IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McCluskey, J.
Right arrow Articles by Smith, D. G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McCluskey, J.
Right arrow Articles by Smith, D. G. E.

 Previous Article  |  Next Article 

Infection and Immunity, June 2002, p. 2899-2907, Vol. 70, No. 6
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.6.2899-2907.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

LsaA, an Antigen Involved in Cell Attachment and Invasion, Is Expressed by Lawsonia intracellularis during Infection In Vitro and In Vivo

Jackie McCluskey,1 Joanne Hannigan,2 Jennifer D. Harris,1 Brendan Wren,3 and David G. E. Smith1*

Zoonotic & Animal Pathogens Research Laboratory, Department of Medical Microbiology,1 Department of Veterinary Pathology, Easter Bush Veterinary Centre, University of Edinburgh, Edinburgh,2 Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, United Kingdom3

Received 6 December 2001/ Returned for modification 22 January 2002/ Accepted 22 February 2002


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lawsonia intracellularis has been identified recently as the etiological agent of proliferative enteropathies, which are characterized by intestinal epithelial hyperplasia and associated moderate immune responses. This disease complex has been reported in a broad range of animals, prevalently in pigs, and L. intracellularis has been linked with ulcerative colitis in humans. L. intracellularis is an obligate intracellular bacterium, and the pathogenic mechanisms used to cause disease are unknown. Using in vitro-grown organisms as a source of genomic DNA, we identified a Lawsonia gene which encodes a surface antigen, LsaA (for Lawsonia surface antigen), associated with attachment to and entry into cells. The deduced amino acid sequence of this protein showed some similarity to members of a novel protein family identified in a number of other bacterial pathogens but for which roles are not fully defined. Transcription of this gene was detected by reverse transcription-PCR in L. intracellularis grown in vitro in IEC18 cells and in bacteria present in ileal tissue from infected animals. Immunohistochemistry with specific monoclonal antibody and immunoblotting with sera from infected animals demonstrated that LsaA protein is synthesized by L. intracellularis during infection. Expression of this gene during infection in vitro and in vivo suggests that this surface antigen is involved during infection, and phenotypic analysis indicated a role during L. intracellularis attachment to and entry into intestinal epithelial cells


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A small number of bacterial pathogens have been identified as causative agents of gastrointestinal epithelial hyperplasia. These comprise Helicobacter species (gastric hyperplasia [3, 20]), Citrobacter rodentium (murine colonic hyperplasia [15, 16, 26, 36]), and Lawsonia intracellularis (proliferative enteropathy [23, 40]). L. intracellularis was only recently recognized as a pathogen and remains poorly characterized in comparison to Helicobacter species and C. rodentium. L. intracellularis is phylogenetically unrelated to other pathogens (13, 34), but it is clearly the causative agent of proliferative enteropathies, which are infectious intestinal hyperplastic diseases of a variety of mammalian and avian species (6, 8, 23). Presently, the disease is recognized as most significant in pigs (23, 40); however, the broad host range of this bacterium includes primates (in which it was recently reported to cause fatal enteritis in captive macaques 22), and it has been suggested to have an etiological role in ulcerative colitis of humans [M. C. L. Pitcher, M. Goddard, S. McOrist, and J. H. Cummings, abstract from the Annu. Meet. Am. Gastroenterol. Assoc. 108(Suppl. 4):A894, 1995].

L. intracellularis is an obligate intracellular bacterial enteropathogen which is most closely related to Desulfovibrio spp. (13) and Bilophila wadsworthia (41). This relationship is based solely on 16S rRNA sequence comparisons, and further similarities between L. intracellularis and these other species have not yet been reported. Pathogenesis of L. intracellularis has not been well investigated; however, organisms cultured in vitro have been used successfully to reproduce the disease in vivo (21, 30, 32, 42, 43). This bacterium has a tropism for intestinal epithelial cells, and the major pathological consequence of infection is hyperplasia of infected epithelial cells (23). An interesting observation with L. intracellularis infections is the reported lack of a significant inflammatory responses (23) and little evidence for dissemination beyond the epithelium, both of which are atypical of infections with other enteroinvasive bacterial pathogens such as salmonellae, shigellae, Listeria monocytogenes, and Clostridium piliforme. The specific bacterial determinants which confer pathogenicity and cause these distinctive pathological effects are not known. Bacterial attachment and entry occur via the apical surface of immature epithelial cells in a process which appears to require a specific bacterial ligand-receptor interaction (33) and an endocytic process involving host cell actin polymerization (24). Once inside the cell, the bacteria escape from the vacuolar compartment into the cytoplasm, where they multiply and spread from cell to cell following cell division (23). At present, the determinants used by L. intracellularis to enter the cell, escape the vacuole, multiply intracytoplasmically, and modulate host cell function are not known.

Molecular characterization of L. intracellularis is rudimentary. Aside from reports of 16S ribosomal DNA sequence, isolation and sequence analysis of one further locus, the groES/EL operon, has been reported as a means to assess the phylogenetic position of L. intracellularis (7). To date, however, no progress has been made in understanding the pathogenic mechanisms of this important pathogen. Despite the use of molecular technologies to further the understanding of the pathogenic mechanisms of a number of important bacterial pathogens (5, 46), the development and use of such techniques to investigate obligately intracellular bacteria have been minimal so far. Here, we applied a range of PCR-based methodologies to identify and characterize a Lawsonia pathogenicity determinant. We sequenced, expressed, and initiated functional examinations of an L. intracellularis surface antigen, which we term LsaA. This factor demonstrated a role during attachment and entry of this bacterium into intestinal epithelial cells, and its expression was monitored in vitro and in vivo using reverse transcription-PCR (RT-PCR) and immunochemical procedures. This study represents the first study of gene expression and characterization of a pathogenicity determinant of this obligate intracellular pathogen.

(This work was presented in part at the 101st General Meeting of the American Society for Microbiology, 2001.)


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Bacterial strains and culture conditions. L. intracellularis strains LR189/83, LI916/91, LI1482/89, LI51/89, and LI963/93 were used during this study. Routine coculture of the strains in a rat enterocyte cell line and estimation of bacterial numbers were performed essentially as described previously (25). Escherichia coli TOP10 (Invitrogen), DH5{alpha}, and XL1-Blue were used for maintaining recombinant plasmids and were routinely cultured on Luria-Bertani medium supplemented with ampicillin (100 µg ml-1) or kanamycin (50 µg ml-1) when appropriate. E. coli BL21 and BL21(DE3)pLysS were host strains for expression of recombinant LsaA fusion proteins. Strains were grown on Luria-Bertani medium containing ampicillin (50 µg ml-1) alone or in combination with chloramphenicol (35 µg ml-1). For hemolysis assays BL21 strains were grown under appropriate selection and inducing conditions on freshly prepared blood agar plates.

General molecular methods. Chromosomal DNA was extracted from L. intracellularis strains by using a method described previously (28). Essentially, approximately 108 bacteria were harvested by centrifugation at 11,500 x g for 5 min. Pelleted cells were resuspended in 600 µl of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) supplemented with 0.5% (wt/vol) sodium dodecyl sulfate and 100 µg of proteinase K ml-1 and incubated for 1 h at 37°C. One hundred microliters of 5 M NaCl and 80 µl of cetyltrimethylammonium bromide-NaCl was then added, and incubation was continued for a further 10 min at 65°C. Extraction with chloroform-isoamyl alcohol (24:1; Sigma) and phenol-chloroform-isoamyl alcohol (25:24:1; Sigma) preceded DNA precipitation in ethanol by centrifugation at 13,000 x g for 15 min at 4°C. Alternatively, to isolate both DNA and RNA, Qiagen RNA and DNA isolation kits were used. Plasmid DNA was prepared using Qiagen miniprep columns. PCR products were ligated into plasmids pCR Blunt II-TOPO or pCR 4-TOPO (Invitrogen) as directed by the manufacturer. Restriction enzyme digestions were performed by standard techniques (28) using enzymes supplied by Promega. DNA transfer to nylon membranes (Boehringer Mannheim) and Southern blot hybridization were performed as described previously (28). Degenerate oligonucleotide primer PCR (DOP-PCR) was performed essentially as described previously (48) with primers DOP-for (CGCTGCAGCNTCNACNGGNGGNGGNTTTAC) and DOP-rev (CCAAGCTTCNGCCTCGAACTGNGGCTT). L. intracellularis DNA (100 ng) was added to a 100-µl PCR mixture consisting of 10 mM Tris-HCl (pH 8.3), 2.5 mM MgCl2, 50 mM deoxyribonucleotides, a 25 µM concentration of each primer, and 1 U of Taq polymerase (Gibco BRL). PCRs were performed for 40 cycles of 1 min at 94°C, 1 min at 40°C, and 2 min at 72°C, in a Genius thermocycler (Techne). The amplified products were analyzed directly by agarose gel electrophoresis (28). Specific DNA probes were digoxigenin labeled using the DNA DIG Labeling Kit (Boehringer Mannheim). The probes used in this study were PCR amplified using lsaA-specific forward and reverse primers LI05 and LI02 (CTAGTTTACGCTTTAGATGTT and CGCTGCAGCGAATCATCATTAGTTTT, respectively) and 16S rRNA-specific primers 16Sfor and16Srev (TAACGCGTTAAGCAC and AGGGTTGCGCTCGTTG, respectively) (6). The relative positions of primers LI02 and LI05 and other lsaA-specific primers are presented schematically in Fig. 1. Gel images were captured using the AlphaImager system (Flowgen) and processed through PaintShop Pro6.



View larger version (8K):
[in this window]
[in a new window]
  		FIG. 1. Schematic representation of the L. intracellularis lsaA gene. Relative positions and directions of primers used for PCR amplifications are shown with arrows. Primers DOP-for and DOP-rev were used for DOP-PCR. Primers LI02 and LI05 were used in RT-PCR and the first stage of semirandom PCR chromosome walking in combination with random primer AP1 or AP2 (not shown). Primers LI15 and LI14 were used as nested primers with SPI in second-stage semirandom PCR chromosome walking. Primers LI19-for and LI-end1 were used to amplify complete the lsaA gene. Primer sequences and amplification conditions are indicated in the text.

 
Semirandom PCR chromosome walking. An adaptation of a method described previously (12, 37) was used to isolate and sequence the DNA flanking the partial sequence determined by DOP-PCR. This method involved the use of 5'-biotinylated specific primer LI05b or LI02b (sequences are given above) derived from the partial sequence in conjunction with arbitrary primer AP1 (GGGAATTCTATGAAGTTTATAACCCNNTGGACCGC) or AP2 (GGGAATTCTATGAAGTTTATAACCCNNNNTGCGCG). Primary PCR amplification involved 35 cycles of 1 min at 94°C, 1 min at 55°C, and 2 min at 72°C. The biotinylated PCR products generated represented a sequenced region with unknown upstream (from primer LI02b) or downstream (from primer LI05b) flanking sequence. Biotinylated single-stranded DNA molecules were immobilized on streptavidin-coated paramagnetic beads (Dynabeads M-280 Streptavidin; Dynal AS, Oslo, Norway), and, following NaOH elution of the DNA, a secondary PCR was performed with nested primers LI14 or LI15 with SPI. LI14 and LI15 (TATTATTAAAGCCTCAATTTGAAGC and GCTCAACAACTTTATAAACTTCTT, respectively) represent lsaA-specific primers (Fig. 1), while SPI (GGGAATTCTATGAAGTTTATAACCC) represents the 25-bp segment from the 5' ends of both AP1 and AP2. Products obtained from this second round of PCR were analyzed by gel electrophoresis, purified, polished, and cloned into pCR Blunt II-TOPO for sequencing.

Sequencing and sequence analysis. PCR products were cloned into pCR Blunt II-TOPO or pCR 4-TOPO (Invitrogen) for automated sequencing from both strands using an ABI PRISM DYE Terminator Cycle Sequencing Kit (Perkin-Elmer) on a model 373A Sequence System (Applied Biosystems). Sequences obtained from overlapping products from both DOP-PCR (i.e., target gene internal fragment) and semirandom PCR chromosome walking (i.e., regions flanking the partial sequence) were assembled using DNASTAR. Data were obtained from multiple reads of the region, permitting validation of sequences obtained on different occasions. Once sequence information from overlapping PCR products was obtained, the complete lsaA gene was amplified with specifically designed primers LI19-for and LI-end1 (ATGGGGATCCATGAAAAAAAGC and CCTGCAGATATCAAGGAATATATTCTG, respectively), cloned, and sequenced for further confirmation of data. Sequence analyses were carried out using programs BLASTN, BLASTX, and CLUSTAL W (National Center for Biotechnology Information, Los Alamos, N.Mex.) available on the Internet.

Cloning, expression, and purification of recombinant LsaA. The full-length lsaA gene was amplified from Lawsonia by using primers LI19-for and LI-end1 (sequences are given above), which incorporate BamHI and PstI sites, respectively. The PCR product was ligated into pCR 4-TOPO (Invitrogen) according to the manufacturer's directions and transformed into E. coli TOP10. Plasmids were purified and, following confirmation of clones by restriction digestion and sequencing, further digested for subcloning into expression vectors. For cloning as a His fusion, pCR 4-TOPO containing complete lsaA was digested with BamHI and PstI and subjected to agarose gel electrophoresis, and the band of appropriate size was purified from the gel (GeneClean). The purified product was ligated into pRSETA (Invitrogen) which was restriction digested and purified similarly. For cloning as a glutathione S-transferase (GST) fusion, pCR 4-TOPO containing complete lsaA was digested with BamHI and EcoRI, electrophoresed, and purified as described above. The purified product was ligated into pGEX-4T-2 (Amersham Pharmacia Biotech) which was restriction digested and purified similarly. Plasmids containing inserts were termed pHLsaA and pGLsaA, respectively. The insert was sequenced to confirm both the lsaA sequence and in-frame cloning. For expression, pHLsaA and pGLsaA were transformed into E. coli BL21(DE3)pLysS or BL21, and transformants were cultured and induced as described by the supplier. His and GST fusion proteins were purified using the Xpress (Invitrogen) and GSTrap (Amersham Pharmacia Biotech) protein purification systems, respectively.

RT-PCR. Total RNA was extracted from purified L. intracellularis or from Lawsonia-infected pig ileum by using RNA-DNA purification columns (Qiagen). The infected pig ileal tissue was obtained from an experimental challenge of pigs performed for related investigations (30). The methods of RNA isolation were essentially the same in both cases, although when infected tissue was used as the starting material, a more rigorous homogenization was performed. Total RNA was treated with RNase-free DNase I (Sigma) for 15 min at 37°C, after which DNase I was heat inactivated by incubation at 65°C for 10 min. RNA (100 ng) was denatured by incubation at 65°C for 10 min prior to reverse transcription in a mixture (20 µl) which contained 1x buffer, 5 mM deoxynucleoside triphosphates, 25 µM primer, 10 U of RNase inhibitor, and 4 U of Omniscript reverse transcriptase (Qiagen) and was incubated at 37°C for 60 min. The primers LI02 and 16Srev were used to reverse transcribe Lawsonia lsaA or 16S rRNA, respectively. Ten microliters of the cDNA was then used for the PCRs with primers LI02 and LI05 for lsaA or 16Sfor and 16Srev for 16S rRNA transcripts. PCRs were carried out under standard conditions with Taq polymerase, and products were analyzed using acrylamide gel analysis to increase the sensitivity of detection (28).

Experimental infection of animals and monitoring of infection. Experimental challenges of both mice and pigs (30, 42) were carried out for related investigations of pathogenicity and immune responses during L. intracellularis infection. Small and large intestines were removed post mortem; short regions were fixed in 10% neutral buffered formalin for immunohistochemical analysis, and the remainder was frozen rapidly and stored at -70°C for preparation of DNA and RNA (see above). Immunohistochemical detection of L. intracellularis in fixed tissues was performed as described previously (42). Polyclonal rabbit antiserum (1080/76) or mouse monoclonal antibody VPM53 (25, 31) was used as the primary antibody, and detection was performed using the relevant secondary antibody systems (Mouse-on-Mouse or VectaStain ABC systems [Vector Labs]) according to the manufacturer's instructions. Following this, sections were counterstained with hematoxylin and then mounted in DePex (Merck). Tissues were examined histologically for features typical of L. intracellularis infection, i.e., intestinal epithelial hyperplasia and immunoreactive intracellular bacteria (L. intracellularis).

Immunoblotting. Blood from experimentally challenged and control animals (30, 42) was placed in heparinized vessels and then centrifuged (10,000 x g, 1 min) to remove cellular components prior to removal of plasma to fresh vials for storage at -20°C. Plasma samples were diluted 1:200 in phosphate-buffered saline (PBS) for immunoblotting. Hyperimmune polyclonal rabbit antiserum (1080/76) and monoclonal antibody VPM53 (specific for L. intracellularis strains) were used as control antibodies. Antigen [recombinant LsaA-His fusion purified from E. coli BL21(DE3)pLysS] (approximately 2.5 µg per lane) was electrophoresed on a 12.5% acrylamide gel over the whole gel width and then transferred to nitrocellulose membranes by using an Ancos Semidry blotter. Nitrocellulose membranes were assembled into a parallel blotting assembly (Bio-Rad). Molecular size standards were included routinely on gels, and after transfer to nitrocellulose membrane, lanes were excised and stained with amido black to determine molecular sizes of antigens. Incubation of membranes with primary antibody (plasma diluted 1:200) was carried out for 1 h with gentle shaking, after which it was aspirated. Wells were washed three times with PBS, and then secondary antibody (horseradish peroxidase-conjugated anti-mouse immunoglobulin; Serotec) diluted 1:4,000 was added and left for a further hour. This was removed, and membranes were washed again as described above. Membranes were then removed from the slot blot assembly, washed a further three times in PBS and once in distilled water, and then developed by addition of substrate (diaminobenzidine; Sigma). Once developed, blots were dried and photographed, and images were captured and processed as for agarose and acrylamide gels.

Hemolysin assays. Hemolysin assays were carried out in both agar and fluid formats (39). For agar assays, E. coli clones transformed with pHLsaA or pGLsaA or vectors without insert were cultured on blood agar plates with appropriate selection and induction and monitored for hemolysis for up to 72 h. In microtiter format, purified recombinant LsaA fusion proteins (up to 100 µg ml-1) in PBS were incubated with a 1% suspension of washed sheep erythrocytes for 2 or 24 h. Positive (PBS containing 1% Triton X-100) and negative (PBS) controls were incorporated. Following incubation, cell suspensions were centrifuged (10,000 x g, 2 min) to remove unlysed cells, and then hemoglobin release was monitored by measuring absorbance at 570 nm in a spectrophotometer (Cecil CE2021).

Nucleotide sequence accession number. The nucleotide sequence of the lsaA locus has been placed in the GenBank database under accession number AF498259.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Initial identification of L. intracellularis locus. DOP-PCR using L. intracellularis (LR189/83) genomic DNA resulted in a product of approximately 300 bp, which corresponded to that expected from the designed primers. Following initial identification of this partial gene in L. intracellularis LR189/83, we examined other available Lawsonia isolates for the presence of this determinant. Genomic DNAs from strains LI916/91, LI1482/89 , LI51/89, and LI963/93 were extracted and used as templates in DOP-PCR. Genomic DNAs from E. coli (DH5{alpha}) and Brachyspira hyodysenteriae were used as negative and positive controls, respectively. Products of 300 bp were amplified from all five strains of L. intracellularis examined (data not shown) and also from positive control DNA from B. hyodysenteriae, while no product was visible from the E. coli DNA. Thus, it appears that all available L. intracellularis isolates possess the genomic region representing this locus. Having detected this locus, we proceeded to determine the sequence around this 300-bp region. Semirandom PCR chromosome walking with biotinylated specific primers allowed amplification of DNA sequences adjacent to the region initially obtained. Arbitrary primers used in conjunction with biotinylated primer LI02b or LI05b amplified upstream and downstream flanking regions, respectively. Using this approach, sequences for adjacent upstream (ca. 1-kbp) and downstream (ca. 400-bp) regions were obtained to give a region of ca. 1.7 kbp.

Sequence comparison and analysis of L. intracellularis gene product. Sequence analysis of the ca. 1.7-kbp region showed only one complete putative open reading frame (ORF) which encompassed the original DOP-PCR product. Sequence comparisons of the deduced amino acid sequence of this putative ORF using BLASTX showed some similarity with a family of bacterial proteins and putative proteins for which B. hyodysenteriae TlyA represents the prototype (27, 35, 44). Regions upstream and downstream from this putative ORF revealed similarities to three other bacterial sequences (deoB, nusB, and nifS); however, none of these represented possible complete ORFs. Sequences with similarity to tlyA are present within the genomes of a diverse range of bacteria, including Mycoplasma pulmonis (4), Mycoplasma hyopneumoniae (GenBank accession no. AAG46052), B. hyodysenteriae (27, 35, 44), Rickettsia prowazekii (2), Ureaplasma urealyticum (14), Streptococcus pyogenes (10), Borrelia burgdorferi (11), Helicobacter pylori (1, 29, 45), Campylobacter jejuni (38), Mycobacterium tuberculosis (47), and Mycobacterium leprae (9). The L. intracellularis ORF showed greatest similarity to homologues in two Mycoplasma species, M. pulmonis (53.3% identity) and M. hyopneumoniae (49.6% identity), which are phylogenetically distinct from Lawsonia. Alignment of the deduced amino acid sequence of the L. intracellularis ORF with those of M. pulmonis and M. hyopneumoniae is shown in Fig. 2a.



View larger version (66K):
[in this window]
[in a new window]
  		FIG. 2. Sequence comparison of the L. intracellularis LsaA protein. The deduced amino acid sequence of L. intracellularis LsaA was aligned with TlyA sequences from other bacteria by using CLUSTAL W. Amino acids are written in single-letter convention; asterisks, colons, and periods represent identical, conserved, and semiconserved residues, respectively. (a) Alignment with M. pulmonis (Mpulm) (accession number NP326002) and M. hyopneumoniae (Mhyo) (accession number AAG46052). (b) Alignment with B. hyodysenteriae (Bhyo) (accession number Q06803), M. tuberculosis (Mtb) (accession number X98295), and H. pylori (Hp26695) (accession number AAD08129).

 
Members of this protein family from B. hyodysenteriae (18, 19, 27, 35, 44), H. pylori (29), and M. tuberculosis (47), conferred a hemolytic phenotype in native organisms and/or when cloned into E. coli; however, the activities of other members of this group have not yet been reported and their suggested function remains presumptive. The L. intracellularis gene was expressed in E. coli recipients as either GST or His fusion proteins; however, neither purified recombinant fusion proteins nor E. coli clones expressing either of these fusion products were hemolytic on blood agar under any conditions assessed, including aerobic, microaerophilic, and anaerobic environments. The deduced amino acid sequence of the L. intracellularis ORF exhibited only low homology to the TlyA proteins from B. hyodysenteriae, H. pylori, and M. tuberculosis (36.7, 31.7 to 33.8, and 26.5% identity, respectively). The heterogeneity (see Fig. 2b for alignment comparison) between these protein sequences is sufficient to suggest that gene products from this locus may differ in their specific activities, as is evident from this study. Indeed, since most members of this family have been deduced from genome sequencing, their expression and function remain to be fully ascertained.

Monoclonal antibody VPM53 to L. intracellularis reacted with purified recombinant ORFA-His fusion (Fig. 3). This antibody recognized a surface protein of L. intracellularis of approximately 27 kDa (25, 31-33), which corresponds closely to the calculated molecular mass of this gene product (27.4 kDa) based on the deduced amino acid sequence. Both the monoclonal antibody and its Fab fragment substantially inhibited L. intracellularis in vitro infectivity, to below 10 and 1%, respectively (33), indicating a role for this product in attachment to and/or invasion of intestinal epithelial cells, a phenotype which was not predicted from sequence comparison. The terminology lsaA-LsaA, for Lawsonia surface antigen A, is proposed for this gene and its product.



View larger version (116K):
[in this window]
[in a new window]
  		FIG. 3. Reactivity of LsaA with monoclonal antibody and sera from infected animals. Monoclonal antibody VPM53 and rabbit hyperimmune polyclonal serum 1080/76 (lanes 1 and 3, respectively) reacted with recombinant LsaA (ca. 27 kDa). Lanes 2 and 4, control lanes incubated with labeled anti-mouse or anti-rabbit secondary antibody but without primary antibody. Sera from animals experimentally infected with L. intracellularis (lanes 5 to 7) reacted specifically with LsaA, whereas sera from uninfected animals (lanes 8 to 10) did not; induction of specific antibodies indicates that LsaA was expressed during infection. Lane 11, control lane incubated with labeled anti-mouse antibody but without primary antibody. Lane 12, molecular size standards separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to nitrocellulose as for LsaA and then removed and stained with amido black. Sizes (in kilodaltons) are indicated at the right.

 
L. intracellularis gene expression in vitro and in vivo. To examine whether the L. intracellularis lsaA gene was transcribed during infection in vitro and in vivo, RT-PCR was performed on total RNAs extracted from Lawsonia-infected IEC18 cells and from Lawsonia-infected pig ileal tissue. Both the IEC18 cells and the ileal tissue were positive for L. intracellularis by immunological analysis with Lawsonia-specific monoclonal antibody VPM53 (data not shown). To confirm the presence of Lawsonia, DNA was extracted from L. intracellularis-infected IEC18 cells or tissue and used as the template in an initial PCR with 16S rRNA- and lsaA-specific primers. Both genes were detected (Fig. 4a and 5a and b), confirming that these bacteria were present and thus enabling us to proceed with the transcriptional analysis. Primers for detecting transcription of the Lawsonia 16S rRNA gene (6) were used as an intrinsic control reaction for RT-PCR, as this gene product represents a housekeeping gene which provides an essential function and is presumably transcribed constitutively during bacterial growth. To perform RT-PCR with prokaryotes with any certainty that the signal(s) obtained does indeed arise from transcripts, stringent controls need to be applied: RNA preparations were treated exhaustively with RNase-free DNase to remove residual DNA, and furthermore, in all analyses controls with no reverse transcription were included.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 4. Transcriptional analysis of 16S rRNA (odd-numbered lanes) and lsaA (even-numbered lanes) in L. intracellularis grown in vitro. (a) The presence of L. intracellularis in infected IEC18 cells was confirmed by conventional PCR amplification of 16S rRNA and lsaA from extracted DNA. (b) RT-PCR with 16S rRNA- or lsaA-specific primers detected transcripts for both 16S rRNA and lsaA in RNA extracted from IEC18 cells infected with L. intracellularis. (c and d) Products obtained from RT-PCR amplification of 16S rRNA and lsaA were separated by electrophoresis and transferred to a nylon membrane for Southern blotting. Blotting was performed with digoxigenin-labeled 16S rRNA-specific (c) or lsaA-specific (d) probes, and the presence of single bands in each panel confirmed the specificity of the RT-PCR.

 


View larger version (82K):
[in this window]
[in a new window]
  		FIG. 5. Transcriptional analysis of 16S rRNA and lsaA during infection in vivo. (a and b) Conventional PCR amplification of 16S rRNA (a) and lsaA (b) was performed with DNA extracted from ileum of L. intracellularis-infected (lanes 1 to 5) and uninfected (lanes 6 to 9) animals. Amplification products of 600 and 300 bp for 16S rRNA and/or lsaA, respectively, were evident only in DNA from infected animals. (c to f) Transcriptional analysis of L. intracellularis 16S rRNA (c and d) and lsaA (e and f) in RNA extracted from L. intracellularis-infected animals L1 (lanes 1 and 2), L2 (lanes 3 and 4), L3 (lanes 5 and 6), L4 (lanes 7 and 8), and L5 (lanes 9 and 10). Odd-numbered lanes indicate RT-PCRs in which reverse transcriptase was incorporated, while even-numbered lanes represent the reaction without reverse transcriptase (control). Products were separated by polyacrylamide gel electrophoresis. Only the relevant regions of the gels are shown. RT-PCR with primers specific for 16S rRNA (c) was confirmed by Southern blotting with a 16S rRNA probe (d) and that with primers specific for lsaA (e) was confirmed by Southern blotting with an lsaA probe (f).

 
RT-PCR showed that 16S rRNA was transcribed in bacteria grown in IEC18 cells (Fig. 4b); a product of the predicted size (600 bp) was obtained, confirming the presence of metabolically active bacteria. RT-PCR with lsaA primers revealed a product of the predicted size (approximately 300 bp) (Fig. 4b) indicating transcription of this gene by replicating bacteria. No product was obtained when the reverse transcription step was omitted, confirming that the product was due to the presence of the mRNA transcript and not to contaminating DNA. Further evidence to support the specificity of the RT-PCR products was obtained by Southern blot analysis with digoxigenin-labeled 16S rRNA and lsaA probes (Fig. 4c and d). The 16S rRNA probe hybridized only to the 16S rRNA-derived product, and likewise, the lsaA probe hybridized only to the lsaA-derived product. These findings indicated that L. intracellularis expressed 16S rRNA as well as lsaA mRNA when grown in vitro.

Analysis of lsaA transcription in vivo by RT-PCR using Lawsonia-infected and uninfected pig tissue requires similar stringency. Tissues obtained from animals determined to be infected (L1 to L5) or uninfected (N1 to N4) by immunohistochemical detection (data not shown) were used for DNA and RNA extraction. Like for infected cell monolayers, the presence of 16S rRNA and lsaA genes (and hence bacteria) was determined by conventional PCR analysis with DNA as the template. Animals assessed as infected by immunohistochemistry also demonstrated the presence of 16S rRNA and lsaA PCR products, whereas uninfected animals did not (Fig. 5a and b) did not. We proceeded to examine these animals for transcripts of 16S rRNA and lsaA by using highly purified RNA extracted from the infected pig tissue. Products were obtained with both the 16S rRNA-specific and lsaA-specific primers in all samples from infected animals (Fig. 5c and e, respectively) but not in those from uninfected animals. Again the reactions with no reverse transcription produced no products, confirming the absence of contaminating DNA. The specificity of these products was shown by Southern analysis as before (Fig. 5d and f). RT-PCR therefore demonstrated that Lawsonia 16S rRNA and lsaA were transcribed by these bacteria in the in vivo environment.

The region upstream from the proposed start codon of the Lawsonia lsaA was examined for motifs typical of promoter regions; however, neither conventional sigma factor consensus sites nor ribosome-binding sites were identified. This may reflect peculiarities in gene regulation and expression in this bacterium as a result of its phylogenetic position and its lifestyle. Further analysis is required to fully characterize promoter regions of this and other genes of this bacterium.

To determine whether LsaA protein was expressed by L. intracellularis during infection, two immunochemical approaches were taken. First, sera from mice experimentally infected with L. intracellularis LR189/5/83 (42) were examined by immunoblotting for antibodies to purified recombinant LsaA. The results showed that uninfected mice did not possess antibodies to this protein, whereas animals infected with L. intracellularis did (Fig. 3). Similar results were obtained with sera from experimentally infected pigs (data not shown). The mounting of a specific serum immune response by animals orally inoculated with L. intracellularis demonstrated that this protein is indeed expressed during infection. Further evidence that LsaA was expressed during infection was obtained with monoclonal antibody VPM53, which reacted with intracellular L. intracellularis in situ in both cell culture and infected animals (Fig. 6). As described above, this antibody specifically recognizes LsaA (Fig. 3), which is a ca. 27-kDa surface antigen of this bacterium. Together, the results from these immunochemical studies confirm that LsaA is expressed by L. intracellularis under both in vitro and in vivo circumstances.



View larger version (75K):
[in this window]
[in a new window]
  		FIG. 6. Expression of LsaA by L. intracellularis during infection. L. intracellularis cultured either in vitro in IEC18 cells (left panel) or in infected intestinal epithelium (right panel) reacted with monoclonal antibody VPM53, which recognizes LsaA (Fig. 3). Immunohistochemical detection shows L. intracellularis as more darkly staining cells and aggregates. Examples of heavily infected cells and intestinal crypts are indicated by arrowheads, and uninfected cells and crypts are indicated by asterisks. Typically, infection of crypts is accompanied by epithelial hyperplasia, whereas adjacent uninfected crypts show normal structure as seen in the right panel.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Obligate intracellular bacteria represent a diverse group of organisms, among which are many important pathogens. Although genome sequencing of some has recently been completed or is under way, functional analyses must still follow. Like for other obligate intracellular bacteria, the absence of established molecular techniques for studying L. intracellularis has hindered developments in our understanding of the pathogenesis of this unique bacterium. An objective of this study was to circumvent these problems and apply methodologies to assess gene expression in this organism. Since methods for genetic manipulation of L. intracellularis (and other obligate intracellular bacteria) such as reporter fusions or mutagenesis are rudimentary, we applied PCR-based methods, as these are both specific and sensitive. These considerations are of utmost importance, as the number of bacteria available was often limiting due to the highly fastidious, obligate intracellular nature of L. intracellularis.

We identified and sequenced an L. intracellularis ORF by using DOP-PCR and semirandom PCR chromosome walking and have termed this ORF lsaA, since it encodes a Lawsonia surface antigen which we have shown to be associated with attachment to and/or entry into epithelial cells. Identification of this gene was followed by examination of its expression and initial assessment of its function during infection. RT-PCR has been the method used most widely to monitor gene expression in obligate intracellular bacteria, and its application detected gene transcription by L. intracellularis in both in vitro (infected IEC18 cells) and in vivo (tissue from infected animals) environments. Our results clearly show that both genes encoding 16S rRNA and lsaA are transcribed during infection of intestinal epithelial cells in vitro (Fig. 4). Conditions are much more complex in vivo, and expression of genes may differ from that in in vitro environments; therefore, we examined expression of these genes in ileal tissue from infected pigs. Similar to infection in vitro, transcripts specific to both 16S rRNA and lsaA were detected (Fig. 5). Detection of 16S rRNA- and lsaA-specific transcripts indicated that these genes were expressed and suggested that both are functional during infection. The former clearly performs an essential role in protein synthesis and is presumably transcribed by metabolically active bacteria, whereas understanding of a role(s) for the latter was part of this investigation.

Although it is generally considered that transcription and translation are coupled in bacteria, expression of LsaA protein itself was assessed as a confirmatory procedure. We demonstrated that monoclonal antibody VPM53 recognized recombinant LsaA (Fig. 3), thus facilitating the study of protein expression by immunochemical means. This anti-LsaA monoclonal antibody reacted with intracellular L. intracellularis grown in epithelial cell monolayers or in infected intestinal tissue (Fig. 6); thus, LsaA is expressed under conditions prevailing during both in vitro and in vivo infection. Further corroboratory evidence for expression of LsaA in vivo was obtained from animals (pigs and mice) orally inoculated with L. intracellularis: plasma from infected animals contained antibodies recognizing recombinant LsaA (Fig. 3), thus confirming that LsaA protein was expressed by L. intracellularis during infection.

Demonstration of protein expression does not, in itself, confirm a function(s) or role(s) in pathogenesis; therefore, possible phenotypic characteristics of LsaA were assessed. The deduced amino acid sequence of LsaA was compared to sequence databases. LsaA demonstrated low, though notable, similarity to bacterial proteins within the recently identified TlyA family which are present in a range of phylogenetically diverse bacterial pathogens. Amino acid identity ranged from ca. 50% with M. pulmonis (4) and M. hyopneumoniae (GenBank accession no. AAG46052) to approximately 23% with M. leprae (9); thus, these proteins (and deduced proteins) show much sequence diversity, and such heterogeneity may be of significance.

Although sequence heterogeneity is evident, the presence of representatives of this protein family among these bacteria presumably reflects an important function for these bacteria. To date, homologues from only three bacterial species, i.e., B. hyodysenteriae, M. tuberculosis, and H. pylori, have been examined functionally. Among the activities conferred by TlyA cloned from these bacteria was hemolysis (18, 29, 35, 44, 47); however, neither recombinant E. coli clones expressing L. intracellularis LsaA nor purified recombinant LsaA protein exhibited a hemolytic phenotype. Since there is significant amino acid sequence divergence between the B. hyodysenteriae (36.7% identity [35]), H. pylori (33.8% identity for strain 26995 [29, 45] and 31.7% identity for strain J99 [1]), and M. tuberculosis (26.5% identity [47]) gene products and that of L. intracellularis, this distinct phenotype should perhaps not be entirely unexpected. Recently it was proposed that rather than directly conferring a hemolytic phenotype, TlyA may be a regulatory factor (17), a suggestion which is corroborated through sequence similarities of the N-terminal region of this protein with nucleic acid binding proteins. Irrespective of its specific function, TlyA deletion mutants pf B. hyodysenteriae are significantly attenuated (19) and similarly, H. pylori TlyA mutants show reduced colonization of mice (29); however, a similar function has yet to be ascribed to this gene product in M. tuberculosis.

These proteins evidently confer pathogenicity-associated characteristics, although specific activities and functions need to be examined further. Our own studies of phenotypic characteristics of L. intracellularis LsaA suggest a function for this protein in interaction with epithelial cells. In this study we have shown that L. intracellularis-specific monoclonal antibody VPM53 recognized LsaA, a protein of ca. 27 kDa. This monoclonal antibody also demonstrated reactivity with a bacterial outer membrane component of 27 kDa (31, 32); thus, LsaA is a surface-associated antigen. Furthermore, this anti-LsaA monoclonal antibody inhibited L. intracellularis infection of intestinal epithelial cells in vitro (33), therefore blocking a specific ligand-receptor interaction, with the ligand being LsaA. Similarly, the TlyA orthologue of H. pylori was shown to have significance in adherence to gastric epithelial cells (29), and although its direct involvement in association with epithelium was not examined, that report corroborates our own findings that members of this family may act as possible colonization factors.

Together, our accumulated information indicates that LsaA is a surface molecule of L. intracellularis which plays a role early in infection, presumably conferring adherence and/or invasion. Involvement of LsaA in attachment and/or entry was not anticipated from primary structure comparison, and with the demonstration of this phenotype, it is clear that the function(s) of this protein family requires further elucidation. Since most of the other members of this group of presumed proteins have been identified from genome sequencing, their expression remains presumptive and phenotypes remain to be examined; thus, potential role(s) has yet to be fully defined.

This is the first report of an L. intracellularis factor implicated as a pathogenicity determinant, and its identification has furthered our understanding of the mechanisms of infection of this bacterium. In this study we have identified lsaA as a gene which is both transcribed and translated by L. intracellularis during infection. This is the first direct demonstration of expression of any gene in this novel species of obligate intracellular bacteria and represents a significant initial step in more detailed analyses of expression and regulation of this and other L. intracellularis genes, including those encoding potential pathogenicity determinants. Although further analysis will be required to define fully the role of this factor, our results indicate that LsaA is important in the pathogenesis of L. intracellularis, as it is evidently involved during attachment to and/or invasion of epithelial cells.


   ACKNOWLEDGMENTS
 
We are grateful to the Biotechnology and Biological Sciences Research Council (BBSRC) of the United Kingdom for funding this work. J. Hannigan's study towards M.Sc. qualifications was supported, in part, by the Animal Health Trust.

We thank I. Bennett for sequencing of clones; N. MacIntyre, S. Mitchell, and S. Rhind for their contributions to in vivo studies; and the staff of the Experimental Pathogens Unit for their excellent technical support (all from the Department of Veterinary Pathology, University of Edinburgh).


   FOOTNOTES
 
* Corresponding author. Mailing address: Zoonotic & Animal Pathogens Research Laboratory, Department of Medical Microbiology, University of Edinburgh, Scotland EH8 9AG, United Kingdom. Phone: (44) 131 651 1343. Fax: (44) 131 650 6531. E-mail: dgesmith{at}vet.ed.ac.uk. Back

Editor: J. T. Barbieri


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Alm, R. A., L. S. L. Ling, D. T. Moir, B. L. King, E. D. Brown, P. C. Doig, D. R. Smith, B. Noonan, B. C. Guild, B. L. deJonge, G. Carmel, P. J. Tummino, A. Caruso, M. Uria-Nickelsen, D. M. Mills, C. Ives, R. Gibson, D. Merberg, S. D. Mills, Q. Jiang, D. E. Taylor, G. F. Vovis, and T. J. Trust. 1999. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397:176-180.[CrossRef][Medline]
2. Andersson, S. G., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten, U. C. Alsmark, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H. Winkler, and C. G. Kurland. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133-140.[CrossRef][Medline]
3. Bourke, B., and N. L. Jones. 2001. Pathogenesis of Helicobacter pylori infection. Curr. Opin. Gastroenterol. 17:24-29.
4. Chambaud, I., R. Heilig, S. Ferris, V. Barbe, D. Samson, F. Galisson, I. Moszer, K. Dybvig, H. Wroblewski, A. Viari, E. P. C. Rocha, and A. Blanchard. 2001. The complete genome sequence of the murine respiratory pathogen Mycoplasma pulmonis. Nucleic Acids Res. 29:2145-2153.[Abstract/Free Full Text]
5. Chiang, S. L., J. J. Mekalanos, and D. W. Holden. 1999. In vivo genetic analysis of bacterial virulence. Annu. Rev. Microbiol. 53:129-154.[CrossRef][Medline]
6. Cooper, D. M., D. L. Swanson, S. M. Barns, and C. J. Gebhart. 1997. Comparison of the 16S ribosomal DNA sequences from the intracellular agents of proliferative enteritis in a hamster, deer, and ostrich with the sequence of a porcine isolate of Lawsonia intracellularis. Int. J. Syst. Bacteriol. 47:635-639.[Abstract/Free Full Text]
7. Dale, C. J. H., E. K. Moses, C. C. Ong, C. J. Morrow, M. B. Reed, D. Hasse, and R. A. Strugnell. 1998. Identification and sequencing of the groE operon and flanking genes of Lawsonia intracellularis: use in phylogeny. Microbiology. 144:2073-2084.[Medline]
8. Duhamel, G. E., E. C. Klein, R. O. Elder, and C. J. Gebhart. 1998. Subclinical proliferative enteropathy in sentinel rabbits associated with Lawsonia intracellularis. Vet. Pathol. 35:300-303.[Abstract]
9. Eiglmeier, K., N. Honore, S. A. Woods, B. Caudron, and S. T. Cole. 1993. Use of an ordered cosmid library to deduce the genomic organization of Mycobacterium leprae. Mol. Microbiol. 7:197-206.[CrossRef][Medline]
10. Ferretti, J. J., W. M. McShan, D. Adjic, D. Savic, G. Savic, K. Lyon, C. Primeaux, S. S. Sezate, A. N. Surorov, S. Kenton, H. Lai, S. Lin, Y. Qian, H. G. Jia, F. Z. Najar, Q. Ren, H. Zhu, L. Song, J. White, X. Yuan, S. W. Clifton, B. A. Roe, and R. E. McLaughlin. 2001. Complete genome sequence of an M1 strain of Streptococcus pyogenes. Proc. Natl. Acad. Sci. USA 98:4658-4663.[Abstract/Free Full Text]
11. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochete, Borrelia burgdorferi. Nature 390:580-586.[CrossRef][Medline]
12. Ge, Y. G., and N. W. Charon. 1997. Identification of a large motility operon in Borrelia burgdorferi by semi-random PCR chromosome walking. Gene 189:195-201.[CrossRef][Medline]
13. Gebhart, C. J., S. M. Barns, S. McOrist, G. F. Lin, and G. H. K. Lawson. 1993. Ileal symbiont intracellularis, an obligate intracellular bacterium of porcine intestines showing a relationship to Desulfovibrio species. Int. J. Syst. Bacteriol. 43:533-538.[Abstract/Free Full Text]
14. Glass, J. I., E. J. Lefkowitz, J. S. Glass, C. R. Heiner, E. Y. Chen, and G. H. Cassell. 2000. The complete sequence of the mucosal pathogen Ureaplasma urealyticum. Nature 407:757-762.[CrossRef][Medline]
15. Higgins, L. M., G. Frankel, I. Connerton, N. S. Goncalves, G. Dougan, and T. T. MacDonald. 1999. Role of bacterial intimin in colonic hyperplasia and inflammation. Science 285:588-591.[Abstract/Free Full Text]
16. Higgins, L. M., G. Frankel, G. Douce, G. Dougan, and T. T. MacDonald. 1999. Citrobacter rodentium infection in mice elicits a mucosal Th1 cytokine response and lesions similar to those in murine inflammatory bowel disease. Infect. Immun. 67:3031-3039.[Abstract/Free Full Text]
17. Hsu, T., D. L. Hutto, F. C. Minion, R. L. Zuerner, and M. J. Wannemuehler. 2001. Cloning of a beta-hemolysin gene of Brachyspira (Serpulina) hyodysenteriae and its expression in Escherichia coli. Infect. Immun. 69:706-711.[Abstract/Free Full Text]
18. Hyatt, D. R., and L. A. Joens. 1997. Analysis of the lytic activity of the Serpulina hyodysenteriae hemolysin. Infect. Immun. 65:4877-4879.[Abstract]
19. Hyatt, D. R., A. A. H. M. ter Huurne, B. A. M. van der Zeijst, and L. A. Joens. 1994. Reduced virulence of Serpulina hyodysenteria hemolysin-negative mutants in pigs and their potential to protect pigs against challenge with a virulent strain. Infect. Immun. 62:2244-2248.[Abstract/Free Full Text]
20. Israel, D. A., and R. M. Peek. 2001. Pathogenesis of Helicobacter pylori-induced gastric inflammation. Aliment. Pharmacol. Ther. 15:1271-1290.[CrossRef][Medline]
21. Joens, L. A., S. Nibbelink, and R. D. Glock. 1997. Induction of gross and microscopic lesions of porcine proliferative enteritis by Lawsonia intracellularis. Am. J. Vet. Res. 58:1125-1131.[Medline]
22. Klein, E. C., C. J. Gebhart, and G. E. Duhamel. 1999. Fatal outbreaks of proliferative enteritis caused by Lawsonia intracellularis in young colony-raised rhesus macaques. J. Med. Primatol. 28:11-18.[Medline]
23. Lawson, G. H. K., and C. J. Gebhart. 2000. Proliferative enteropathy. J. Comp. Pathol. 122:77-100.[CrossRef][Medline]
24. Lawson, G. H. K., R. A. Mackie, D. G. E. Smith, and S. McOrist. 1995. Infection of cultured rat enterocytes by ileal symbiont intracellularis depends on host-cell function and actin polymerization. Vet. Microbiol. 45:339-350.[CrossRef][Medline]
25. Lawson, G. H. K., S. McOrist, S. Jasni, and R. A. Mackie. 1993. Intracellular bacteria of porcine proliferative enteropathy: cultivation and maintenance in vitro. J. Clin. Microbiol. 31:1136-1142.[Abstract/Free Full Text]
26. Luperchio, S. A., and D. B. Schauer. 2001. Molecular pathogenesis of Citrobacter rodentium and transmissible murine colonic hyperplasia. Microbes Infect. 3:333-340.[CrossRef][Medline]
27. Lysons, R. J., K. A. Kent, A. P. Bland, R. Sellwood, W. F. Robinson, and A. J. Frost. 1991. A cytotoxic hemolysin from Treponema hyodysenteriae--a probable virulence determinant in swine dysentery. J. Med. Microbiol. 34:97-102.[Abstract]
28. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
29. Martino, M. C., R. A. Stabler, Z. W. Zhang, M. J. G. Farthing, B. W. Wren, and N. Dorrell. 2001. Helicobacter pylori pore-forming cytolysin orthologue tlyA possesses in vitro hemolytic activity and has a role in colonization of the gastric mucosa. Infect. Immun. 69:1697-1703.[Abstract/Free Full Text]
30. McIntyre, N. 2001. Immunological and cellular alterations in pig intestine after inoculation with Lawsonia intracellularis. Fellowship of the Institute of Biomedical Science thesis. University of Edinburgh, Edinburgh, United Kingdom.
31. McOrist, S., R. Boid, and G. H. K. Lawson. 1989. Antigenic analysis of Campylobacter species and an intracellular Campylobacter-like organism associated with porcine proliferative enteropathies. Infect. Immun. 57:957-962.[Abstract/Free Full Text]
32. McOrist, S., G. H. K. Lawson, A. C. Rowland, and N. MacIntyre. 1989. Early lesions of proliferative enteritis in pigs and hamsters. Vet. Pathol. 26:260-264[Abstract]
33. McOrist, S., R. A. Mackie, G. H. K. Lawson, and D. G. E. Smith. 1997. In vitro interactions of Lawsonia intracellularis with cultured enterocytes. Vet. Microbiol. 54:385-392.[CrossRef][Medline]
34. McOrist, S., C. J. Gebhart, R. Boid, and S. M. Barns. 1995. Characterization of Lawsonia intracellularis gen. nov., sp. nov., the obligately intracellular bacterium of porcine proliferative enteropathy. Int. J. Syst. Bacteriol. 45:820-825.[Abstract/Free Full Text]
35. Muir, S., M. B. Koopman, S. J. Libby, L. A. Joens, F. Heffron, and J. G. Kusters. 1992. Cloning and expression of a Serpulina (Treponema) hyodysenteriae hemolysin gene. Infect. Immun. 60:529-535.[Abstract/Free Full Text]
36. Newman, J. V., B. A. Zabel, S. S. Jha, and D. B. Schauer. 1999. Citrobacter rodentium espB is necessary for signal transduction and for infection of laboratory mice. Infect. Immun. 67:6019-6025.[Abstract/Free Full Text]
37. Nguyen, T. N., P. Samuelson, F. Sterky, C. Merle-Poitte, A. Robert, T. Baussant, J. F. Haeuw, M. Uhlen, H. Binz, and S. Stahl. 1998. Chromosomal sequencing using a PCR-based biotin-capture method allowed isolation of the complete gene for the outer membrane protein A of Klebsiella pneumoniae. Gene 210:93-101.[CrossRef][Medline]
38. Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham, T. Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. Karlyshev, S. Moule, M. J. Pallen, C. W. Penn, M. Quail, M. A. Rajandream, K. M. Rutherford, A. VanVliet, S. Whitehead, and B. G. Barrell. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature 403:665-668.[CrossRef][Medline]
39. Rowe, G. E., and R. A. Welch. 1994. Assays of hemolytic toxins. Methods Enzymol. 235:657-667.[Medline]
40. Rowland, A. C., and G. H. K. Lawson. 1992. Porcine proliferative enteropathies, p. 560-569. In A. D. Leman, B. E. Straw, W. L. Mengeling, S. D'Allaire, and D. J. Taylor (ed.), Diseases of swine, 7th ed. Iowa State University Press, Ames.
41. Sapico, F. L., D. Reeves, H. M. Wexler, J. Duncan, K. H. Wilson, and S. M. Finegold. 1994. Preliminary study using species-specific oligonucleotide probe for ribosomal RNA of Bilophila wadsworthia. J. Clin. Microbiol. 32:2510-2513.[Abstract/Free Full Text]
42. Smith, D. G. E., S. M. Mitchell, T. Nash, and S. Rhind. 2000. Interferon gamma influences intestinal epithelial hyperplasia caused by Lawsonia intracellularis infection in mice. Infect. Immun 68:6737-6743.[Abstract/Free Full Text]
43. Smith, S. H., and S. McOrist. 1997. Development of persistent intestinal infection and excretion of Lawsonia intracellularis by piglets. Res. Vet. Sci. 62:6-10.[CrossRef][Medline]
44. Ter Huurne, A. A. H. M., S. Muir, M. van Houten, B. A. M. van der Zeijst, W. Gaastra, and J. G. Kusters. 1994. Characterization of three putative Serpulina hyodysenteriae hemolysins. Microb. Pathog. 16:269-282.[CrossRef][Medline]
45. Tomb, J. F., O. White, A. R. Kerlavage, R. A. Clayton, G. G. Sutton, R. D. Fleischmann, K. A. Ketchum, H. P. Klenk, S. Gill, B. A. Dougherty, K. Nelson, J. Quackenbush, L. X. Zhou, E. F. Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K. McKenney, L. M. Fitzegerald, N. Lee, M. D. Adams, E. K. Hickey, D. E. Berg, J. D. Gocayne, T. R. Utterback, J. D. Peterson, J. M. Kelley, M. D. Cotton, J. M. Weidman, C. Fujii, C. Bowman, L. Watthey, E. Wallin, W. S. Hayes, M. Borodovsky, P. D. Karp, H. O. Smith, C. M. Fraser, and J. C. Venter. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547.[CrossRef][Medline]
46. Valdivia, R. H., and S. Falkow. 1997. Probing bacterial gene expression within host cells. Trends Microbiol. 5:360-363.[CrossRef][Medline]
47. Wren, B. W., R. A. Stabler, S. S. Das, P. D. Butcher, J. A. Mangan, J. D. Clarke, N. Casali, T. Parish, and N. G. Stoker. 1998. Characterization of a haemolysin from Mycobacterium tuberculosis with homology to a virulence factor of Serpulina hyodysenteriae. Microbiology 144:1205-1211.[Medline]
48. Wren, B. W., S. M. Colby, R. R. Cubberley, and M. J. Pallen. 1992. Degenerate PCR primers for the amplification of fragments from genes encoding response regulators from a range of pathogenic bacteria. FEMS Microbiol. Lett. 78:287-291.[Medline]

Infection and Immunity, June 2002, p. 2899-2907, Vol. 70, No. 6
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.6.2899-2907.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McCluskey, J.
Right arrow Articles by Smith, D. G. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McCluskey, J.
Right arrow Articles by Smith, D. G. E.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals