Previous Article | Next Article 
Infection and Immunity, February 2002, p. 1014-1016, Vol. 70, No. 2
0019-9567/01/$04.00+0 DOI: 70.2.1014-1016.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Conformationally Correct Expression of Membrane-Anchored Toxoplasma gondii SAG1 in the Primitive Protozoan Giardia duodenalis
Matthias Marti, Yajie Li,,
Peter Köhler, and Adrian B. Hehl*
Institute of Parasitology, University of Zürich, CH-8057 Zürich, Switzerland
Received 13 August 2001/
Returned for modification 19 September 2001/
Accepted 12 November 2001

ABSTRACT
To explore the possibility of expressing membrane-anchored exodomains
of heterologous surface antigens in
Giardia, a chimeric construct
containing the
Toxoplasma gondii SAG1 gene was made. The
Giardia system is shown here to provide a means of generating correctly
folded chimeric surface proteins in a native and unmodified
form.

INTRODUCTION
SAG1 is the immunodominant surface antigen of
Toxoplasma gondii tachyzoites and has been shown to elicit a protective immune
response against lethal challenge with parasites of the virulent
RH strain in mice and other model animals. During previous development
of SAG1 as a vaccine candidate against toxoplasmosis and a diagnostic
reagent, recombinant forms of SAG1 were produced in a variety
of bacterial or eukaryotic expression systems. Native SAG1 adopts
a specific tertiary structure defined by intramolecular cysteine
bridges that give rise to immunologically relevant conformational
epitopes (
4). Thus, production of correctly folded recombinant
protein in bacterial expression systems has been inherently
difficult. Similarly, illegitimate posttranslational modifications
in the molecule were common when SAG1 was expressed in eukaryotic
systems. The primitive eukaryote
Giardia duodenalis (syn.
G. lamblia and
G. intestinalis) has an efficient protein export
pathway to keep its surface provided with membrane-anchored
variant-specific protein (VSP). Like SAGs and related proteins,
Giardia VSPs contain many cysteine residues, which are likely
to be important for attaining their functional conformation
(
1). Although initial studies have shown that VSPs are posttranslationally
modified (
7,
13), recent data suggest that at least in the case
of VSP-H7, these protein-associated glycans may not be covalently
bound (A. Hülsmeier and P. Köhler, unpublished data),
indicating that posttranslational modification of surface antigens
may be more sparingly used in
Giardia than previously believed.
In the present study, we wanted to test (i) whether an important
T. gondii antigen, SAG1, can be expressed as both a correctly
folded and unmodified membrane protein and (ii) whether this
recombinant protein reacts with antibodies in human patient
sera and could be used as a diagnostic reagent.
A chimeric gene containing targeting sequences for VSP surface expression fused to the SAG1 exodomain (SAG1-VSPct) was constructed for expression in Giardia under the control of a stage-specific inducible promoter. The chimeric SAG1-VSPct cassette was assembled as follows. The cyst wall protein 1 (CWP1) promoter region, including the transcription start site and a hydrophobic leader sequence, was amplified from genomic DNA from Giardia strain WBC6 (ATCC Nr 50803) (16) with primers CWP1-XbaI-s (sense; ATTCTAGACTAGCCACGCATGGGCTGT) and CWP1-nsiI-as (antisense; GTATGCATGACGAGCACCTCCCTCTGA). The SAG1 exodomain was amplified from the plasmid SAG1-GPI (15) with primers SAG1-nsi1-s (sense; GTatgcatCTGAGTAGCCGGGCTATGA) and SAG1-BglII-as (antisense; CATAGATCTAGCCCGGCAAACTCCAGT). The VSPH7 transmembrane domain plus the cytoplasmic pentapeptide was amplified from genomic DNA from Giardia strain H7 (12) (ATCC Nr 50581) with primers H7-BglII-s (sense; CATagatctAATAGCACCGGCGGCGATAGTG) and H7-PacI-as (antisense; GCTTAATTAATCACGCCTTCCCGCGGCAGACGAAC). The complete SAG1-VSPct gene was ligated into the green fluorescent protein (GFP) expression vector C1-GFP (6). The C-terminal portion of SAG1-VSPct consists of the hydrophobic VSP transmembrane anchor and a short cytoplasmic pentapeptide, CRGKA, replacing the original glycosylphosphatidyl inositol anchor signal of SAG1. Parasites of the WB strain were stably transformed with the SAG1-VSPct plasmid, and production of the chimeric protein was induced by encystation as described previously (6). Expression of SAG1-VSPct protein was determined by Western blot analysis of total lysate and indirect immunofluorescence of fixed but intact parasites. For detection of the SAG1 exodomain, a monoclonal antibody (MAb), DG52 (3), and human patient sera, which had been titrated against total membrane proteins of T. gondii tachyzoites of strain RH, were used (F. Grimm, unpublished results). For Western blots, total cell lysates (from 5 x 105 cells/lane; 15 h postencystation) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under nonreducing conditions unless stated otherwise and transferred onto a nitrocellulose membrane. Western blotting of total protein from encysting parasites transformed with the SAG1-VSPct construct and probed with DG52 showed a single band of
28 kDa (Fig. 1).
In contrast, total protein from uninduced trophozoites, the parental WBC6 strain, and encysting WB-SAG1-VSPct parasites separated in the presence of 100 mM dithiothreitol did not react with DG52. Reactivity of MAb DG52 with SAG1-VSPct could be increased >10-fold by treatment of cells with Triton X-100 (data not shown). T. gondii total protein probed with DG52 revealed, in addition to SAG1, several minor bands representing cross-reactions with other members of the SAG family.
To test whether SAG1-VSPct would also be recognized by naturally
occurring antibodies of human toxoplasmosis patients, we performed
Western blot analysis with lysates from transformed
Giardia.
Sera from 12 toxoplasmosis patients with acute (high immunoglobulin
M [IgM], low IgG; e.g., patient 1 in Fig.
1) or chronic (low
IgM, high IgG; e.g., patient 2 in Fig.
1) infections and two
negative control sera were used to examine the extent to which
transgenic parasites were able to present native and conformation-dependent
SAG1 epitopes in addition to the epitope recognized by MAb DG52.
The sera reacted specifically with the nonreduced SAG1-VSPct
product, but, interestingly, failed to recognize any linear
SAG1 epitope in the reduced forms. As shown for two representative
examples in Fig.
1, the serum from acute infection with high
levels of anti-
Toxoplasma IgM and low levels of IgG showed a
weaker signal when detected with anti-IgG secondary antibodies.
Although there was a possibility of interference with detection
of anti-SAG1 antibodies, the polyclonal human sera investigated
here did not evoke additional, strongly cross-reacting bands
when incubated with lysate of transformed
Giardia. In contrast,
they reacted with several higher- and lower-molecular-weight
proteins of
T. gondii tachyzoites in addition to SAG1. Controls
with sera from uninfected human subjects showed no reaction
with either transgenic
Giardia or
T. gondii lysates.
To confirm that the recombinant SAG1-VSPct was not posttranslationally modified by glycosylation, specifically at the single Asn-X-Ser site in SAG1, we performed ECL (enhanced chemiluminescence) glycoprotein detection experiments (Amersham Pharmacia UK, Ltd.), as described previously (7), with lysates from induced and noninduced transgenic Giardia on Western blots. Endogenous VSP bands and a putative GPI-anchored protein (GP49) were detected, but no specific signal at the position of SAG1-VSPct could be seen in lanes with parasite lysates (Fig. 2).
By indirect immunofluorescence with MAb DG52 or the human patient
sera described above, SAG1-VSPct was found associated with the
plasma membrane and flagella (Fig.
3).
In parasites induced
to express SAG1-VSPct, the observed staining pattern was in
accordance with the distribution of the endogenous VSP-H7 in
Giardia strain H7 in immunoelectron microscopy studies (
14)
and immunofluorescence (A. B. Hehl, unpublished observation),
as well as that of VSP TSA417 in strain WB (
5). Surface exposition
of SAG1-VSPct was not found on trophozoites. These results demonstrate
that SAG1-VSPct expressed in
Giardia retains its tight tertiary
structure, exposing immunologically relevant conformational
epitopes.
The variability between commercially used serological assays
to detect
T. gondii-specific Igs is largely due to varying conditions
for tachyzoite cultivation (mouse or tissue culture) and a lack
of standard methods for preparing tachyzoite antigen (
2). In
addition, the pattern of
T. gondii antigen immunoreactivity
with human sera varies with the Ig class and the stage of infection.
The GPI-anchored SAG1 is highly abundant and the most immunogenic
surface protein of the
T. gondii tachyzoites present during
the acute phase of the disease, but it is not expressed in bradyzoites
during the chronic stage of infection (
9). Therefore, the SAG1
antigen has been the focus of intensive research with the aim
of developing a subunit vaccine against
T. gondii infection
or as a diagnostic tool. Expression of recombinant SAG1 in different
prokaryotic systems, as well as in eukaryotic cells, such as
insect cells (
8),
Pichia pastoris (
11), and CHO cells (
10),
remained unsatisfactory due to improper folding and/or fortuitous
glycosylation events. These deviations from the native SAG1
structure lead to a strong decrease in protective responses
or the production of antibodies against natural epitopes in
animals. In contrast, SAG1 expressed in
Giardia retains its
correct tertiary structure, and most importantly, SAG1-VSPct
appears also not to be glycosylated. Simple axenic cultivation
in a semidefined medium and well-established techniques for
stable maintenance of transfected DNA make
Giardia an extremely
useful system for small- and medium-scale expression of membrane-bound
recombinant surface antigens. Finally, the expression of heterologous
surface antigens such as SAG1, or specific subdomains thereof,
in a native conformation on the
Giardia surface provides a powerful
tool for the investigation of host-parasite interactions.

ACKNOWLEDGMENTS
This work was supported by Swiss National Science Foundation
grant 31-58912.99. Y. Li was supported by a training grant from
the China Scholarship Council.
We thank Frank Seeber for the plasmid pSAG1-GPI and T. Michel for expert technical assistance.

FOOTNOTES
* Corresponding author. Mailing address: Institute of Parasitology, University of Zürich, Winterthurerstrasse 266a, CH-8057 Zürich, Switzerland, Phone: 41-1-635-8526. Fax: 41-1-635-8907. E-mail:
ahehl{at}vetparas.unizh.ch.

Editor: J. M. Mansfield
Present address: Department of Parasitology, Harbin Medical University, 150086 Harbin, People's Republic of China 

REFERENCES
1
- Aley, S. B., and F. D. Gillin. 1993. Giardia lamblia: post-translational processing and status of exposed cysteine residues in TSA 417, a variable surface antigen. Exp. Parasitol. 77:295-305.[CrossRef][Medline]
2
- Aubert, D., G. T. Maine, I. Villena, J. C. Hunt, L. Howard, M. Sheu, S. Brojanac, L. E. Chovan, S. F. Nowlan, and J. M. Pinon. 2000. Recombinant antigens to detect Toxoplasma gondii-specific immunoglobulin G and immunoglobulin M in human sera by enzyme immunoassay. J. Clin. Microbiol. 38:1144-1150.[Abstract/Free Full Text]
3
- Bulow, R., and J. C. Boothroyd. 1991. Protection of mice from fatal Toxoplasma gondii infection by immunization with p30 antigen in liposomes. J. Immunol. 147:3496-3500.[Abstract]
4
- Cesbron-Delauw, M. F., S. Tomavo, P. Beauchamps, M. P. Fourmaux, D. Camus, A. Capron, and J. F. Dubremetz. 1994. Similarities between the primary structures of two distinct major surface proteins of Toxoplasma gondii. J. Biol. Chem. 269:16217-16222.[Abstract/Free Full Text]
5
- Gillin, F. D., P. Hagblom, J. Harwood, S. B. Aley, D. S. Reiner, M. McCaffery, M. So, and D. G. Guiney. 1990. Isolation and expression of the gene for a major surface protein of Giardia lamblia. Proc. Natl. Acad. Sci. USA 87:4463-4467.[Abstract/Free Full Text]
6
- Hehl, A. B., M. Marti, and P. Kohler. 2000. Stage-specific expression and targeting of cyst wall protein-green fluorescent protein chimeras in Giardia. Mol. Biol. Cell 11:1789-1800.[Abstract/Free Full Text]
7
- Hiltpold, A., M. Frey, A. Hulsmeier, and P. Kohler. 2000. Glycosylation and palmitoylation are common modifications of Giardia variant surface proteins. Mol. Biochem. Parasitol. 109:61-65.[CrossRef][Medline]
8
- Hunter, S., L. Ashbaugh, P. Hair, C. M. Bozic, and M. Milhausen. 1999. Baculovirus-directed expression and secretion of a truncated version of Toxoplasma SAG1. Mol. Biochem. Parasitol. 103:267-272.[CrossRef][Medline]
9
- Kasper, L. H., J. H. Crabb, and E. R. Pfefferkorn. 1983. Purification of a major membrane protein of Toxoplasma gondii by immunoabsorption with a monoclonal antibody. J. Immunol. 130:2407-2412.[Abstract]
10
- Kim, K., R. Bülow, J. Kampmeier, and J. C. Boothroyd. 1994. Conformationally appropriate expression of the toxoplasma antigen SAG1 (p30) in CHO cells. Infect. Immun. 62:203-209.[Abstract/Free Full Text]
11
- Letourneur, O., G. Gervasi, S. Gaia, J. Pages, B. Watelet, and M. Jolivet. 2001. Characterization of Toxoplasma gondii surface antigen 1 (SAG1) secreted from Pichia pastoris: evidence of hyper O-glycosylation. Biotechnol. Appl. Biochem. 33:35-45.[CrossRef][Medline]
12
- Nash, T. E., D. A. Herrington, M. M. Levine, J. T. Conrad, and J. W. Merritt, Jr. 1990. Antigenic variation of Giardia lamblia in experimental human infections. J. Immunol. 144:4362-4369.[Abstract]
13
- Papanastasiou, P., M. J. McConville, J. Ralton, and P. Kohler. 1997. The variant-specific surface protein of Giardia, VSP4A1, is a glycosylated and palmitoylated protein. Biochem. J. 322:49-56.
14
- Pimenta, P. F. P., P. P. da Silva, and T. Nash. 1991. Variant surface antigens of Giardia lamblia are associated with the presence of a thick cell coat: thin section and label fracture immunocytochemistry survey. Infect. Immun. 59:3989-3996.[Abstract/Free Full Text]
15
- Seeber, F., J. F. Dubremetz, and J. C. Boothroyd. 1998. Analysis of Toxoplasma gondii stably transfected with a transmembrane variant of its major surface protein, SAG1. J. Cell Sci. 111:23-29.[Abstract]
16
- Smith, P. D., F. D. Gillin, W. M. Spira, and T. E. Nash. 1982. Chronic giardiasis: studies on drug sensitivity, toxin production, and host immune response. Gastroenterology 83:797-803.[Medline]
Infection and Immunity, February 2002, p. 1014-1016, Vol. 70, No. 2
0019-9567/01/$04.00+0 DOI: 70.2.1014-1016.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Marti, M., Regos, A., Li, Y., Schraner, E. M., Wild, P., Muller, N., Knopf, L. G., Hehl, A. B.
(2003). An Ancestral Secretory Apparatus in the Protozoan Parasite Giardia intestinalis. J. Biol. Chem.
278: 24837-24848
[Abstract]
[Full Text]
-
Marti, M., Li, Y., Schraner, E. M., Wild, P., Kohler, P., Hehl, A. B.
(2003). The Secretory Apparatus of an Ancient Eukaryote: Protein Sorting to Separate Export Pathways Occurs Before Formation of Transient Golgi-like Compartments. Mol. Biol. Cell
14: 1433-1447
[Abstract]
[Full Text]
-
Touz, M. C., Lujan, H. D., Hayes, S. F., Nash, T. E.
(2003). Sorting of Encystation-specific Cysteine Protease to Lysosome-like Peripheral Vacuoles in Giardia lamblia Requires a Conserved Tyrosine-based Motif. J. Biol. Chem.
278: 6420-6426
[Abstract]
[Full Text]