Previous Article | Next Article 
Infection and Immunity, February 2002, p. 859-868, Vol. 70, No. 2
0019-9567/01/$04.00+0 DOI: 70.2.859-868.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Expression of Indoleamine 2,3-Dioxygenase, Tryptophan Degradation, and Kynurenine Formation during In Vivo Infection with Toxoplasma gondii: Induction by Endogenous Gamma Interferon and Requirement of Interferon Regulatory Factor 1
Neide M. Silva,1,2 Cibele V. Rodrigues,1,2 Marcelo M. Santoro,1 Luiz F. L. Reis,3 Jacqueline I. Alvarez-Leite,1 and Ricardo T. Gazzinelli1,2*
Department of Biochemistry and Immunology, UFMG, 31270-910 Belo Horizonte,1
Centro de Pesquisas René Rachou, FIOCRUZ, 30190-002 Belo Horizonte, MG,2
Ludwig Institute of Cancer Research, 01509-010 São Paulo, SP, Brazil3
Received 30 March 2001/
Returned for modification 14 May 2001/
Accepted 17 October 2001
 |
ABSTRACT
|
|---|
The induction of indoleamine 2,3-dioxygenase (INDO) expression and the tryptophan (Trp)-kynurenine (Kyn) metabolic pathway during in vivo infection with Toxoplasma gondii was investigated. Decreased levels of Trp and increased formation of Kyn were observed in the lungs, brain, and serum from mice infected with T. gondii. Maximal INDO mRNA expression and enzyme activity were detected in the lungs at 10 to 20 days postinfection. Further, the induction of INDO mRNA expression, Trp degradation and Kyn formation were completely absent in tissues from mice deficient in IFN-
(IFN-
-/-) or IFN regulatory factor -1 (IRF-1-/-). These findings indicate the important role of endogenous IFN-
and IRF-1 in the in vivo induction of the Trp-Kyn metabolic pathway during acute infection with T. gondii. In contrast, expression of INDO mRNA and its activity was preserved in the tissues of TNF-receptor p55- or inducible nitric oxide synthase-deficient mice infected with T. gondii. Together with the results showing the extreme susceptibility of the IFN-
-/- and the IRF-1-/- mice to infection with T. gondii, our results indicate a possible involvement of INDO and Trp degradation in host resistance to early infection with this parasite.
 |
INTRODUCTION
|
|---|
Toxoplasma gondii is an obligate intracellular protozoan parasite, which infects a wide range of intermediate hosts that include different species of birds and mammals, including humans. The tachyzoites, the rapid multiplying form of the parasite, can invade and replicate within all nucleated cells and, if left unchecked by the immune system, causes extensive tissue damage and death of the intermediate host (11). Resistance to acute infection with T. gondii in the murine model is highly dependent on endogenous gamma interferon (IFN-
) (11, 12, 37, 43). Soon after initial infection in the intermediate host, T. gondii tachyzoites trigger the synthesis of interleukin-12 (2, 12, 13, 23, 34) and other costimulatory cytokines (13, 17, 22, 23), which initiate the synthesis of IFN-
by NK cells (13, 23) and CD4+ CD8-
ß+ T lymphocytes (12). IFN-
combined with tumor necrosis factor alpha will activate macrophages to produce high levels of reactive nitrogen intermediates (RNI) that are involved in the control of parasite replication (1, 26). However, RNI is only one of the IFN-
-inducible mechanisms involved in the control of tachyzoite replication, and mice treated with inducible nitric oxide synthase (iNOS) inhibitor (20) or deficient in iNOS (38) are relatively more resistant than mice treated with neutralizing antibodies to IFN-
(12) or deficient in IFN-
or IFN-
receptor (10, 37). Thus, additional effector mechanisms induced by IFN-
and active during early experimental infection with T. gondii in the mouse model still have to be defined (11, 21).
Indoleamine 2,3-dioxygenase (INDO) is an enzyme that catalyzes the initial rate-limiting step of tryptophan (Trp) catabolism to N-formylkynurenine and kynurenine (Kyn) (21, 44). Many human cell lines express INDO upon stimulation with IFN-
. Restriction of available Trp due to degradation by INDO leads to the control of various intracellular pathogens, including T. gondii, in both nonprofessional phagocytic cells (NPPC) and professional phagocytic cells (PPC) (4, 5, 7, 8, 28, 29, 32, 39, 45). In the absence of Trp, an essential amino acid for T. gondii, parasite growth also becomes restricted (32, 36, 41). In fact, in human NPPC the induction of INDO appears to be the main mechanism by which IFN-
controls the intracellular replication of T. gondii tachyzoites (4, 5, 7, 8, 29, 32).
The INDO activity and the Trp-Kyn metabolic pathway can be induced in murine tissues under various conditions (21, 27, 35, 36). However, it has been difficult to demonstrate the role of INDO and Trp degradation in the control of tachyzoite replication in cell lines of mouse origin (18, 19, 40). In addition, no information is available about the induction of the Trp-Kyn metabolic pathway and its possible role in the restriction of parasite replication during in vivo experimental infection with T. gondii. In the present study, we evaluated the induction of INDO mRNA, Trp degradation, and Kyn formation during infection with T. gondii. Our results show that during the early stage of infection with T. gondii in the mouse model, INDO mRNA expression, Trp degradation, and Kyn formation are induced by endogenous IFN-
in an IFN regulatory factor 1 (IRF-1)-dependent manner. In contrast, the Trp-Kyn metabolic pathway is active and may contribute to the early resistance to T. gondii in iNOS- and TNF receptor p55 (TNFRp55)-deficient mice.
 |
MATERIALS AND METHODS
|
|---|
Animals.
IFN-
-/- and iNOS-/- mice were originally obtained from the Jackson Laboratory (Bar Harbor, Maine). The TNFRp55-/- matrices were kindly provided by Klaus Pfeffer (Technical Institute of Hygiene, University of Munich, Munich, Germany) (31). The IFN-
-/-, iNOS-/-, and TNFRp55-/- mice were all in the C57BL/6 genetic background. The IRF-
-/- mice were originated and maintained in the 129 genetic background (33). The wild-type (WT) and knockout mice, on either a 129 or C57BL/6 background, were bred as homozygotes and kept in the Laboratory of Gnotobiology, Department of Biochemistry and Immunology, Biological Sciences Institute, UFMG. The mice were housed under specific-pathogen-free conditions. All of the animals used for the experiments were females aged 8 to 12 weeks.
Experimental infections.
The low-virulence ME-49 strain of T. gondii was used to infect animals in this experiment. Cysts were harvested from the brains of C57BL/6 mice that had been inoculated 1 month beforehand with approximately 20 cysts by the intraperitoneal route. For experimental infections, knockout and WT mice received 10 ME-49 cysts in a volume of 0.1 ml by the intraperitoneal route.
Quantification of tissue parasitism by immunocytochemistry.
In these experiments, IRF-1-/-, TNFRp55-/-, iNOS-/-, IFN-
-/-, and WT mice were intraperitoneally infected with 10 T. gondii cysts and groups of three mice were killed by cervical dislocation. The IFN-
-/- (0, 5, and 8 days), IRF-1-/- (0, 5, and 8 days), iNOS-/- (0, 5, 8, 14, and 21 days), TNFRp55-/- (0, 5, 8, 14, 21, and 25 days), and WT (0, 5, 8, 14, 21, 25, and 30 days) were killed on different days postinfection as indicated in the parentheses. Brain, lung, liver, and spleen tissue samples were removed, fixed in 10% buffered formalin, and processed routinely for paraffin embedding and sectioning. Sections (4 µm) were cut from the organs and used for immunocytochemistry.
For immunocytochemistry, deparaffinized sections were subjected to antigenic unmasking in a microwave oven. The sections were incubated for 30 min at 37°C in 2% unlabeled sheep serum to reduce nonspecific binding and then incubated in polyclonal rabbit antibody against whole parasites of the RH strain of T. gondii (total antigen parasite), at 4°C overnight. Secondary biotinylated antibodies were sheep anti-rabbit antibodies. The sensitivity was improved with the avidin-biotin technique (ABC kit, PK-4000; Vector Laboratories, Inc., Burlingame, Calif.). The reaction was visualized by incubating the sections with 3,3"-diaminobenzidine tetrahydrochloride (Amresco, Solon, Ohio) for 5 min. Control slides were incubated in the unlabeled rabbit serum. The slides were studied with an Olympus microscope.
The immunocytochemical staining was measured by morphometric analysis. The images generated by our immunocytochemistry assay were captured in a Zeiss Axiolab microscope connected to JVC/TK-1270 video camera and a computer-digitized plate. The images were analyzed by Kontron Elektronic GMBH (KS300) software. The parasite load was measured in three noncontiguous sections (40 µm apart) in 40 fields per section (original magnification x 400) in a blinded fashion, measuring the total parasite antigen expression per square micrometer (42). Low background staining was observed in our immuncytochemistry slides. It is also of note that the digital camera was programmed to capture well-defined spots with intense staining and not diffuse staining.
Semiquantitative PCR.
The tissue parasitism was also measured by a semiquantitative PCR detecting the 35-copy B1 gene of T. gondii (16). We used, as the template in PCR, DNA extracted from paraffin-embedded tissue (15) of T. gondii-infected animals. The PCR was performed in a volume of 20 µl containing 25 ng of DNA and the PCR buffer, which consists of 0.02 mM each deoxynucleoside triphosphate, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 10 µM each primer 5"TCTTCCCAGAGGTGGATTTC3" (sense, nucleotides 151 to 171) and 5"CTCGACAATACGCTGCTTG3" (antisense, nucleotides 682 to 663), and 0.1 U of TaqPolimerase (CENBIOTIC, Porto Alegre, RS, Brazil). After initial incubation for 3 min at 95°C, samples were subjected to cycles of denaturing at 94°C for 1 min, annealing for 1.2 min at 62°C, and extension for 2 min at 72°C. After 38 cycles, the program executed a final extension of 7 min at 72°C. The products were electrophoresed in 6% polyacrylamide and developed by silver staining. Then the intensity of the B1-specific PCR product in tissues from knockout and WT mice was measured by densitometric analysis.
High-pressure liquid chromatography (HPLC) determination of tryptophan and kymurenine.
Control and infected mice were sacrificed at different times postinfection, and different organs (i.e. liver, spleen, lungs, and brain) were harvested, washed in phosphate-buffered saline and frozen at -70°C until use. The sera were obtained from blood samples collected from the brachial plexus and subjected to clotting and centrifugation. The serum samples were frozen at -70°C until use. Total free Trp and Kyn were quantified in serum and tissues by HPLC (30, 46). A 1-ml volume of serum was mixed with 0.2 ml of 30% trichloroacetic acid and centrifuged at 2,000 x g for 5 min. The supernatant was filtered through a 0.45-µm-pore-size filter. The tissues were homogenized for 0.5 min in ice-cold 0.16 M perchloric acid containing 0.1% EDTA and 0.1% ascorbic acid and centrifuged at 20,000 x g for 20 min, and the supernatant was filtered. The chromatography was performed in a Shimadzu LC-10A liquid chromatograph. The chromatographic separation was achieved using a 250- by 4.6-mm (inner diameter) C18 reverse-phase column (particle size, 4 µm; Aquapore RP-300 C-18). For Trp measurement, the column was eluted isocratically at flow rate of 1.0 ml/min with 0.02 M sodium phosphate buffer (pH 5.9) or 0.015 M sodium acetate (pH 4.5) containing 15% methanol for analysis of serum and tissue samples, respectively. For Kyn determination, the column was eluted with acetonitrile at a 1:47 dilution in 0.1 M acetic acid-0.1 M ammonium acetate (pH 4.65). The absorbance of the column effluent was monitored at 280 and 365 nm for Trp and Kyn respectively. The peaks of Trp or Kyn were identified by comparison with the retention times of standard compounds (Sigma), and quantification was based on the ratios of the peak areas of compound to the internal standard.
Reverse transcription-PCR analysis.
Lung fragments were harvested and placed in 0.5 ml of RNAzol solution (Cinna/Biotecx, Friendwood, Tex.) and homogenized, and RNA was extracted as previously described (14). Then 0.5µg of RNA was reverse transcribed using Moloney murine leukemia virus Reverse transcriptase (GIBCO BRL) and used as template in the PCR employing a housekeeping gene hipoxantine phosphoribosyl transferase (HPRT)-INDO-iNOS- or IFN-
-specific primers. The PCR was performed in 10 µl of reaction mixture containing samples diluted in buffer consisting of 200 µM deoxynucleoside triphosphates, 10 mM Tris-HCl (pH8.3), 50 mM KCl, 1.5 mM MgCl2, 5 µM each primer, and 0.05 U of TaqPolimerase. After initial incubation for 3 min at 95°C, samples were subjected to cycles of denaturing at 94°C for 1 min, annealing for 1 min, and extension at 72°C for 2 min. After the designated cycle numbers for each primer, the program executed a final extension of 7 min at 72°C. The products were electrophoresed in polyacrylamide and developed by silver staining. The PCR products were standardized using HPRT. The primer sequences (sense and antisense sequences) used, PCR product size, numbers of cycles, and annealing temperature used in cDNA amplification each are listed below: HPRT, 5"GTTGGATACAGGCCAGACTTTGTTG3" and 5"GATTCAACTTGCGCTCA-TCTTAGGC3", 162 bp, 30 cycles, 54°C; INDO, 5"CCTGTGCTGATTGAGAACGG3" and 5"TAATGAGCTATGACAGGATG3", 1,133 bp, 35 cycles, 63°C; iNOS, 5"CATGGCTTGCCCCTGGAAGTTTCTCTTCAAAG3" and 5"GCAGCATCCCCTCTGATGGTGCCATCG3", 832 bp, 35 cycles, 56°C; IFN-
: 5"GGTGACATGAAAATCCTGCAGAGC3" and 5"-CGCTGGACCTGTGGGTTGTTGACC3", 237 bp, 29 cycles, 64°C.
Statistical analysis.
Statistical determinations of the difference between means of experimental groups were performed using the unpaired two-tailed Student t test.
 |
RESULTS
|
|---|
IFN-/- and IRF-/- mice are highly susceptible to acute infection with T. gondii.
In our initial studies we employed WT, IFN-
-/-, INOS-/-, and TNFRp55-/- mice, all in the C57BL/6 genetic background, and evaluated their susceptibility to infection with the ME-49 strain of T. gondii, as measured by cumulative mortality and host tissue parasitism. As shown in previous studies (12, 37, 43), the IFN-
-/- mice were highly susceptible, and all the IFN-
-/- mice succumbed to T. gondii infection at day 10 postinfection (Fig. 1,
left panel). In contrast, iNOS-/- and TNFRp55-/- mice were relatively more resistant to T. gondii infection (9, 38, 48), surviving up to 30 days postinfection (Fig. 1, left panel). The WT mice survived at least 40 days postinfection but were all infected, as indicated by the serology, histopathology, and immunocytochemistry analyses. The results presented in Table 1
show that the tissue parasitism in peripheral organs (i.e., liver, lungs, and spleen) was dramatically enhanced in the IFN-
-/- mice but not in the iNOS-/- and TNFRp55-/- mice compared to WT mice. Our immunocytochemistry assay was highly sensitive, being able to detect a single tachyzoite (Fig. 2A)
and being devoid of nonspecific staining (Fig. 2). The tissue parasitism was also measured by a semiquantitative PCR detecting the T. gondii B1-specific gene (Fig. 3A),
being sensitive at the level of 0.1 pg of parasite DNA. As expected, the semiquantitative PCR indicated a higher concentration of parasite DNA in the liver and lungs from IFN-
-/- mice and to a lesser extent from iNOS-/- mice compared to WT mice (Fig. 3B). The results with TNFRp55-/-, IRF-1-/-, and 129 mice were similar to the ones with iNOS-/-, IFN-
-/- and C57BL/6 mice, respectively (data not shown). The quantification of parasites by immunocytochemistry and by semiquantitative PCR showed a high positive correlation, as is shown in Fig. 3C. The mortality of iNOS-/- and TNFRp55-/- mice was associated with enhanced tissue parasitism in the lungs and central nervous system (CNS) after 20 days postinfection (Table 1; Fig. 2B and 3B).
View this table:
[in this window]
[in a new window]
|
TABLE 1 Immunocytochemical analysis of tissue parasitism in peripheral organs and in the CNS from TNFRp55-/-, iNOS-/-, IFN- -/-, and IRF-1-/- mice and their respective WT counterparts infected with T. gondiia
|
|
In vitro studies show that IRF-1 mediates the expression of different genes induced by IFN-
, including INDO and iNOS (3). Therefore, we evaluated the susceptibility of IRF-1-/- mice to infection with T. gondii. In a previous study (25), IRF-1-/- mice in the C57BL/6 genetic background were shown to be more susceptible than WT mice when infected with 1,000 or 500 tachyzoites of the PLK strain of T. gondii per mouse. According to these findings, we found that IRF-1-/- mice were highly susceptible to infection with 10 cysts of the ME-49 strain, in contrast to WT mice, both of which are in the 129 genetic background. Under the conditions used in our experiments, the susceptibility of IRF-1-/- mice to T. gondii infection was comparable to that observed for the IFN-
-/- mice. All IRF-1-/- mice succumbed to infection by day 8 postinfection (Fig. 1, right panel), and mortality was associated with an intense tissue parasitism in the various peripheral organs (Table 1). Together, our results indicate that IFN-
and IRF-1 are crucial elements of innate resistance to early toxoplasmosis whereas iNOS and TNFRp55 appear to be active elements in the effector mechanism triggered by acquired immune responses during later stages of T. gondii infection in mice.
Kinetics of Trp degradation and Kyn formation during infection with T. gondii.
To investigate the induction of INDO activity and Trp-Kyn metabolic pathway during infection with T. gondii, we measured the levels of Trp and Kyn in different tissues and sera from infected WT mice. The serum, liver, spleen, lungs, and CNS were harvested at different times postinfection, and levels of Trp and Kyn were evaluated by HPLC with Trp and Kyn as standards. As shown in Fig. 4,
decreased levels of Trp and increased levels of Kyn were detected in sera from mice infected from 5 to 30 days postinfection. No major changes in Trp levels were observed in the liver or spleen from infected animals. A small increase in Kyn levels was observed in the spleen but not in the liver of animals 7 and 8 days after infection with T. gondii. A small but significant decrease in Trp levels in the CNS was observed at 20 days after infection with T. gondii. The changes in Kyn levels were more pronounced, and a significant increase of Kyn levels was observed in the CNS at 7, 10, and 20 days postinfection.
More dramatic changes in Trp and Kyn levels were observed in the lungs; the levels of Trp were mostly reduced by 5 days postinfection, and at days 10 and 20 postinfection they were below the limit of detection. The decrease in Trp levels was associated with a dramatic increase in the Kyn concentration in the lungs of animals infected for 5 to 30 days. The chromatograms on the right (Fig. 4) show the peak of Trp (5.05 min) and Kyn (5.68 min) levels in the lungs from uninfected control (top panels) and infected (bottom panels) mice. The results for INDO mRNA, as measured by RT-PCR, were consistent with the levels of Trp and Kyn in the lungs from uninfected and T. gondii-infected mice. Expression of INDO mRNA in the lungs was absent in uninfected animals. After infection with T. gondii, expression of INDO mRNA was noticeable at 5 days postinfection, maximal at 10 days postinfection, and persisted at high levels at 20 days postinfection. Maximal expression of INDO mRNA was associated with expression of high levels of IFN-
mRNA in the lungs from infected mice (Fig. 5).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5. Expression of IFN- , iNOS, and INDO mRNA genes in the lungs from mice infected with T. gondii ME-49. Lungs from C57BL/6 (top), 129 and IRF-1-/- (middle), and IFN- -/-, TNFRp55-/-, and iNOS-/- (bottom) mice were harvested at different times postinfection, total RNA was extracted, and gene expression was evaluated by RT-PCR. The amplification products for IFN- (237 pb), iNOS (832 pb), INDO (1,133 pb) and HPRT (160 pb) cDNAs were visualized in a silver-stained polyacrylamide gel. Each lane corresponds to the RT-PCR product obtained from the lungs of a single mouse. Similar results were obtained in two different experiments.
|
|
After 20 days postinfection, the levels of Trp and Kyn in the lungs, CNS, and/or sera from T. gondii-infected mice returned to those similar to the ones observed in tissues from uninfected animals. Identical results were obtained when tissues and sera from 129 and C57BL/6 mice infected with T. gondii were compared (data not shown).
Deficient INDO mRNA expression, Trp degradation, and Kyn formation in IFN-/- and IRF-/- mice infected with T. gondii.
To compare the levels of INDO mRNA in the pulmonary tissue from WT and various knockout mice, lungs were harvested from animals at 7 to 10 days after infection with T. gondii, total RNA was extracted, and the levels of INDO mRNA expression were compared by semiquantitative RT-PCR. As shown in Fig. 5, while absent in the pulmonary tissue from IFN-
-/- and IRF-1-/- mice, the expression of INDO mRNA was comparable in the WT, iNOS-/-, and TNFRp55-/- mice infected with T. gondii. Expression of iNOS mRNA was also shown to be absent in the lungs from IFN-
-/- and IRF-1-/- mice. In contrast, diminished expression of iNOS mRNA was found in the lungs from TNFRp55-/- mice (Fig. 5).
Consistent with the results found for INDO mRNA expression (Fig. 5), Trp degradation and Kyn formation were comparable in the lungs from WT, iNOS-/-, and TNFRp55-/- (Fig. 6)
mice infected with T. gondii. No significant decrease in the levels of Trp and only a very small increase in the levels of Kyn were observed in the lungs from the IFN-
-/- and IRF-1-/- mice. Likewise, but to a minor extent, we observed a decrease in the levels of Trp and Kyn formation in the CNS from the iNOS-/- and TNFRp55-/- mice but not from the IFN-
-/- or IRF-1-/- mice infected with T. gondii (Fig. 6). A major decrease in Trp levels was observed in the sera from all knockout mice at 8 days postinfection (Fig. 6), including the IFN-
-/- and IRF-1-/-, indicating that the control of Trp levels in the sera from infected mice was independent of endogenous IFN-
as well as IRF-1. In contrast, an increase in the levels of Kyn was observed in sera from WT, iNOS-/-, and TNFRp55-/- mice (Fig. 6) but not from IFN-
-/- and IRF-1-/- mice (Fig. 6) infected with T. gondii.
 |
DISCUSSION
|
|---|
Different studies indicate that RNI is only one of the mechanisms induced by IFN-
and involved in host resistance to T. gondii (11, 24, 38). It has also been suggested that in the murine model, induction of iNOS and the consequent action of RNI is the main mechanism responsible for the in vivo control of tachyzoite replication by PPC but not by NPPC (47). The mechanism responsible for the control of tachyzoite replication in NPPC still has to be defined. Substantial evidence indicates that induction of INDO expression and consequent Trp degradation, triggered by cytokines (mainly IFN-
), is largely responsible for the inhibition of intracellular T. gondii replication in human NPPC (4, 5, 7, 8, 29, 32). Intriguingly, it has been difficult to demonstrate the role of INDO activity and Trp degradation in the control of tachyzoite replication in cell lines of mouse origin (18, 19, 40), despite the fact that this metabolic pathway is operative in mouse tissues (21, 27, 35, 36). Additionally, the in vitro control of T. gondii in astrocytes were shown to be independent of iNOS and INDO (18, 19). The present study represents our efforts to demonstrate the induction of INDO expression and the Trp-Kyn metabolic pathway during infection with T. gondii.
Initially, we infected WT mice, either in the C57BL/6 or in the 129 genetic background, with the ME-49 strain of T. gondii and measured the levels of Trp and Kyn in different tissues and in sera at different times postinfection. Our results show decreased levels of Trp in sera, lungs, and CNS but not in the liver and spleen of infected mice. Concomitant with the decrease in the Trp levels in the sera, lungs, and CNS of infected animals, we observed increased levels of kyn, a direct product of Trp catabolism by INDO. The maximal changes in Trp and Kyn levels were observed between days 5 and 20 postinfection; the levels returned to those similar to the levels in the control uninfected animals after 20 to 30 days postinfection. Although statistically significant, the effects observed in the sera and CNS were only partial and relatively small, compared to those observed in the lungs. Therefore, we focused our study mainly in the pulmonary tissue, which was found to be an important site of parasite replication during acute infection with T. gondii. Consistent with the measurements of Trp and Kyn levels, we observed that the expression of INDO mRNA in the lungs was noticeable by 5 days postinfection and peaked around 10 to 20 days postinfection. These findings are in accordance with previous studies demonstrating that in vivo INDO activity in mice was observed mainly in the pulmonary tissue during viral infection (50) and during systemic stimulation with lipopolysaccharide or pokeweed mitogen (49).
In vitro as well as in vivo studies (21, 32, 36, 39, 44) have demonstrated that IFN-
is the most effective cytokine in its ability to stimulate INDO expression and Trp degradation, both in cells of human origin and in the mouse model. In addition, IRF-1, a transcription factor induced by IFN-
, is essential for induction of INDO in human cell lines (6). Therefore, we investigated whether the expression of INDO mRNA, Trp degradation, and Kyn formation would also occur in IFN-
-/- and IRF-1-/- mice infected with T. gondii. In agreement with the intense parasitism in the lungs, we observed that INDO mRNA expression was completely absent in the lungs from IFN-
-/- and IRF-1-/- mice at 7 to 10 days after infection with T. gondii. Consistently, we found no major changes in the levels of Trp and Kyn in the lungs of IFN-
-/- and IRF-1-/- mice infected with T. gondii. Similar findings were observed in the brain tissue from IFN-
-/- and IRF-1-/- mice infected with T. gondii. In contrast, we found that the Trp levels in the sera from infected mice were not under control of IFN-
and IRF-1. These findings indicate that the serum Trp levels from infected mice are not determined by INDO activity and may reflect a diminished food intake by infected mice, as determined in our experiments (data not shown).
Because iNOS-/- (24, 38) and TNFRp55-/- (9, 48) mice were shown to be relatively more resistant to T. gondii infection than were IFN-
-/- and IRF-1-/- mice, we investigated the expression of INDO mRNA as well as the levels of Trp and Kyn in the lungs from those animals. Our results indicate that INDO was highly expressed in the lung tissues from both iNOS-/- and TNFRp55-/- mice. Consistently, decreased Trp and increased Kyn levels in the lungs from iNOS-/- and TNFRp55-/- mice were comparable to those observed in the lungs from WT mice infected with T. gondii. Similar findings were observed in the CNS from both iNOS-/- and TNFRp55-/- mice infected with T. gondii. These findings indicate that the Trp-Kyn metabolic pathway is active in the absence of functional iNOS or TNFRp55.
Together, the results presented here show a very close association with the in vivo expression of INDO and host resistance to early infection with T. gondii. Thus, IFN-
-/- and IRF-1-/- mice that lack expression of INDO were highly susceptible to T. gondii infection. In contrast, iNOS-/- and TNFRp55-/- mice, which lack or show diminished expression of iNOS (9, 38), respectively, were relatively resistant to T. gondii especially to infection in the peripheral organs. Therefore, our results further indicate the involvement of an effector mechanism, other than iNOS, which is IFN-
-inducible and IRF-1-dependent and is essential for control of parasite replication in the peripheral organs of mice infected with T. gondii. However, it is noteworthy that IRF-1 mediates the expression of different genes induced by IFN-
and not exclusively INDO and iNOS (3).
In fact, we have not observed major changes in Trp and Kyn concentrations in the liver and spleen from mice infected with T. gondii. However, we observed an intense parasite replication in these same organs from IFN-
- or IRF-1-deficient mice. Therefore, our findings suggest that not INDO but another IFN-
- and IRF-1-dependent effector mechanism may be important for the control of parasite replication in the liver and spleen from mice infected with T. gondii. An alternative hypothesis would be that INDO may be active in some of these organs and play an eventual role in local resistance to tachyzoite replication. However, due to the lower activity and/or eventual problems with metabolites diffusion, variations of its activity are difficult to detect.
Nevertheless, our results show striking changes of Trp and Kyn concentrations and high levels of INDO mRNA expression in the lungs of mice acutely infected with T. gondii. Therefore, it is possible that the Trp-Kyn pathway is implicated in the IFN-
/IRF-1-dependent, iNOS/TNFRp55-independent immunological control of tissue parasitism in the lungs, which are important sites of parasite replication during acute infection with T. gondii in the intermediate hosts.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported in part by Conselho Nacional de Pesquisa Cientifica e Tecnológica (CNPq), PADCT, and Fundação de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG CBB 47/2001). R.T.G., M.M.S., J.I.A.L., and L.F.L.R. are research fellows from the CNPq. C.R.V. is suported by FAPEMIG, and N.M.S. received a scholarship from the CNPq.
We thank Antonio Mesquita Vaz, Maria Helena de Oliveira, and Ronilda Maria de Paula for maintaining the colony of knockout mice, and we thank Jamil Silvano and Marcelo Porto Bemquerer for excellent technical support with HPLC analysis. We also thank Leda Q. Vieira for critically reading the manuscript.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Laboratory of Immunopathology, Centro de Pesquisas René Rachou, FIOCRUZ, Av. Augusto de Lima 1715, 30190-002 Belo Horizonte, MG, Brazil. Phone: 55-31-3295-3566. Fax: 55-31-3295-3115. E-mail: ritoga{at}dedalus.lcc.ufmg.br. 
Editor: J. M. Mansfield
 |
REFERENCES
|
|---|
| 1. |
Adams, L. B., J. B. Hibbs, Jr., R. R. Taintor, and J. L. Krahenbuhl. 1990. Microbiostatic effect of murine-activated macrophages for Toxoplasma gondii. Role for synthesis of inorganic nitrogen oxides from L-arginine. J. Immunol. 144:2725-2729.[Abstract] |
| 2. |
Bliss, S. K., Y. Zhang, and E. Y. Denkers. 1999. Murine neutrophil by Toxoplasma gondii antigen drives high level production of IFN-gamma-independent IL-12. J. Immunol. 163:2081-2088.[Abstract/Free Full Text] |
| 3. |
Boehm U., T. Klamp, M. Groot, and J. C. Howard. 1997. Cellular responses to interferon- . Annu. Rev. Immunol. 15:749-795.[CrossRef][Medline] |
| 4. |
Cerávolo, I. P., A. C. L. Chaves, C. A. Bonjardim, D. Sibley, A. J. Romanha, and R. T. Gazzinelli. 1999. Replication of Toxoplasma gondii, but not Trypanosoma cruzi, is regulated in human fibroblasts activated with gamma interferon: requirement of a functional JAK/STAT pathway. Infect. Immun. 67:2233-2240.[Abstract/Free Full Text] |
| 5. |
Chaves, A. C. L., I. P. Cerávolo, J. A. S. Gomes, C. L. Zani, A. J. Romanha, and R. T. Gazzinelli. 2001. IL-4 and IL-13 regulate the induction of indoleamine 2,3-dioxygenase activity and the control of Toxoplasma gondii replication in human fibroblasts activated with IFN- . Eur. J. Immunol. 31:333-344.[CrossRef][Medline] |
| 6. |
Chon, S. Y., H. H. Hassanain, and S. L. Gupta. 1996. Cooperative role of interferon regulatory factor 1 and p 91 (STAT1) response elements in interferon- -inducible expression of human indoleamine 2,3-dioxygenase gene. J. Biol. Chem. 271:17247-17252.[Abstract/Free Full Text] |
| 7. |
Daubener, W., C. Remscheid, S. Nockemann, K. Pilz, S. Seghoruchni, C. Mackenzie, and U. Hadding. 1996. Anti-parasitic effector mechanism in human CNS tumor cells: role of interferon-gamma and tumor necrosis factor-alpha. Eur. J. Immunol. 26:487-492.[Medline] |
| 8. |
Daubener, W., K. Pilz, Z. S. Seghrouchni, T. Bilzer, H. G. Fischer, and U. Hadding. 1993. Induction of toxoplasmostasis in a human glioblatoma by interferon gamma. J. Neuroimmunol. 43:31-38.[CrossRef][Medline] |
| 9. |
Deckert-Schluter, M., H. Bluethmann, A. Rang, H. Hof, and D. Schluter. 1998. Crucial role of TNF receptor type 1 (p55), but not of TNF receptor type 2 (p75), in murine toxoplasmosis. J. Immunol. 160:3427-3436.[Abstract/Free Full Text] |
| 10. |
Deckert-Schluter, M., A. Rang, D. Weiner, S. Huang, O. D. Wiestler, H. Hof, and D. Schluter. 1996. Interferon- receptor-deficiency renders mice highly susceptible to toxoplasmosis by decreased mecrophage activation. Lab. Investig. 75:827-841.[Medline] |
| 11. |
Denkers, E. Y., and R. T. Gazzinelli. 1998. Regulation and function of T-cell-mediated immunity during Toxoplasma gondii infection. Clin. Microbiol. Rev. 11:569-588.[Abstract/Free Full Text] |
| 12. |
Gazzinelli, R. T., M. Wysocka, S. Hayashi, E. Y. Denkers, S. Hieny, P. Caspar, G. Trinchieri, and A. Sher. 1994. Parasite-induced IL-12 stimulates early IFN- synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153:2533-2543.[Abstract] |
| 13. |
Gazzinelli, R. T., S. Hieny, T. Wynn, S. Wolf, and A. Sher. 1993. IL-12 is required for the T-cell independent induction of IFN- by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115-6119.[Abstract/Free Full Text] |
| 14. |
Gazzinelli, R. T., I. Eltoum, T. A. Wynn, and A. Sher. 1993. Acute cerebral toxoplasmosis is induced by in vivo neutralization of TNF- and correlates with the down-regulated expression of inducible nitric oxide synthase and other markers of macrophage activation. J. Immunol. 151:3672-3681.[Abstract] |
| 15. |
Greer, C. E., S. L. Peterson, N. B. Kiviat, and M. M. Manos. 1991. PCR amplification from paraffin-embedded tissues. Effects of fixative and fixation time. Am. J. Clin. Pathol. 95:117-124.[Medline] |
| 16. |
Grigg, M. E., and J. C. Boothroyd. 2001. Rapid identification of virulent type I strains of the protozoan pathogen Toxoplasma gondii by PCR-restriction fragment length polymorphism analysis at the B1 gene. J. Clin. Microbiol. 39:398-400.[Abstract/Free Full Text] |
| 17. |
Guifang, C., R. Kastelein, and C. A. Hunter. 2000. Interleukin-18 (IL-18) enhances innate IL-12-mediated resistance to Toxoplasma gondii. Infect. Immun. 68:6932-6938.[Abstract/Free Full Text] |
| 18. |
Halonen, S. K., and L. M. Weiss. 2000. Investigation into the mechanism of gamma interferon-mediated inhibition of Toxoplasma gondii in murine astrocytes. Infect. Immun. 68:3426-3430.[Abstract/Free Full Text] |
| 19. |
Halonen, S. K., F. Chiu, and L. M. Weiss. 1998. Effect of cytokines on growth of Toxoplasma gondii in murine astrocytes. Infect. Immun. 66:4989-4993.[Abstract/Free Full Text] |
| 20. |
Hayashi, S., C. C. Chan, R. T. Gazzinelli, and G. Roberge. 1996. Contribution of nitric oxide to the host parasite equilibrium in toxoplasmosis. J. Immunol. 154:1476-1481. |
| 21. |
Heyes, M. P., K. Saito, J. S. Crowley, L. E. Davis, M. A. Demitrack, M. Der, L. A. Dilling, J. Elia, M. J. P. Kruesi, A. Lackner, S. A. Larsen, K. Lee, H. L. Leonard, S. P. Markey, A. Martin, S. Milstein, M. M. Mouradian, M. R. Prazatelli, B. J. Quearry, A. Salazar, M. Smith, S. E. Strauss, T. Sunderland, S. W. Swedo, and W. W. Tourtellotte. 1992. Quinolinic acid and kynurenine pathway metabolism in inflammatory and non-inflammatory neurological disease. Brain 115:1249-1273.[Abstract/Free Full Text] |
| 22. |
Hunter, C. A., R. Chizzonite, and J. S. Remington. 1995. IL-ß is required for IL-12 to induce production of IFN- by NK cells. J. Immunol. 155:4347-4354.[Abstract] |
| 23. |
Hunter, C. A., C. S. Subauste, V. H. Van Cleave, and J. S. Remington. 1994. Production of gamma interferon by natural killer cells from Toxoplasma gondii-infected SCID mice: regulation by interleukin-10, interleukin-12, and tumor necrosis factor alpha. Infect. Immun. 62:2818-2824.[Abstract/Free Full Text] |
| 24. |
Khan, I. A., J. D. Schwartzman, T. Matsuura, and L. H. Kasper. 1997. A dichotomous role for nitric oxide during acute Toxoplasma gondii infection in mice. Proc. Natl. Acad. Sci. USA 94:13955-13960.[Abstract/Free Full Text] |
| 25. |
Khan, I. A., T. Matsuura, S. Fonseka, and L. H. Kasper. 1996. Production of nitric oxide (NO) is not essential for protection against acute Toxoplasma gondii infection in IRF-1-/- mice. J. Immunol. 156:636-643.[Abstract] |
| 26. |
Langermans, J. A. M., M. E. B. Van Der Hulst, P. H. Nibbering, P. S. Hiemstra, L. Fransen, and R. Van Furth. 1992. IFN- induced L-arginine-dependent toxoplasmastatic activity in murine peritoneal macrophages is mediated by endogenous tumor necrosis factor- . J. Immunol. 148:568-574.[Abstract] |
| 27. |
Munn, D. H., M. Zhou, J. T. Atwood, I. Nondarev, S. J. Conway, B. Marshall, C. Brown, and A. L. Mellor. 1998. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 281:1191-1193.[Abstract/Free Full Text] |
| 28. |
Murray, H. W., A. Szuro-Sudol, D. Wellner, M. J. Oca, A. M. Granger, D. M. Libby, C. D. Rothermed, and B. Y. Rubin. 1989. Role of tryptophan degradation in respiratory burst-independent antimicrobial activity of gamma interferon-stimulated human macrophages. Infect. Immun. 57:845-849.[Abstract/Free Full Text] |
| 29. |
Nagineni, C. N., K. Pardhasaradhi, M. C. Martins, B. Detrick, and J. J. Hooks. 1996. Mechanisms of interferon-induced inhibition of Toxoplasma gondii replication in human retinal pigment epithelial cells. Infect. Immun. 64:4188-4196.[Abstract] |
| 30. |
Parent-Ermini, A., and R. R. Bem-Harari. 1990. Effect of volatile anesthetics on endogenous tryptophan, 5-hydroxytryptophan and 5-hydroxytryptamine in rat lung. Lung 168:259-266.[Medline] |
| 31. |
Pfeffer, K., T. Matsuyama, T. M. Kundig, A. Wakeham, K. Kishihara, A. Shahinian, K. Weignmann, P. S. Ohashi, M. Kronke, and T. W. Mak. 1993. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73:457-467.[CrossRef][Medline] |
| 32. |
Pfefferkorn, E. R. 1984. Interferon- blocks the growth of Toxoplasma gondii in human fibroblasts by inducing the host cells to degrade tryptophan. Proc. Natl. Acad. Sci. USA 81:908-912.[Abstract/Free Full Text] |
| 33. |
Reis, L. F., H. Ruffner, G. Stark, M. Aguet, and C. Weissmann. 1994. Mice devoided to interferon regulatory factor 1 show normal expression of type I interferon genes. EMBO. J. 13:4798-806.[Medline] |
| 34. |
Reis e Sousa, C., S. Hieny, T. Scharton-Kersten, D. Jankovic, H. Charest, R. N. Germain, and A. Sher. 1997. In vivo microbial stimulation induces rapid CD40L-independent production of IL-12 by dendritic cells and their re-distribution to T cell areas. J. Exp. Med. 186:1819-1829.[Abstract/Free Full Text] |
| 35. |
Rottenberg, M. E., A. G. Rothfuchs, D. Gigliotti, M. Ceausu, C. Une, V. Levitsky, and H. Wigzell. 2000. Regulation and role of IFN- in the innate resistance to infection with Chlamydia pneumoniae. J. Immunol. 164:4812-4818.[Abstract/Free Full Text] |
| 36. |
Saito, K., S. P. Markey, and M. P. Heyes. 1992. Effects of immune activation on quinolinic acid and neuroactive kynurenines in the mouse. Neuroscience 51:25-39.[CrossRef][Medline] |
| 37. |
Scharton-Kersten, T. M., T. A. Wynn, E. Y. Denkers, S. Bala, L. Showe, E. Grunvald, S. Hieny, R. T. Gazzinelli, and A. Sher. 1996. In the absence of endogenous IFN- mice develop unimpaired IL-12 responses to Toxoplasma gondii while failing to control acute infection. J. Immunol. 157:4045-4054.[Abstract] |
| 38. |
Scharton-Kersten, T., G. Yap, J. Magram, and A. Sher. 1997. Inducible nitric oxide is essential for host control of persistent but not acute infection with the intracellular pathogen Toxoplasma gondii. J. Exp. Med. 185:1-13.[Abstract/Free Full Text] |
| 39. |
Schmitz, J. L., J. M. Carlin, E. C. Borden, and G. I. Byrne. 1989. Beta interferon inhibits Toxoplasma gondii growth in human monocyte-derived macrophages. Infect. Immun. 57:3254-3256.[Abstract/Free Full Text] |
| 40. |
Schwartzman, J. D., S. L. Gonias, and E. R. Pfefferkorn. 1990. Murine gamma interferon fails to inhibit Toxoplasma gondii growth in murine fibroblasts. Infect. Immun. 58:833-834.[Abstract/Free Full Text] |
| 41. |
Sibley, L. D., M. Messina, and I. R. Niesman. 1994. Stable DNA transformation in the obligate intracellular parasite Toxoplasma gondii by complementation of tryptophan auxotrophy. Proc. Natl. Acad. Sci. USA 91:5508-5512.[Abstract/Free Full Text] |
| 42. |
Silva, N. M., R. T. Gazzinelli, D. A. O. Silva, E. A. V. Ferro, L. H. Kasper, and J. R. Mineo. 1998. Expression of Toxoplasma gondii-specific heat shock protein 70 during in vivo conversion of bradyzoites to tachyzoites. Infect. Immun. 66:3959-3963.[Abstract/Free Full Text] |
| 43. |
Suzuki, Y., M. A. Orellana, R. D. Schreiber, and J. S. Remington. 1988. Interferon- : the major mediator of resistance against Toxoplasma gondii. Science 240:516-518.[Abstract/Free Full Text] |
| 44. |
Taylor, M. W., and G. Feng. 1991. Relationship between interferon- , indoleamine 2,3-dioxygenase and tryptophan catabolism. FASEB J. 5:2526-2521. |
| 45. |
Thomas, S. F., L. F. Garrity, C. R. Brandt, C. S. Schobert, G. Feng, M. W. Taylor, J. M. Carlin, and G. J. Byrne. 1993. IFN- mediated antimicrobial response. J. Immunol. 150:5529-5534.[Abstract] |
| 46. |
Walser, M., and S. B. Hill. 1993. Free and protein-bound tryptophan in serum of untreated patients with chronic renal failure. Kidney Int. 44:1366-1371.[Medline] |
| 47. |
Yap, G. S., and A. Sher. 1999. Effector cells of both nonhemopoietic and hemopoietic origin are required for interferon (IFN)- - and tumor necrosis factor (TNF)- -dependent host resistance to the intracellular pathogen, Toxoplasma gondii. J. Exp. Med. 189:1083-1091.[Abstract/Free Full Text] |
| 48. |
Yap, G. S., T. Scharton-Kersten, H. Charest, and A. Sher. 1998. Decreased resistance of TNF receptor p55- and p75-deficient mice to chronic toxoplasmosis despite normal activation of inducible nitric oxide synthase in vivo. J. Immunol. 160:1340-1345.[Abstract/Free Full Text] |
| 49. |
Yoshida, R., T. Oku, J. Imanishi, T. Kishida, and O. Hayaishi. 1986. Interferon: a mediator of indoleamine 2,3-dioxygenase induction by lipopolysaccharide, p(I) X poly(C), and pokeweed mitogen in mouse lung. Arch. Biochem. Biophys. 249:596-604.[CrossRef][Medline] |
| 50. |
Yoshida, R., Y. Urade, M. Tokuda, and O. Hayaishi. 1979. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. Proc. Natl. Acad. Sci. USA 76:4084-4086.[Abstract/Free Full Text] |
Infection and Immunity, February 2002, p. 859-868, Vol. 70, No. 2
0019-9567/01/$04.00+0 DOI: 70.2.859-868.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Saito, A., Motomura, N., Kakimi, K., Narui, K., Noguchi, N., Sasatsu, M., Kubo, K., Koezuka, Y., Takai, D., Ueha, S., Takamoto, S.
(2008). Vascular allografts are resistant to methicillin-resistant Staphylococcus aureus through indoleamine 2,3-dioxygenase in a murine model. J. Thorac. Cardiovasc. Surg.
136: 159-167
[Abstract]
[Full Text]
-
Kim, S.-K., Fouts, A. E., Boothroyd, J. C.
(2007). Toxoplasma gondii Dysregulates IFN-{gamma}-Inducible Gene Expression in Human Fibroblasts: Insights from a Genome-Wide Transcriptional Profiling. J. Immunol.
178: 5154-5165
[Abstract]
[Full Text]
-
Bernardes, E. S., Silva, N. M., Ruas, L. P., Mineo, J. R., Loyola, A. M., Hsu, D. K., Liu, F.-T., Chammas, R., Roque-Barreira, M. C.
(2006). Toxoplasma gondii Infection Reveals a Novel Regulatory Role for Galectin-3 in the Interface of Innate and Adaptive Immunity. Am. J. Pathol.
168: 1910-1920
[Abstract]
[Full Text]
-
Datta, R., deSchoolmeester, M. L., Hedeler, C., Paton, N. W., Brass, A. M., Else, K. J.
(2005). Identification of Novel Genes in Intestinal Tissue That Are Regulated after Infection with an Intestinal Nematode Parasite. Infect. Immun.
73: 4025-4033
[Abstract]
[Full Text]
-
Hainz, U., Obexer, P., Winkler, C., Sedlmayr, P., Takikawa, O., Greinix, H., Lawitschka, A., Putschger, U., Fuchs, D., Ladisch, S., Heitger, A.
(2005). Monocyte-mediated T-cell suppression and augmented monocyte tryptophan catabolism after human hematopoietic stem-cell transplantation. Blood
105: 4127-4134
[Abstract]
[Full Text]
-
Bozza, S., Fallarino, F., Pitzurra, L., Zelante, T., Montagnoli, C., Bellocchio, S., Mosci, P., Vacca, C., Puccetti, P., Romani, L.
(2005). A Crucial Role for Tryptophan Catabolism at the Host/Candida albicans Interface. J. Immunol.
174: 2910-2918
[Abstract]
[Full Text]
-
Portugal, L. R., Fernandes, L. R., Cesar, G. C., Santiago, H. C., Oliveira, D. R., Silva, N. M., Silva, A. A., Lannes-Vieira, J., Arantes, R. M. E., Gazzinelli, R. T., Alvarez-Leite, J. I.
(2004). Infection with Toxoplasma gondii Increases Atherosclerotic Lesion in ApoE-Deficient Mice. Infect. Immun.
72: 3571-3576
[Abstract]
[Full Text]
-
Schluter, D., Kwok, L.-Y., Lutjen, S., Soltek, S., Hoffmann, S., Korner, H., Deckert, M.
(2003). Both Lymphotoxin-{alpha} and TNF Are Crucial for Control of Toxoplasma gondii in the Central Nervous System. J. Immunol.
170: 6172-6182
[Abstract]
[Full Text]