IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Dijck, P.
Right arrow Articles by Thevelein, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Dijck, P.
Right arrow Articles by Thevelein, J. M.

 Previous Article  |  Next Article 

Infection and Immunity, April 2002, p. 1772-1782, Vol. 70, No. 4
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.4.1772-1782.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Disruption of the Candida albicans TPS2 Gene Encoding Trehalose-6-Phosphate Phosphatase Decreases Infectivity without Affecting Hypha Formation

Patrick Van Dijck,1,2* Larissa De Rop,1 Karolina Szlufcik,1 Elke Van Ael,1 and Johan M. Thevelein1

Laboratory of Molecular Cell Biology,1 Flemish Institute for Biotechnology, Instituut voor Plantkunde en Microbiologie, Katholieke Universiteit Leuven, B-3001 Heverlee, Flanders, Belgium2

Received 6 July 2001/ Returned for modification 3 October 2001/ Accepted 20 December 2001


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Deletion of trehalose-6-phosphate phosphatase, encoded by TPS2, in Saccharomyces cerevisiae results in accumulation of trehalose-6-phosphate (Tre6P) instead of trehalose under stress conditions. Since trehalose is an important stress protectant and Tre6P accumulation is toxic, we have investigated whether Tre6P phosphatase could be a useful target for antifungals in Candida albicans. We have cloned the C. albicans TPS2 (CaTPS2) gene and constructed heterozygous and homozygous deletion strains. As in S. cerevisiae, complete inactivation of Tre6P phosphatase in C. albicans results in 50-fold hyperaccumulation of Tre6P, thermosensitivity, and rapid death of the cells after a few hours at 44°C. As opposed to inactivation of Tre6P synthase by deletion of CaTPS1, deletion of CaTPS2 does not affect hypha formation on a solid glucose-containing medium. In spite of this, virulence of the homozygous deletion mutant is strongly reduced in a mouse model of systemic infection. The pathogenicity of the heterozygous deletion mutant is similar to that of the wild-type strain. CaTPS2 is a new example of a gene not required for growth under standard conditions but required for pathogenicity in a host. Our results suggest that Tre6P phosphatase may serve as a potential target for antifungal drugs. Neither Tre6P phosphatase nor its substrate is present in mammals, and assay of the enzymes is simple and easily automated for high-throughput screening.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Over the last years, the prevalence of Candida albicans infections in humans has increased seriously (40). The two main reasons are the increasing number of immunocompromised patients and the increasing resistance against the limited number of antimycotic drugs that are commercially available. These drugs act on a small number of targets. They either bind ergosterol or inhibit its biosynthesis (amphotericin B, terbinafine, nystatin, and the azoles) or interfere with nucleic acid biosynthesis (flucytosine). New drugs still under clinical investigation act on cell wall formation or on protein synthesis (echinocandins, nikkomycins and aureobasidin, rustmicin, and khafrefungin) (23, 35). A major problem for development of new antifungal compounds is the fact that fungi are eukaryotes and therefore have most essential functions in common with mammalian cells.

Recently, much research focus has gone to targets involved in the regulation of the dimorphic shift from yeast cells to hyphae, since it has been shown that the capacity to form hyphae is related to virulence (12, 20, 30). Based on the similarity with pathways involved in the control of pseudohyphal growth in Saccharomyces cerevisiae (38), the mitogen-activated protein (MAP) kinase pathway and the Ras-cyclic AMP pathway have been identified as being involved in control of C. albicans dimorphism. The MAP kinase pathway includes Cst20, Hst7, Cek1, and Cph1 (14, 16, 27, 33), while the Ras-cyclic AMP pathway includes Ras1, Cap1, Tpk2, and Efg1 (3, 17, 43, 45). Although deletion of these genes renders C. albicans cells less virulent or even avirulent in a mouse model, the gene products do not seem to be promising as antifungal targets because homologous components are present in mammals. A similar situation applies to the Hog1 MAP kinase pathway (1, 33, 34). More promising are signaling pathways involved in cell wall formation, and for some of the components clinical studies to investigate their potential as antifungal targets are under way (8, 10, 32, 42, 44, 49). Another class of interesting targets are important for adherence to host cells. Two groups, the secreted acid protease family genes and the cell surface glycoprotein family genes, have been identified, and their deletion results in lower virulence (9, 20, 25, 41).

Trehalose metabolism might be an interesting target for antifungals. It is entirely absent in mammalian cells and makes use of highly specific enzymes. Trehalose ({alpha},{alpha},1,1-diglucose) is synthesized in fungi in a two-step process. Trehalose-6-phosphate (Tre6P) synthase, encoded by TPS1, synthesizes Tre6P from glucose-6-phosphate and UDPglucose (4). Tre6P is then hydrolyzed into trehalose by Tre6P phosphatase, encoded by TPS2 (15). Trehalose is a storage carbohydrate, but it also plays a major role as stress protectant (47, 51, 53). It appears that trehalose has unusual chemical properties which make it more suitable than other sugars to protect proteins and membranes against denaturation under stress conditions (13, 37). It accumulates in large quantities in survival forms of a diverse array of organisms and also accumulates in vegetative cells of fungi under stress conditions (47, 51, 53). Since pathogens are living under adverse conditions in host organisms because of the host defense reactions, insufficient nutrient supply, or high osmolarity, etc., one can assume that their stress response mechanisms are continuously activated. Trehalose accumulation is part of the stress response, and previous work has shown that prevention of trehalose accumulation by deletion of the C. albicans TPS1 gene renders the cells less virulent (54). In S. cerevisiae, deletion of the TPS2 gene encoding Tre6P phosphatase causes hyperaccumulation of Tre6P instead of trehalose under stress conditions (15, 39). As a result, a tps2{Delta} strain is thermosensitive. Tre6P accumulation is toxic because it sequestrates phosphate and as a result inhibits ATP generation. Moreover, Tre6P is an inhibitor of hexokinase, causing additional reduction of glycolytic flux and energy generation (6, 48). Energy provision is required for most cellular functions, including the activity of drug efflux pumps. Because of these reasons, it appeared to us that Tre6P phosphatase might be even a better target for antifungals than Tre6P synthase. Moreover, not only is Tre6P phosphatase absent in mammals, its substrate Tre6P is also absent, increasing the chances for design of specific inhibitors.

Disruption of the C. albicans TPS1 gene (CaTPS1) impairs the formation of hyphae on glucose-containing medium and decreases virulence in a mouse systemic infection model (2, 54). The reason for the lower virulence is not well understood. There are at least two possibilities. First, deletion of TPS1 in other yeasts such as S. cerevisiae or Kluyveromyces lactis results in complete deregulation of glycolysis after addition of glucose and rapid loss of viability (31, 50). In C. albicans, a similar deregulation of metabolism is found but only at higher temperatures. Second, the absence of trehalose may result in lower stress resistance and as a result lower virulence. If the absence of trehalose is the main reason for the reduced virulence, it appears that deletion of the C. albicans TPS2 gene (CaTPS2), which results in high levels of Tre6P instead of trehalose, should at least give the same reduction in stress resistance and virulence. Because of the toxic effects of Tre6P hyperaccumulation on glycolysis, inactivation of CaTPS2 might impair cellular functions even more and therefore further reduce virulence. In this work we have cloned the CaTPS2 gene and constructed hetero- and homozygous deletion mutants. We show that complete inactivation of CaTPS2 results in a 50-fold increase in Tre6P levels, growth inhibition, and loss of viability during heat stress. Whereas deletion of CaTPS1 prevented glucose-induced hypha formation (54), deletion of CaTPS2 did not affect hypha formation under all conditions examined. In spite of this, virulence of the homozygous deletion mutant in a mouse systemic infection model was strongly reduced.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Yeast strains and growth conditions. The wild-type C. albicans SC5314 strain (21) and the genetically marked CAI-4 strain (ura3{Delta}::imm434/ura3{Delta}::imm434) (18) were kindly provided by Alistair Brown (Aberdeen, United Kingdom). The construction of the different C. albicans tps2{Delta} strains (Table 1) is described further. The yeast cells were grown with shaking at 28°C in YPD medium (1% yeast extract, 2% peptone, 2% glucose). To study the yeast-hypha transition, early-exponential-phase cells (optical density at 600 nm = 0.8) growing at 28°C on YPD medium were supplemented with 10% fetal calf serum (Sigma) and shifted to 37°C. To study colony morphology, stationary-phase C. albicans cells were resuspended in fresh YPD medium and diluted to obtain single colonies on plates. After 5 days at 37°C, individual colonies were photographed. The formation of hyphae and colony morphology were tested on different media, including medium containing fetal calf serum (Sigma), Spider medium (1% nutrient broth {sigma}, 0.2% K2HPO4, 1% mannitol), Lee's medium (28), SLAD medium (0.17% yeast nitrogen base without amino acids and ammonium sulfate, 2% glucose, 50 µM ammonium sulfate), and medium 199 (Sigma; containing Earle's salts and L-glutamine).


View this table:
[in this window]
[in a new window]
 
TABLE 1. C. albicans strains used in this study

 
Growth curves were determined with a Bioscreen apparatus (Life Sciences). Strains were grown overnight in YPD medium and diluted to an optical density of 0.05 in fresh YPD medium, and 300 µl was added to the wells of the honeywell plate and incubated at the indicated temperature with 30 s of shaking every minute.

Chromosomal deletion of TPS2. The CaTPS2 gene and its flanking DNA (530 bp upstream and 640 bp downstream) were isolated by PCR amplification with genomic DNA of strain SC5314 as a template. The sequences of the two oligonucleotides used were as follows: primer FOR2, 5'GAGTCGACCTCACCTGAGGCATCCACATAC3', and REV2, 5'GAGGTACCGTGTAATCCGGACATTAACTCCG3'. The FOR2 oligonucleotide contains a SalI recognition site (underlined), and the REV2 oligonucleotide contains a KpnI recognition site. The 3,800-bp fragment was subcloned in pUC19 digested with the same restriction enzymes. The plasmid obtained was then digested with SnaBI and NsiI, which remove nearly the complete open reading frame of the CaTPS2 gene, leaving the flanking sequences and material encoding only 7 amino acids at the N terminus and 10 amino acids at the C terminus. The cassette hisG-URA3-hisG carrying the C. albicans URA3 gene flanked by two direct repeats of the Salmonella enterica serovar Typhimurium hisG sequence was obtained by digesting plasmid pMB7-A (18) with the restriction enzymes BglII and PstI. Before ligation into the plasmid containing the flanking sequences of CaTPS2, the BglII site was blunted using the Klenow polymerase. To make the final deletion construct, the plasmid obtained was digested with AvrII and SpeI resulting in the 4.8-kb deletion fragment. This fragment was used to transform the CAI-4 strain. Both PCR analysis and Southern blotting were used to confirm deletion of one copy of the CaTPS2 gene.

Excision of the disruption cassette from the chromosome was performed by plating the cells on minimal medium containing uridine and 5-fluoro-orotic acid (FOA). The FOA-positive colonies were checked by PCR and Southern blotting, and a colony that showed the correct pattern was used to delete the second copy of the CaTPS2 gene. The same strategy was used as for the deletion of the first copy. For the reintegration of CaTPS2 in the homozygous deletion strain, we cloned the gene and promoter sequence into the plasmid pCaEX (11) (kindly provided by P. Sudbury, University of Sheffield, Sheffield, United Kingdom). The CaTPS2 gene was amplified using oligonucleotides CaTPS2 FOR4 (5' GAAGTCTGAAGCTGCCGG 3') and CaTPS2 REV3 (5' CGGCATGCCCGAGACTGGAGATTAGGTG 3'). The CaTPS2 gene was cloned by digesting the PCR product with XbaI (in the promoter) and SphI (underlined) and subcloned in the pCaEX vector digested with the same enzymes, thereby removing the MET3 promoter sequence in the plasmid. The plasmid was linearized using AvrII, directing the integration at the CaTPS2 locus in the genome.

Heat shock response and resistance. Cells growing exponentially at 30°C in YPD medium were transferred to a water bath at 44°C, and at different times after the shift, samples were taken and a 10-fold serial dilution was spotted on YPD plates and further incubated at 30°C.

Determination of trehalose, Tre6P, and Tre6P phosphatase activity. Cells from an overnight culture were washed and resuspended in fresh YPD medium for 4 h. Samples for trehalose and Tre6P were taken. The culture was then divided in four aliquots, and the cells were further incubated at either 30, 37, 40, or 43°C. At different times after the shift, samples for trehalose and Tre6P determination were taken. Trehalose levels were determined as described by Neves et al. (36), and Tre6P levels were determined as described by Van Vaeck et al. (52).

Tre6P phosphatase activity was determined according to a method described previously (5). The activity was measured at 30°C, and measurements were repeated five times.

Determination of virulence. Female BALB/c mice weighing 20 g were inoculated in the lateral caudal vein with 106 C. albicans cells suspended in 150 µl of saline. Survival was scored over a period of 1 month. A group of 10 mice per condition was tested. The fungal burdens in the kidneys, liver, and lungs were determined by homogenizing the organs in saline and counting the colonies on YPD plates after appropriate dilution.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of the C. albicans TPS2 gene. BLAST analysis of the C. albicans genome database (http://www-sequence.stanford.edu:8080/bncontigs6.html) with the S. cerevisiae TPS2 sequence revealed a homologous sequence in contig 4-3098. Based on the homology, PCR primers were designed to clone the complete open reading frame and flanking sequences in pUC19. The C. albicans Tps2 protein contains 878 amino acids and shares 70% sequence similarity with the S. cerevisiae Tps2 protein (Fig. 1). The C. albicans Tps2 protein also contains the two phospohydrolase motifs (46) which are present in all Tps2 sequences that have been described (22, 29).



View larger version (62K):
[in this window]
[in a new window]
 
FIG. 1. Sequence alignment of the S. cerevisiae and C. albicans Tps2 proteins. The phosphohydrolase motifs typical for all Tps2 proteins (46) are indicated in boldface.

 
Construction of a C. albicans TPS2 deletion strain. We made use of the Ura blaster cassette to construct the CaTPS2 deletion strain (Fig. 2A). The pUC19/CaTPS2 plasmid was digested with SnaBI and NsiI, which removes nearly completely the CaTPS2 open reading frame. It leaves 523 bp of promoter sequence and 639 bp of terminator sequence on the plasmid. The Ura blaster cassette was isolated from plasmid pMB7-A (18) as a BglII-PstI fragment. After ligation of the two fragments, we obtained the plasmid pUC19/Catps2::hisG-URA3-hisG. The final deletion construct was made by digesting this plasmid with AvrII and SpeI (Fig. 2A). After transformation of the C. albicans CAI4 Ura- strain with this 4,814-bp fragment, we obtained 14 colonies. PCR analysis and Southern blotting (not shown) indicated that 12 transformants contained a proper deletion of the CaTPS2 gene. The positive transformants were streaked on FOA medium as explained in Materials and Methods. The colonies that grew on these plates were checked by PCR for the loss of the C. albicans URA3 gene. One of the positive colonies was transformed again with the CaTPS2 deletion construct. In this second round of transformation, we screened 75 colonies and found only one transformant with the correct pattern in Southern blot analysis (Fig. 2B). The homozygous deletion strain was also checked by Northern blotting using a CaTPS2 probe, and no CaTPS2 messenger could be detected (data not shown). For the reintroduction of a wild-type copy of the C. albicans TPS2 gene, we cloned the gene and its promoter on a plasmid and integrated it at the tps2 locus. Correct integration was confirmed by Southern blot analysis (not shown).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 2. Deletion strategy for C. albicans TPS2. (A) Genetic organization of the CaTPS2 locus. The CaTPS2 open reading frame (black arrow) was replaced with the Ura blaster cassette as described in Materials and Methods. Restriction endonucleases: H, HindIII; S, SpeI; Sn, SnaBI; N, NsiI; A, AvrII. (B) Southern blot analysis of HindIII-digested C. albicans genomic DNA probed with part of the CaTPS2 terminator as indicated in panel A. Lanes: 1, parental strain CAI4; 2, CaTPS2/Catps2{Delta} strain CC5 (Ura+); 3 and 4, Catps2{Delta}/Catps2{Delta} strains CC17 and EL17 (Ura+ and Ura-, respectively; 5, CaTPS2-complemented strain KAR17. Numbers on the left and right are the lenghts of the DNA fragments in basepairs.

 
Phenotypic characterization of the hetero- and homozygous CaTPS2 deletion strains. (i) Tre6P phosphatase activity. In a first control experiment to check for proper deletion of the CaTPS2 gene, we measured the Tre6P phosphatase activity. Cell extracts were prepared from glucose-grown stationary-phase cells. The wild-type SC5314 strain has an activity of 231 nkat/g of protein, whereas the tps2{Delta}/tps2{Delta} strain has virtually no Tre6P phosphatase activity (7 nkat/g of protein). The heterozygous deletion strain has an intermediate activity (147 nkat/g of protein). This result clearly indicates that the homozygous deletion strain has little or no Tre6P phosphatase activity left.

(ii) Temperature-sensitive growth and survival. We grew the wild type and heterozygous and homozygous CaTPS2 deletion mutants in glucose-containing medium at 41 and 43°C in a Bioscreen apparatus (Life Sciences). The growth rate of the heterozygous deletion strain was quite similar to that of the wild type. Only at 43°C was there a minor reduction in growth rate. The homozygous deletion mutant showed a minor growth inhibition at 41°C and a severe inhibition at 43°C compared to the wild-type strain (Fig. 3A). These data show that also in C. albicans, deletion of TPS2 results in temperature-sensitive growth. Subsequently, we incubated exponentially growing cultures of the three strains for different time periods at 44°C, after which serial dilutions were plated on YPD plates and incubated further at 30°C. Figure 3B shows that the wild-type and heterozygous deletion strains were able to survive quite well an incubation of at least 6 h at 44°C. On the other hand, the homozygous deletion strain was clearly much more sensitive to the heat treatment than the other two strains, and after 6 h at 44°C nearly all cells had died. These results show that the homozygous CaTPS2 deletion strain is heat sensitive not only for growth but also for survival.



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 3. The Catps2{Delta}/Catps2{Delta} strain is thermosensitive. (A) The SC5314 wild-type (circles), CaTPS2/Catps2{Delta} (squares), and Catps2{Delta}/Catps2{Delta} (triangles) strains were grown in YPD medium at 30°C (filled symbols) or 43°C (open symbols) in a Bioscreen apparatus. OD, optical density. (B) Cells of the three strains were grown exponentially in YPD medium at 30°C and then incubated in a water bath at 44°C for the indicated amounts of time. Afterwards, aliquots were taken and diluted several times 10-fold. Five microliters of each 10-fold dilution was plated on YPD plates and incubated further at 30°C. The colonies were photographed 24 h later. WT, wild type.

 
(iii) Trehalose accumulation. It has been suggested that the reason for the temperature sensitivity of the S. cerevisiae tps2{Delta} strain is the accumulation of large amounts of Tre6P, which is toxic because it results in phosphate sequestration and deregulation of central metabolism (15, 39). To investigate whether the C. albicans homozygous CaTPS2 deletion mutant behaves in the same way, we measured trehalose and Tre6P levels during heat treatment. Wild-type, CaTPS2/Catps2{Delta}, and Catps2{Delta}/Catps2{Delta} strains were grown in YPD medium at 30°C to exponential phase. The cultures were then divided in four and further incubated at either 30, 37, 40, or 43°C. The results show that during heat stress strong accumulation of trehalose occurs in the wild type and in the heterozygous deletion strain (Fig. 4). However, in the Catps2{Delta}/Catps2{Delta} strain significant amounts of trehalose also were accumulated. At 30°C the level of trehalose in the homozygous deletion strain was even somewhat higher than those in the wild type and the heterozygous deletion strain. At 43°C the largest difference was observed between the wild-type and heterozygous deletion strains on the one hand and the homozygous deletion strain on the other hand. However, at 43°C the Catps2{Delta}/Catps2{Delta} strain still accumulated up to 30 mM trehalose. We have repeated the trehalose determinations with the homozygous deletion strain under various stress conditions, and we could always detect up to 30 mM trehalose. Apparently, C. albicans contains nonspecific phosphatases which are able to dephosphorylate Tre6P into trehalose with lower efficiency than Tre6P phosphatase. We have found similar results for S. cerevisiae (55). Addition of general phosphatase inhibitors, such as levamisole, to the cells did not prevent the accumulation of trehalose in the Catps2{Delta}/Catps2{Delta} strain (data not shown). Although our results indicate the presence of other phosphatases able to dephosphorylate Tre6P, we cannot exclude the possibility that these phosphatases act only on unphysiologically high Tre6P levels that accumulate in the Catps2{Delta}/Catps2{Delta} strain.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 4. Trehalose levels during heat treatment. Cells of the wild type (•), CaTPS2/Catps2{Delta} ({blacksquare}), and Catps2{Delta}/Catps2{Delta} ({blacktriangleup}) strains were grown in fresh YPD medium at 30°C for 4 h. The cultures were divided in four and incubated further at 30, 37, 40, and 43°C. Samples for trehalose determination were taken at the indicated time points. ww, wet weight.

 
(iv) Tre6P accumulation. To determine the accumulation of Tre6P during heat stress, we grew wild-type, CaTPS2/Catps2{Delta}, and Catps2{Delta}/Catps2{Delta} strains in YPD medium at 30°C until exponential phase. The cultures were then divided in two and further incubated at either 30 or 43°C. At different time points after the shift, samples were taken for Tre6P determination. At 30°C there was no Tre6P accumulation in the wild type or in the CaTPS2/Catps2{Delta} strain. The estimated Tre6P concentration in these strains was around 100 to 200 µM. This is similar to the level found in wild-type S. cerevisiae cells (6, 24, 52). In the Catps2{Delta}/Catps2{Delta} strain there was a continuous increase in Tre6P at 30°C, and after 4 h more than 5 mM Tre6P was present (Fig. 5). After the shift from 30 to 43°C there was a rapid transient increase in Tre6P levels in the wild type and the heterozygous deletion strain (Fig. 5). The maximum level of about 1 to 2 mM was reached 1 h after the shift. In the heterozygous deletion strain this peak level is twice that in the wild-type strain. The Tre6P increase at 43°C in the homozygous deletion strain was very high and was also more permanent than that in the other strains. Two hours after the shift, the cells contained 35 mM Tre6P, which is more than 1,000-fold higher than the basal level in the wild-type strain (Fig. 5). Sugar phosphates are generally present in concentrations of just a few millimolar in the cytosol. This very high concentration of Tre6P is likely to disturb energy metabolism and is most probably the cause of thermosensitive growth in the homozygous deletion strain.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 5. Tre6P levels during heat treatment. Cells of the wild type (•), CaTPS2/Catps2{Delta} ({blacksquare}), and Catps2{Delta}/Catps2{Delta} ({blacktriangleup}) strains were grown in fresh YPD medium at 30°C for 4 h. The cultures were then divided in two and incubated further at 30 and 43°C. Samples for Tre6P determination were taken at the indicated time points.

 
(v) Yeast-hypha transition. One of the major virulence factors of C. albicans is its ability to undergo a dimorphic switch from the budding yeast form to the hyphal form (26). We have investigated whether deletion of the TPS2 gene interferes with induction of hypha formation. For that purpose, we grew the wild-type, CaTPS2/Catps2{Delta} and Catps2{Delta}/Catps2{Delta} strains as well as the Catps2{Delta}/Catps2 strain with reintegrated TPS2 on different hypha-inducing media. Upon addition of serum to cells in liquid glucose-containing medium at 37°C, there was no difference in hypha formation between the wild type and the mutants. One hour after the shift, 93 to 95% of the cells contained a germ tube, and after 3 h all of the cells underwent the morphological switch. Figure 6 gives an illustration of the morphology 90 min after the addition of fetal calf serum. Germ tube formation is clearly visible in all four strains. Under similar conditions, the Catps1{Delta}/Catps1{Delta} strain was reported to be impaired in the formation of hyphae (54). Next we monitored the morphology of C. albicans colonies on different solid media. Under all conditions tested, we could not see a difference in colony morphology between the wild type and the TPS2 mutant strains. In Fig. 7 we show the results for colonies on solid YPD medium, Spider medium, Lee's medium, and SLAD medium, all incubated at 37°C. On YPD medium, the colonies of the different strains had the shape and morphology reflecting predominant yeast-like growth. On the three other media, the colonies produced filaments at the periphery, and this filamentation was very similar for the different strains. We have also grown colonies on M199 minimal medium and on YPD medium containing serum, and also in those cases we could not see any difference between the wild type and the Catps2{Delta}/Catps2{Delta} strain in the extent of filamentation.



View larger version (123K):
[in this window]
[in a new window]
 
FIG. 6. tps2{Delta}/tps2{Delta} strains are not defective in hyphal development. Overnight cultures of the wild-type (A), CaTPS2/Catps2{Delta} (B), Catps2{Delta}/Catps2{Delta} (C), and reconstituted (D) strains were diluted in fresh YPD medium containing 10% fetal calf serum. Cells were photographed after incubation at 37°C for 90 min.

 


View larger version (79K):
[in this window]
[in a new window]
 
FIG. 7. Influence of CaTPS2 deletion on colony morphology. Cells of the wild-type strain, the heterozygous and homozygous Catps2{Delta} strains, and the reintegrated CaTPS2 strain were grown in YPD medium and diluted to obtain single colonies on plates. The colonies were plated on YPD medium, Lee's medium, Spider medium, and SLAD medium. After 5 days, the colonies were photographed.

 
(vi) Virulence. To determine whether deletion of TPS2 affects virulence of C. albicans, we injected 40 mice (10 per strain) in the caudal vein with 106 cells of the wild-type, CaTPS2/Catps2{Delta}, Catps2{Delta}/Catps2{Delta}, and reconstituted strains. As shown in Fig. 8, mice injected with wild-type C. albicans, with the heterozygous mutant, or with the strain containing the reintegrated CaTPS2 gene died within a period of 4 to 14 days. On the other hand, 50% of the mice infected with the homozygous deletion strain survived this treatment. We have repeated this experiment three more times and obtained similar results each time (not shown). We also injected the mice with 107 or 105 C. albicans cells. When injected with 107 cells, all mice infected with the wild type and the heterozygous deletion strain died within 3 days. Those injected with the homozygous deletion strain were all dead after 5 days. When injected with 105 cells, all of the mice injected with the homozygous deletion strain survived for up to 60 days, whereas 80% of the mice infected with either the wild-type, heterozygous, or TPS2 reintegrated homozygous deletion strain died (data not shown). We also determined the fungal burdens in the kidneys and livers of the dead mice obtained from the experiment shown in Fig. 8. In each case similar numbers of CFU could be isolated for the four different strains (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 8. Survival curves for mice (female BALB/c, 20 g, 10 mice/group) systemically infected with 106 cells of the C. albicans wild-type (•), CaTPS2/Catps2{Delta} ({blacksquare}), Catps2{Delta}/Catps2{Delta} ({blacktriangleup}), or Catps2{Delta}/tps2{Delta} +p CaTPS2 ({blacklozenge}) strains. Similar results were obtained in three independent experiments.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The rationale of this work is based on the following elements: (i) trehalose is known to be an important stress protection compound in fungi, (ii) stress conditions induce the accumulation of trehalose, (iii) pathogenic fungi infecting a host organism are probably subject to constant stress, and (iv) accumulation of the trehalose biosynthesis intermediate Tre6P is toxic. Moreover, the toxic accumulation of Tre6P might itself elicit the stress response, with further accumulation of Tre6P as a consequence and the initiation of a vicious circle which might kill the pathogen. As a result, the second enzyme of trehalose biosynthesis, Tre6P phosphatase, appeared to be a more interesting target for antifungals than the first enzyme, Tre6P synthase. The potential usefulness of Tre6P phosphatase as a target for antifungals is further supported by its absence and the absence of its substrate in mammals, which might facilitate the isolation and/or design of specific inhibitors. Tre6P phosphatase is also an enzyme whose activity can easily be determined in high-throughput assays to screen for inhibitors. Hence, for all of these reasons we have explored the potential use of Tre6P phosphatase as a novel target for antifungals by constructing the homozygous deletion mutant in C. albicans, characterizing it, and determining its virulence.

We have cloned the TPS2 gene of C. albicans based on the homology with the S. cerevisiae gene, and we have constructed the heterozygous and homozygous deletion strains with the Ura blaster method. Several data support proper heterozygous and homozygous deletion of the CaTPS2 gene, including Southern and Northern blotting results and the determination of Tre6P phosphatase activity. The latter was reduced by about 50% in the heterozygous strain and was negligible in the homozygous strain. The latter result appeared to indicate that C. albicans contains very little Tre6P phosphatase activity besides that encoded by the CaTPS2 gene. In S. cerevisiae heat treatment induces dramatic trehalose accumulation in a wild-type strain and Tre6P accumulation in a tps2{Delta} strain (15, 39). As a result the latter strain is temperature sensitive, growth is inhibited, and, as shown in this paper, the cells rapidly die after only a few hours at the high temperature. The latter is an important result, since it indicates that inhibition of Tre6P phosphatase in a fungal pathogen during infection could be fungicidal rather than just fungistatic, at least if there is enough stress response in the fungus to cause a large accumulation of Tre6P. Our results show that the Catps2 homozygous deletion strain is also temperature sensitive and accumulates large amounts of Tre6P at the high temperature. The growth rate at 43°C is strongly reduced, and incubation for more than 6 h at 44°C results in a dramatic drop in viability. This indicates that also in C. albicans hyperaccumulation of Tre6P is probably fungicidal.

Unexpectedly, there was still a significant accumulation of trehalose in the Catps2 homozygous deletion strain at the high temperature. Similar observations have been made for S. cerevisiae and Schizosaccharomyces pombe. Upon deletion of the TPS2 gene in these yeasts, heat-induced trehalose accumulation still amounts to up to 20% of the level accumulated in wild-type cells (19, 55). This indicates that in vivo there must be significant Tre6P phosphatase capacity to sustain this accumulation of trehalose, although in vitro very little Tre6P phosphatase activity can be detected. There are several possible explanations. The alternative, presumably unspecific, phosphatases might be more active at high temperature or at the high Tre6P levels that accumulate in vivo. Also, the depletion of the free phosphate pool in vivo, because of its sequestration into Tre6P, might contribute to higher phosphatase activity in vivo because of reduction in phosphate repression or inhibition of phosphatase enzymes. The significant residual trehalose accumulation in the Catps2{Delta} mutant might explain why the phenotype of the strain was not as stringent as that of the S. cerevisiae tps2{Delta} mutant and less stringent than expected (see below).

We have also investigated whether Tre6P accumulation in itself would evoke the stress response, causing even higher Tre6P accumulation and the initiation of a vicious circle. However, investigation of heat shock protein synthesis in a Catps2{Delta}/Catps2{Delta} strain at 41 or 43°C did not reveal a faster induction of heat shock proteins in spite of the large Tre6P accumulation (results not shown). Hence, it appears that Tre6P accumulation in itself does not induce a stress response.

The homozygous Catps2{Delta} strain was clearly less virulent than the heterozygous and wild-type strains. This supports the rationale of the work, as follows. During infection the pathogen is probably under stress, e.g., because of the defense reactions of the host and an inadequate nutrient supply, etc. This causes a stress response, with Tre6P accumulation as a result. Because of the sequestration of free phosphate and inhibition of glycolysis, this compromises energy metabolism and weakens the pathogen. However, virulence of the homozygous deletion strain was not abolished. This can be due to several reasons. First, the residual trehalose accumulation in this strain at high temperature indicates that also during fungal infection nonspecific phosphatases might help to rescue the homozygous Catps2{Delta} strain from the Tre6P accumulation problem. Second, the stress experienced by the fungus might be lower than we anticipated. Perhaps pathogenic fungi have developed ways to evade stressful reactions and conditions rather than ways to respond more vigorously to such conditions compared to nonpathogenic fungi. An alternative explanation for the reduced virulence of the homozygous Catps2{Delta} strain is possible interference of Tre6P with chitin biosynthesis, as has been shown for Aspergillus nidulans (7). At elevated temperatures when high levels of Tre6P have accumulated, the activity of the first enzyme in chitin biosynthesis (glutamine:fructose-6-phosphate amidotransferase) is reduced in an orlA-disrupted strain (Tre6P phosphatase deficient), and the enzyme itself is labile. For C. albicans it has recently been shown that chitin-deficient (chs3-disrupted) strains are less virulent (8). The reduced virulence of the homozygous Catps2{Delta} strain might actually be due to a combination of impairments in metabolism. Phosphate sequestration and inhibition of hexokinase can impair the flux in glycolysis and proper energy generation, which affects many cellular processes. Moreover, these effects can be exacerbated by the presence of artificially high levels of a metabolite which strongly resembles glucose-6-phosphate and other sugar phosphates in its structure and therefore might also impair processes in which such sugar phosphates are involved.

The dimorphic switch from the yeast form to the filamentous form has been linked to virulence in C. albicans, and much attention has recently been paid to gene products required for the formation of hyphae (12, 20, 30). Also, the Catps1{Delta} mutant was deficient in hypha formation in medium containing glucose and calf serum, which might be related to its reduced virulence (54). Interestingly, the Catps2{Delta} mutant was not affected in hypha formation under any condition tested, indicating that either trehalose, Tre6P, or the C. albicans Tps1 protein might be required in some way for filamentation. Since the TPS1 gene product is involved in the control of glucose influx into glycolysis in S. cerevisiae and other fungi (48), the deficiency in filamentation might be a side effect of impaired glycolytic control. Our results indicate that strains with proper filamentation capacity (at least under in vitro conditions) can still show strong reduction in virulence in vivo.

Is there a potential for Tre6P phosphatase as a target for antifungals? The results that we have obtained for virulence of the homozygous Catps2{Delta} strain are promising but not entirely convincing. Moreover, the use of a Tre6P phosphatase inhibitor as an antifungal drug will never be able to cause complete inhibition of the enzyme as is the case in the Catps2{Delta} strain. Such inhibitors, however, might also act to some extent on the alternative phosphatases that are able to dephosphorylate Tre6P to trehalose, although this might then also cause interference with phosphatases in the mammalian host cells. On the other hand, the systemic infection test in mice is a very stringent test. It is comparable to systemic infection with C. albicans of the bloodstream in humans, which occurs only in terminal patients. It is very well possible that C. albicans experiences more stressful conditions during the initial phases of the infection, for instance, the invasion of tissues. The virulence of the Catps2{Delta} strain might be much more reduced under experimental conditions simulating a natural infection. Another potential promising avenue is the stimulation of combination therapy with existing antifungals and inhibitors of Tre6P phosphatase. It is possible that the presence of antifungals elicits a stress response in C. albicans, stimulating trehalose accumulation in a wild-type strain and as a result triggering higher Tre6P accumulation in the presence of Tre6P phosphatase inhibitors. Hence, Tre6P phosphatase inhibitors might enhance the efficiency of existing antifungals. Because of these reasons, its absence in mammals, the absence of its substrate in mammals, its high specificity, and its highly convenient assay, it appears that Tre6P phosphatase still holds significant potential as a novel target for antifungals.


    ACKNOWLEDGMENTS
 
We gratefully acknowledge the excellent technical assistance of Cindy Colombo and Suzanne Marcelis. Alistair Brown and Mark Ramsdale are acknowledged for providing yeast strains and plasmids and for teaching C. albicans experimental methods.

This work was supported by the Flemish Interuniversity Institute for Biotechnology (VIB/PRJ2), the Research Fund of the Katholieke Universiteit Leuven (Concerted Research Actions), and the European Commission (BIO4-CT98-0268).


    FOOTNOTES
 
* Corresponding author. Mailing address: Flemish Institute for Biotechnology, Katholieke Universiteit Leuven, Laboratory of Molecular Cell Biology, Kasteelpark Arenberg 31, B-3001 Heverlee, Belgium. Phone: 32-16321512. Fax: 32-16321979. E-mail: patrick.vandijck{at}bio.kuleuven.ac.be. Back

Editor: V. J. DiRita


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Alex, L. A., C. Korch, C. P. Selitrennikoff, and M. I. Simon. 1998. COS1, a two-component histidine kinase that is involved in hyphal development in the opportunistic pathogen Candida albicans. Proc. Natl. Acad. Sci. USA 95:7069-7073.[Abstract/Free Full Text]
2. Argüelles, J. C., T. Rodriguez, and F. J. Alvarez-Peral. 1999. Trehalose hydrolysis is not required for human serum-induced dimorphic transition in Candida albicans: evidence from a tps1/tps1 mutant deficient in trehalose synthesis. Res. Microbiol. 150:521-529.[Medline]
3. Bahn, Y.-S., and P. Sundstrom. 2001. CAP1, an adenylate cyclase-associated protein gene, regulates bud-hypha transitions, filamentous growth, and cyclic AMP levels and is required for virulence of Candida albicans. J. Bacteriol. 183:3211-3223.[Abstract/Free Full Text]
4. Bell, W., P. Klaassen, M. Ohnacker, T. Boller, M. Herweijer, P. Schoppink, P. van der Zee, and A. Wiemken. 1992. Characterization of the 56 kDa subunit of the yeast trehalose-6-phosphate synthase and cloning of its gene reveal its identity with the product of CIF1, a regulator of carbon catabolite inactivation. Eur. J. Biochem. 209:951-959.[Medline]
5. Bell, W., W. Sun, S. Hohmann, S. Wera, A. Reinders, C. De Virgilio, A. Wiemken, and J. M. Thevelein. 1998. Composition and functional analysis of the Saccharomyces cerevisiae trehalose synthase complex. J. Biol. Chem. 273:33311-33319.[Abstract/Free Full Text]
6. Blazquez, M. A., R. Lagunas, C. Gancedo, and J. M. Gancedo. 1993. Trehalose-6-phosphate, a new regulator of yeast glycolysis that inhibits hexokinases. FEBS Lett. 329:51-54.[CrossRef][Medline]
7. Borgia, P. T., Y. Miao, and C. L. Dodge. 1996. The orlA gene from Aspergillus nidulans encodes a trehalose-6-phosphate phosphatase necessary for normal growth and chitin synthesis at elevated temperatures. Mol. Microbiol. 20:1287-1296.[Medline]
8. Bulawa, C. E., D. W. Miller, L. K. Henry, and J. M. Becker. 1995. Attenuated virulence of chitin-deficient mutants of Candida albicans. Proc. Natl. Acad. Sci. USA 92:10570-10574.[Abstract/Free Full Text]
9. Buurman, E. T., C. Westwater, B. Hube, A. J. Brown, F. C. Odds, and N. A. R. Gow. 1998. Molecular analysis of CaMnt1p, a mannosyl transferase important for adhesion and virulence of Candida albicans. Proc. Natl. Acad. Sci. USA 95:7670-7675.[Abstract/Free Full Text]
10. Calera, J. A., X. J. Zhao, F. De Bernardis, M. Sheridan, and R. Calderone. 1999. Avirulence of Candida albicans CaHK1 mutants in a murine model of hematogenously disseminated candidiasis. Infect. Immun. 67:4280-4284.[Abstract/Free Full Text]
11. Care, R. S., J. Trevethick, K. M. Binley, and P. E. Sudbery. 1999. The MET3 promoter: a new tool for Candida albicans molecular genetics. Mol. Microbiol. 34:792-798.[CrossRef][Medline]
12. Corner, B. E., and P. T. Magee. 1997. Candida pathogenesis: unraveling the threads of infection. Curr. Biol. 7:R691-R694.[CrossRef][Medline]
13. Crowe, J. H., F. A. Hoekstra, and L. M. Crowe. 1992. Anhydrobiosis. Annu. Rev. Physiol. 54:579-599.[CrossRef][Medline]
14. Csank, C., K. Schroppel, E. Leberer, D. Harcus, O. Mohamed, S. Meloche, D. Y. Thomas, and M. Whiteway. 1998. Roles of the Candida albicans mitogen-activated protein kinase homolog, Cek1p, in hyphal development and systemic candidiasis. Infect. Immun. 66:2713-2721.[Abstract/Free Full Text]
15. De Virgilio, C., N. Buerckert, W. Bell, P. Jeno, T. Boller, and A. Wiemken. 1993. Disruption of TPS2, the gene encoding the 100-kDa subunit of the trehalose-6-phosphate synthase/phosphatase complex in Saccharomyces cerevisiae, causes accumulation of trehalose-6-phosphate and loss of trehalose-6-phosphate phosphatase activity. Eur. J. Biochem. 212:315-323.[Medline]
16. Diez-Orejas, R., G. Molero, F. Navarro-Garcia, J. Pla, C. Nombela, and M. Sanchez-Perez. 1997. Reduced virulence of Candida albicans MKC1 mutants: a role for mitogen-activated protein kinase in pathogenesis. Infect. Immun. 65:833-837.[Abstract]
17. Feng, Q., E. Summers, B. Guo, and G. Fink. 1999. Ras signalling is required for serum-induced hyphal differentiation in Candida albicans. J. Bacteriol. 181:6339-6346.[Abstract/Free Full Text]
18. Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728.[Abstract]
19. Franco, A., T. Soto, J. Vicente-Soler, P. V. Guillen, J. Cansado, and M. Gacto. 2000. Characterization of tpp1+ as encoding a main trehalose-6-phosphate phosphatase in the fission yeast Schizosaccharomyces pombe. J. Bacteriol. 182:5880-5884.[Abstract/Free Full Text]
20. Gale, C. A., C. M. Bendel, M. McClellan, M. Hauser, J. M. Becker, J. Berman, and M. K. Hostetter. 1998. Linkage of adhesion, filamentous growth, and virulence in Candida albicans to a single gene, INT1. Science 279:1355-1358.[Abstract/Free Full Text]
21. Gillum, A. M., E. Y. H. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179-182.[CrossRef][Medline]
22. Goddijn, O. J. M., and K. van Dun. 1999. Trehalose metabolism in plants. Trends Plant Sci. 4:315-319.[CrossRef][Medline]
23. Groll, A. H., S. C. Piscigtelli, and T. J. Walsh. 1998. Clinical pharmacology of systemic antifungal agents: a comprehensive review of agents in clinical use, current investigational compounds, and putative targets for antifungal drug development. Adv. Pharmacol. 44:343-500.
24. Hohmann, S., W. Bell, M. J. Neves, D. Valckx, and J. M. Thevelein. 1996. Evidence for trehalose-6-phosphate-dependent and -independent mechanisms in the control of sugar influx into yeast glycolysis. Mol. Microbiol. 20:981-991.[Medline]
25. Hube, B., D. Sanglard, F. C. Odds, D. Hess, M. Monod, W. Schafer, A. J. Brown, and N. A. R. Gow. 1997. Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence. Infect. Immun. 65:3529-3538.[Abstract]
26. Kobayashi, S. D., and J. E. Cutler. 1998. Candida albicans hyphal formation and virulence: is there a clearly defined role? Trends Microbiol. 6:92-94.[CrossRef][Medline]
27. Leberer, E., K. Ziegelbauer, A. Schmidt, D. Harcus, D. Dignard, J. Ash, L. Johnson, and D. Y. Thomas. 1997. Virulence and hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p. Curr. Biol. 7:539-546.[CrossRef][Medline]
28. Lee, K. L., H. R. Buckley, and C. C. Campbell. 1975. An amino acid liquid synthetic medium for the development of mycelial and yeast forms of Candida albicans. Sabouraudia 13:148-153.[Medline]
29. Leyman, B., P. Van Dijck, and J. M. Thevelein. 2001. An unexpected plethora of trehalose biosynthesis genes in Arabidopsis thaliana. Trends Plant Sci. 6:510-513.[CrossRef][Medline]
30. Lo, H.-J., J. R. Köhler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti, and G. R. Fink. 1997. Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949.[CrossRef][Medline]
31. Luyten, K., W. de Koning, I. Tesseur, M. C. Ruiz, J. Ramos, P. Cobbaert, J. M. Thevelein, and S. Hohmann. 1993. Disruption of the Kluyveromyces lactis GGS1 gene causes inability to grow on glucose and fructose and is suppressed by mutations that reduce sugar uptake. Eur. J. Biochem. 217:701-713.[Medline]
32. Mio, T., T. Yabe, M. Sudoh, Y. Satoh, T. Nakajima, M. Arisawa, and H. Yamada-Okabe. 1996. Role of three chitin synthase genes in the growth of Candida albicans. J. Bacteriol. 178:2416-2419.[Abstract/Free Full Text]
33. Monge, R. A., F. Navarro-Garcia, G. Molero, R. Diez-Orejas, M. Gustin, J. Pla, M. Sanchez, and C. Nombela. 1999. Role of the mitogen-activated protein kinase Hog1p in morphogenesis and virulence of Candida albicans. J. Bacteriol. 181:3058-3068.[Abstract/Free Full Text]
34. Nagahashi, S., T. Mio, N. Ono, T. Yamada-Okabe, M. Arisawa, H. Bussey, and H. Yamada-Okabe. 1998. Isolation of CaSLN1 and CaNIK1, the genes for osmosensing histidine kinase homologues, from the pathogenic fungus Candida albicans. Microbiology 144:425-432.[Abstract]
35. Neely, M. N., and M. A. Ghannoum. 2000. The exciting future of antifungal therapy. Eur. J. Clin. Microbiol. Infect. Dis. 19:897-914.[CrossRef][Medline]
36. Neves, M. J., H. F. Terenzi, F. A. Leone, and J. A. Jorge. 1994. Quantification of trehalose in biological samples with a conidial trehalase from the thermophilic fungus Humicola grisea var. thermoidea. World J. Microbiol. Biotechnol. 10:17-19.
37. Newman, Y. M., S. G. Ring, and C. Colaco. 1993. The role of trehalose and other carbohydrates in biopreservation. Biotechnol. Genet. Eng. Rev. 11:263-294.[Medline]
38. Pan, X., T. Harashima, and J. Heitman. 2000. Signal transduction cascades regulating pseudohyphal differentiation of Saccharomyces cerevisiae. Curr. Opin. Microbiol. 3:567-572.[CrossRef][Medline]
39. Piper, P. W., and A. Lockheart. 1988. A temperature-sensitive mutant of Saccharomyces cerevisiae defective in the specific phosphatase of trehalose biosynthesis. FEMS Microbiol. Lett. 49:245-250.[CrossRef]
40. Sandven, P. 2000. Epidemiology of candidemia. Rev. Iberoam. Micol. 17:73-81.[Medline]
41. Sanglard, D., B. Hube, M. Monod, F. C. Odds, and N. A. R. Gow. 1997. A triple deletion of the secreted aspartyl proteinase genes SAP4, SAP5, and SAP6 of Candida albicans causes attenuated virulence. Infect. Immun. 65:3539-3546.[Abstract]
42. Sarthy, A. V., T. McGonigal, D. Coen, D. J. Frost, J. A. Meulbroek, and R. C. Goldman. 1997. Phenotype in Candida albicans of a disruption of the BGL2 gene encoding a 1,3-ß-glucosyltransferase. Microbiology 143:367-376.[Abstract]
43. Sonneborn, A., D. P. Bockmühl, M. Gerads, K. Kurpanek, S. Sanglard, and J. F. Ernst. 2000. Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans. Mol. Microbiol. 35:386-396.[CrossRef][Medline]
44. Staab, J. F., S. D. Bradway, P. L. Fidel, and P. Sundstrom. 1999. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 283:1535-1538.[Abstract/Free Full Text]
45. Stoldt, V. R., A. Sonneborn, C. E. Leuker, and J. F. Ernst. 1997. Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 16:1982-1991.[CrossRef][Medline]
46. Thaller, M. C., S. Schippa, and G. M. Rossolini. 1998. conserved sequence motifs among bacterial, eukaryotic, and archaeal phosphatases that define a new phosphohydrolase superfamily. Protein Sci. 7:1647-1652.[Abstract]
47. Thevelein, J. M. 1996. Regulation of trehalose metabolism and its relevance to cell growth and function, p. 395-420. In R. Brambl and G. A. Marzluf (ed.), The mycota III: biochemistry and molecular biology. Springer Verlag, Berlin, Germany.
48. Thevelein, J. M., and S. Hohmann. 1995. Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem. Sci. 20:3-10.[CrossRef][Medline]
49. Timpel, C., S. Strahl-Bosinger, K. Ziegelbauer, and J. F. Ernst. 1998. Multiple functions of Pmt1p-mediated protein O-mannosylation in the fungal pathogen Candida albicans. J. Biol. Chem. 273:20837-20846.[Abstract/Free Full Text]
50. Van Aelst, L., S. Hohmann, B. Bulaya, W. de Koning, L. Sierkstra, M. J. Neves, K. Luyten, R. Alijo, J. Ramos, P. Coccetti, E. Martegani, N. M. de Magalhaes-Rocha, R. L. Brandao, P. Van Dijck, M. Vanhalewyn, P. Durnez, A. W. H. Jones, and J. M. Thevelein. 1993. Molecular cloning of a gene involved in glucose sensing in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 8:927-943.[Medline]
51. Van Laere, A. 1989. Trehalose, reserve and/or stress metabolite? FEMS Microbiol. Rev. 63:201-210.[CrossRef]
52. Van Vaeck, C., S. Wera, P. Van Dijck, and J. M. Thevelein. 2001. Analysis and modification of trehalose-6-phosphate levels in the yeast Saccharomyces cerevisiae using Bacillus subtilis phosphotrehalase. Biochem. J. 353:157-162.[CrossRef][Medline]
53. Wiemken, A. 1990. Trehalose in yeast, stress protectant rather than reserve carbohydrate. Antonie Leeuwenhoek 58:209-217.[CrossRef][Medline]
54. Zaragoza, O., M. A. Blazquez, and C. Gancedo. 1998. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases infectivity. J. Bacteriol. 180:3809-3815.[Abstract/Free Full Text]
55. Zentella, R., J. O. Mascorro-Gallardo, P. Van Dijck, J. Folch-Mallol, B. Bonini, C. Van Vaeck, R. Gaxiola, A. A. Covarrubias, J. Nieto-Sotelo, J. M. Thevelein, and G. Iturriaga. 1999. A Selaginella lepidophylla trehalose-6-phosphate synthase complements growth and stress-tolerance defects in a yeast tps1 mutant. Plant Physiol. 119:1473-1482.[Abstract/Free Full Text]


Infection and Immunity, April 2002, p. 1772-1782, Vol. 70, No. 4
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.4.1772-1782.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Dijck, P.
Right arrow Articles by Thevelein, J. M.
Right arrow