which would be consistent with the previous studies of Lee and Rikihisa (32). Although there are minor fluctuations in the nitric oxide concentrations after E. chaffeensis infection, there is no correlation between NO production and subsequent long-term persistence of infection observed in some mouse strains. This is contrary to the important role NO plays in eliminating other macrophage-tropic pathogens (7, 28, 35). A recent study presented by Banerjee et al. (2) demonstrated a short-term delay in the clearance of the human granulocytic ehrlichiosis (HGE) agent in nitric oxide synthase (NOS2) gene knockout mice. The lowered NO response in tlr4d/d mutant mice may reflect the overall lack of macrophage activation in our mouse strains and may also be consistent with the data for the HGE agent (2). The tlr4d/d mutants ultimately cleared the E. chaffeensis infection, as the NOS2 knockout mice cleared the HGE agent (2), suggesting that NO is one of many possible mediators that macrophages can use to help clear rickettsiae. Banerjee et al. (3) also reported that HGE agent infections repress respiratory burst. Although persistent infection did not inhibit the NO response in our studies, there may be differences in the impact of these rickettsiae on the O2- pathway and the NO pathway. Cell tropism differences between E. chaffeensis and the HGE agent also may explain the contrast between our two studies. These hypotheses remain to be tested. While macrophage activation may contribute to clearance of E. chaffeensis, it alone is not sufficient for the pathogen clearance, and CD4+ T cells appear to be the critical factor. This hypothesis is supported by the fact that all mice having functional tlr4 but lacking MHC-II genes failed to clear the infection.
The hypothesis that an effective cell-mediated immune response is necessary for ehrlichial resistance is also supported by the formation of granulomatous inflammation in the livers of infected mice. Peak inflammation is observed 16 days postinfection, with inflammation decreasing over time. Granulomatous inflammation found in infected mice having functional MHC-II genes is expected as part of a cell-mediated immune response necessary for the clearance of intracellular organisms. However, we did observe a similar inflammation in all mice independent of their MHC-II gene alleles. The response is transient, with a peak inflammation at 16 days after infection. Similar granuloma formation was reported earlier in E. chaffeensis-infected SCID mice that lack both T and B cells (61). Mice in that study became moribund within 24 days postinfection (61). In contrast, MHC-II and tlr4 mutants in our study did not become ill or die. The granuloma formation in MHC-II mutant mice likely consists of macrophages, CD4-negative T cells (such as CD8+ or CD8- natural killer cells), and possibly B cells. Further studies are needed to determine the composition of the infiltrates. The establishment of persistent infections in MHC-II-/- mice suggests that the CD4+ T cells are essential for the complete clearance. However, the decline of liver inflammation and survival despite persistent infection in these mutants suggest that other immune cells and mechanisms also contribute to the host response against E. chaffeensis.
The results from this study support the hypothesis that the macrophage and T-cell regulatory genes impact the course of E. chaffeensis infection. We provided evidence that E. chaffeensis stimulates an effective cell-mediated immune response. The response is associated with B-cell activation leading to the synthesis of a TH1-type IgG response and macrophage activation. tlr4 mutation suppresses the early clearance of the pathogen but does not compromise the subsequent resistence. Likewise, macrophages from E. chaffeensis-infected mice produced high levels of NO, but it was not sufficient for complete rickettsial clearance. Delayed clearance of E. chaffeensis in tlr4 mutants, the rickettsial persistence in MHC-II-/- mice, and the production of a TH1-type, complement-fixing, IgG antibody response suggest that CD4+ T cells orchestrate the complete clearance of E. chaffeensis.
|
ACKNOWLEDGMENTS |
|---|
E. chaffeensis-specific antisera obtained from an HME patient and E. chaffeensis isolates were provided by Christopher Paddock, CDC&P.
|
FOOTNOTES |
|---|
This work is contribution 01-279-5-J of the Agricultural Experimental Station.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
| 1. | Andrew, H. R., and R. A. Norval. 1989. The carrier status of sheep, cattle and African buffalo recovered from heartwater. Vet. Parasitol. 34: 261–266.[CrossRef][Medline] |
| 2. | Banerjee, R., J. Anguita, and E. Fikrig. 2000. Granulocytic ehrlichiosis in mice deficient in phagocyte oxidase or inducible nitric oxide synthase. Infect. Immun. 68: 4361–4362. |
| 3. | Banerjee, R., J. Anguita, D. Roos, and E. Fikrig. 2000. Cutting edge: infection by the agent of human granulocytic ehrlichiosis prevents the respiratory burst by down-regulating gp91phox. J. Immunol. 164: 3946–3949. |
| 4. | Barnewall, R. E., and Y. Rikihisa. 1994. Abrogation of gamma interferon-induced inhibition of Ehrlichia chaffeensis infection in human monocytes with iron-transferrin. Infect. Immun. 62: 4804–4810. |
| 5. | Beharka, A. A., J. W. Armstrong, J. J. Iandolo, and S. K. Chapes. 1994. Binding and activation of major histocompatibility complex class II-deficient macrophages by staphylococcal exotoxins. Infect. Immun. 62: 3907–3915. |
| 6. | Bogdan, C., M. Rollinghoff, and A. Diefenbach. 2000. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Curr. Opin. Immunol. 12: 64–76.[CrossRef][Medline] |
| 7. | Boockvar, K. S., D. L. Granger, R. M. Poston, M. Maybodi, M. K. Washington, J. B. Hibbs, and R. L. Kurlander. 1994. Nitric oxide produced during murine listeriosis is protective. Infect. Immun. 62: 1089–1100. |
| 8. | Breitschwerdt, E. B., B. C. Hegarty, and S. I. Hancock. 1998. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin. Microbiol. 36: 2645–2651. |
| 9. | Brown, W. C., T. C. McGuire, D. Zhu, H. A. Lewin, J. Sosnow, and G. H. Palmer. 2001. Highly conserved regions of the immunodominant major surface protein 2 of the genogroup II ehrlichial pathogen Anaplasma marginale are rich in naturally derived CD4+ T lymphocyte epitopes that elicit strong recall responses. J. Immunol. 166: 1114–1124. |
| 10. | Byrom, B., M. Obwolo, A. F. Barbet, and S. M. Mahan. 2000. A polarized Th1 type immune response to Cowdria ruminantium infection is detected in immune DBA/2 mice. J. Parasitol. 86: 983–992.[CrossRef][Medline] |
| 11. | Chapes, S. K., and A. A. Beharka. 1995. Lipopolysaccharide is required for the lethal effects of enterotoxin B after D-galactosamine sensitization. J. Endotox. Res. 2: 263–271. |
| 12. | Chapes, S. K., D. A. Mosier, A. D. Wright, and M. L. Hart. 2001. MHCII, Tlr4 and Nramp1 genes control host pulmonary resistance against the opportunistic bacterium Pasteurella pneumotropica. J. Leukoc. Biol. 69: 381–386. |
| 13. | Chen, S. M., V. L. Popov, H. M. Feng, and D. H. Walker. 1996. Analysis and ultrastructural localization of Ehrlichia chaffeensis proteins with monoclonal antibodies. Am. J. Trop. Med. Hyg. 54: 405–412. |
| 14. | Dawson, J. E., B. E. Anderson, D. B. Fishbein, C. Y. Sanchez, C. Y. Goldsmith, K. H. Wilson, and C. W. Duntley. 1991. Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis. J. Clin. Microbiol. 29: 2741–2745. |
| 15. | Dawson, J. E., K. L. Biggie, C. K. Warner, K. Cookson, S. Jenkins, J. F. Levine, and J. G. Olson. 1996. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human erlichiosis, in dogs from southeast Virginia. Am. J. Vet. Res. 57: 1175–1179.[Medline] |
| 16. | Dawson, J. E., J. E. Childs, K. L. Biggie, C. Moore, D. Stallknecht, J. Shaddock, J. Bouseman, E. Hofmeister, and J. G. Olson. 1994. White-tailed deer as a potential reservoir of Ehrlichia spp. J. Wildl. Dis. 30: 162–168.[Abstract] |
| 17. | Dugan, V. G., S. E. Little, D. E. Stallknecht, and A. D. Beall. 2000. Natural infection of domestic goats with Ehrlichia chaffeensis. J. Clin. Microbiol. 38: 448–449. |
| 18. | Dumler, J. S., W. L. Sutker, and D. H. Walker. 1993. Persistent infection with Ehrlichia chaffeensis. Clin. Infect. Dis. 17: 903–905.[Medline] |
| 19. | Festing, M. F. W. 1994. Inbred strains of mice (updated 3rd Aug. 1994). Mouse Genome 92(Suppl.): 373–374. |
| 20. | Fishbein, D., L. Sawyer, C. Holland, E. Hayes, W. Okoroanyanwu, B. Williams, R. Sikes, M. Ristic, and J. McDade. 1987. Unexplained febrile illnesses after exposure to ticks: infection with an Ehrlichia?. JAMA 257: 3100–3104.[Abstract] |
| 21. | Fleming, S. D., J. J. Iandolo, and S. K. Chapes. 1991. Murine macrophage activation by staphylococcal exotoxins. Infect. Immun. 59: 4049–4055. |
| 22. | Germann, T., M. Bongartz, H. Dlugonska, H. Hess, E. Schmitt, L. Kolbe, E. Kolsch, F. J. Podlaski, M. K. Gately, and E. Rude. 1995. Interleukin-12 profoundly up-regulates the synthesis of antigen-specific complement-fixing IgG2a, IgG2b and IgG3 antibody subclasses in vivo. Eur. J. Immunol. 25: 823–829.[Medline] |
| 23. | Goldsby, R. A., T. J. Kindt, and B. A. Osborne. 2000. Kuby-immunology. W. H. Freeman and Company, New York, N.Y. |
| 24. | Goodman, S. A., and D. C. Morrison. 1985. Lipopolysaccharide receptors on lymphocytes. I. Lack of immunologic recognition of a putative LPS receptor on LPS-responder lymphocytes by LPS-nonresponder mice. J. Immunol. 135: 1906–1910.[Abstract] |
| 25. | Grusby, M. J., R. S. Johnson, V. E. Papaioannou, and L. H. Glimcher. 1991. Depletion of CD4+ T cells in major histocompatibility complex class II-deficient mice. Science 253: 1417–1420. |
| 26. | Hansen, T. H., B. M. Carreno, and D. H. Sachs. 1993. The major histocompatibility complex, p. 577–628. In W. E. Paul (ed.), Fundamental immunology. Raven Press, New York, N.Y. |
| 27. | Hauschildt, S., W. G. Bessler, and P. Scheipers. 1993. Engagement of major histocompatibility complex class II molecules leads to nitrite production in bone marrow-derived macrophages. Eur. J. Immunol. 23: 2988–2992.[Medline] |
| 28. | Kaushik, R. S., J. E. Uzonna, J. R. Gordon, and H. Tabel. 1999. Innate resistance to Trypanosoma congolense infections: differential production of nitric oxide by macrophages from susceptible BALB/c and resistant C57B1/6 mice. Exp. Parasitol. 92: 131–143.[CrossRef][Medline] |
| 29. | Kocan, A. A., G. C. Levesque, L. C. Whitworth, G. L. Murphy, S. A. Ewing, and R. W. Barker. 2000. Naturally occurring Ehrlichia chaffeensis infection in coyotes from Oklahoma. Emerg. Infect. Dis. 6: 477–480.[Medline] |
| 30. | Kordick, S. K., E. B. Breitschwerdt, B. C. Hegarty, K. L. Southwick, C. M. Colitz, S. I. Hancock, J. M. Bradley, R. Rumbough, J. T. Mcpherson, and J. N. MacCormack. 1999. Coinfection with multiple tick-borne pathogens in a Walker Hound kennel in North Carolina. J. Clin. Microbiol. 37: 2631–2638. |
| 31. | Kuhn, R., K. Rajewsky, and W. Muller. 1991. Generation and analysis of interleukin-4 deficient mice. Science 254: 707–710. |
| 32. | Lee, E. H., and Y. Rikihisa. 1996. Absence of tumor necrosis factor alpha, interleukin-6 (IL-6), and granulocyte-macrophage colony-stimulating factor expression but presence of IL-1ß, IL-8, and IL-10 expression in human monocytes exposed to viable or killed Ehrlichia chaffeensis. Infect. Immun. 64: 4211–4219.[Abstract] |
| 33. | Lei, M. G., and D. C. Morrison. 2000. Differential expression of caveolin-1 in lipopolysaccharide-activated murine macrophages. Infect. Immun. 68: 5084–5089. |
| 34. | Li, J. S., E. Yager, A. Reilly, C. Freeman, G. R. Reddy, A. A. Reilly, F. K. Chu, and G. M. Winslow. 2001. Outer membrane protein specific monoclonal antibodies protect SCID mice from fatal infection by the obligate intracellular bacterial pathogen Ehrlichia chaffeensis. J. Immunol. 166: 1855. |
| 35. | Liew, F. Y., S. Millott, C. Parkinson, R. M. Palmer, and S. Moncada. 1990. Macrophage killing of Leishmania parasite in vivo is mediated by nitric oxide from L-arginine. J. Immunol. 144: 4794–4797.[Abstract] |
| 36. | Maeda, K., N. Markowitz, R. C. Hawley, M. Ristic, D. Cox, and J. E. McDade. 1987. Human infection with Ehrlichia canis, a leukocytic rickettsia. N. Engl. J. Med. 316: 853–856.[Medline] |
| 37. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 38. | Matsuyama, S., Y. Koide, and T. O. Yoshida. 1993. HLA class II molecule-mediated signal transduction mechanism responsible for the expression of interleukin-1 beta and tumor necrosis factor-alpha genes induced by a staphylococcal superantigen. Eur. J. Immunol. 23: 3194–3202.[Medline] |
| 39. | Mehindate, K., R. al-Daccak, F. Damdoumi, and W. Mourad. 1996. Synergistic effect between CD40 and class II signals overcome the requirement for class II dimerization in superantigen-induced cytokine gene expression. Eur. J. Immunol. 26: 2075–2080.[Medline] |
| 40. | Merlin, T., A. Sing, P. J. Nielsen, C. Galanos, and M. A. Freudenberg. 2001. Inherited IL-12 unresponsiveness contributes to the high LPS resistance of the Lps(d) C57BL/10ScCr mouse. J. Immunol. 166: 566–573. |
| 41. | Mourad, W., K. Mehindate, T. J. Schall, and S. R. McColl. 1992. Engagement of major histocompatibility complex class II molecules by superantigen induces inflammatory cytokine gene expression in human rheumatoid fibroblast-like synoviocytes. J. Exp. Med. 175: 613–616. |
| 42. | Ohasi, N., N. Zhi, Y. Zhang, and Y. Rikihisa. 1998. Immunodominant major outer membrane proteins of Ehrlichia chaffeensis are encoded by a polymorphic multigene family. Infect. Immun. 66: 132–139. |
| 43. | Paddock, C. D., D. P. Suchard, K. L. Grumbach, W. K. Hadley, R. L. Kerschmann, N. W. Abbey, J. E. Dawson, B. E. Anderson, K. G. Sims, J. S. Dumler, and B. G. Herndier. 1993. Brief report: fatal seronegative ehrlichiosis in a patient with HIV infection. N. Engl. J. Med. 329: 1164–1167. |
| 44. | Paddock, C. D., J. W. Sumner, G. M. Shore, D. C. Bartley, R. C. Elie, J. G. McQuade, C. R. Martin, C. S. Goldsmith, and J. E. Childs. 1997. Isolation and characterization of Ehrlichia chaffeensis strains from patients with fatal ehrlichiosis. J. Clin. Microbiol. 35: 2496–2502.[Abstract] |
| 45. | Reardon, M. J., and K. R. Pierce. 1981. Acute experimental canine ehrlichiosis: I. Sequential reaction of the hemic and lymphoreticular systems. Vet. Pathol. 18: 48–61.[Abstract] |
| 46. | Reddy, G. R., and C. P. Streck. 1999. Variability in the 28-kDa surface antigen protein multigene locus of isolates of the emerging disease agent Ehrlichia chaffeensis suggests that it plays a role in immune evasion. Mol. Cell Biol. Res. Commun. 1: 167–175.[CrossRef][Medline] |
| 47. | Reddy, G. R., C. R. Sulsona, A. F. Barbet, S. M. Mahan, M. J. Burridge, and A. R. Alleman. 1998. Molecular characterization of a 28 kDa surface antigen gene family of the tribe Ehrlichiae. Biochem. Biophys. Res. Commun. 247: 636–643.[CrossRef][Medline] |
| 48. | Sha, Z., and R. W. Compans. 2000. Induction of CD4+ T-cell-independent immunoglobulin responses by inactivated influenza virus. J. Virol. 74: 4999–5005. |
| 49. | Snapper, C. M., T. M. McIntyre, R. Mandler, L. M. Pecanha, F. D. Finkelman, A. Lees, and J. J. Mond. 1992. Induction of IgG3 secretion by interferon gamma: a model for T cell-independent class switching in response to T cell-independent type 2 antigens. J. Exp. Med. 175: 1367–1371. |
| 50. | Snapper, C. M., and W. E. Paul. 1987. Interferon-gamma and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236: 944–947. |
| 51. | Stamler, J. S., D. J. Singel, and J. Loscalzo. 1992. Biochemistry of nitric oxide and its redox-activated forms. Science 258: 1898–1902. |
| 52. | Stevens, T. L., A. Bossie, V. M. Sanders, R. Fernandez-Botran, R. L. Coffman, T. R. Mosmann, and E. S. Vitetta. 1988. Regulation of antibody isotype secretion by subsets of antigen-specific helper T cells. Nature 334: 255–258.[CrossRef][Medline] |
| 53. | Stuehr, D. J., and C. F. Nathan. 1989. Nitric oxide. A macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. J. Exp. Med. 169: 1543–1555. |
| 54. | Sumner, J. W., J. E. Childs, and C. D. Paddock. 1999. Molecular cloning and characterization of the Ehrlichia chaffeensis variable-length PCR target: an antigen-expressing gene that exhibits interstrain variation. J. Clin. Microbiol. 37: 1447–1453. |
| 55. | Telford, S. R., and J. E. Dawson. 1996. Persistent infection of C3H/HeJ mice by Ehrlichia chaffeensis. Vet. Microbiol. 52: 103–112.[CrossRef][Medline] |
| 56. | Unanue, E. R., and J. C. Cerottini. 1989. Antigen presentation. FASEB J. 3: 2496–2502.[Abstract] |
| 57. | Vallance, B. A., F. Galeazzi, S. M. Collins, and D. P. Snider. 1999. CD4 T cells and major histocompatibility complex class II expression influence worm expulsion and increased intestinal muscle contraction during Trichinella spiralis infection. Infect. Immun. 67: 6090–6097. |
| 58. | Vogel, S. N. 1992. The Lps gene: insights into the genetic and molecular basis of LPS responsiveness and macrophage differentiation, p. 485–513. In B. Beutler (ed.), Tumor necrosis factors: the molecules and their emerging role in medicine. Raven Press, New York, N.Y. |
| 59. | Vogel, S. N., C. T. Hansen, and D. L. Rosenstreich. 1979. Characterization of a congenitally LPS-resistant, athymic mouse strain. J. Immunol. 122: 619–622. |
| 60. | Walker, D. H., and J. S. Dumler. 1997. Human monocytic and granulocytic ehrlichioses. Discovery and diagnosis of emerging tick-borne infections and the critical role of the pathologist. Arch. Pathol. Lab. Med. 121: 785–791.[Medline] |
| 61. | Winslow, G. M., E. Yager, K. Shilo, D. N. Collins, and F. K. Chu. 1998. Infection of the laboratory mouse with the intracellular pathogen Ehrlichia chaffeensis. Infect. Immun. 66: 3892–3899. |
| 62. | Winslow, G. M., E. Yager, K. Shilo, E. Volk, A. Reilly, and F. K. Chu. 2000. Antibody-mediated elimination of the obligate intracellular bacterial pathogen Ehrlichia chaffeensis during active infection. Infect. Immun. 68: 2187–2195. |
| 63. | Wright, A. D., and S. K. Chapes. 1999. LPS sensitivity in recombinant mice lacking functional alleles at MHCII, Lps, and Nramp1 genes. J. Endotoxin Res. 5: 297–305. |
| 64. | Yu, X., J. W. McBride, X. Zhang, and D. H. Walker. 2000. Characterization of the complete transcriptionally active Ehrlichia chaffeensis 28 kDa outer membrane protein multigene family. Gene 248: 59–68.[CrossRef][Medline] |
| 65. | Zaugg, J. L., D. Stiller, M. E. Croan, and S. D. Lincoln. 1986. Transmission of Anaplasma marginale Theiler by males of Dermacentor andersoni Stiles fed on an Idaho field infected, chronic carrier cow. Am. J. Vet. Res. 47: 2269–2271.[Medline] |
This article has been cited by other articles:
