Previous Article | Next Article ![]()
Infection and Immunity, July 2002, p. 3355-3362, Vol. 70, No. 7
0019-9567/02/$04.00+0 DOI: 10.1128/IAI.70.7.3355-3362.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Zhiqi Liu,,
Anna Finucane, Roger Parton, and John Coote*
Infection and Immunity Division, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow, United Kingdom
Received 13 August 2001/ Returned for modification 14 September 2001/ Accepted 2 April 2002
|
|
|---|
|
|
|---|
Naturally acquired immunity is common among survivors of HS outbreaks, and consequently, animals up to 2 years old are most susceptible. The nature of the immune responses to P. multocida is poorly understood, and the relative contributions of cellular immunity and humoral immunity to long-term protection have not been established. It is not known where the organism lodges and multiplies during the early clinical phase of HS, although HS pathogenesis involves rapid translocation of bacteria from the respiratory tract to the blood and lymph. In attempts to mimic natural infection and to elicit long-term humoral and cellular immunity, live vaccines have been developed (22), but these vaccines are ill-defined and of questionable safety.
Live attenuated vaccines in general have the advantage of a natural route of entry into the host, which allows targeting of immunostimulatory factors to the same sites of the immune system that occur in the natural infection. The aroA gene encodes 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase, which is involved in the conversion of shikimic acid to chorismic acid, a common intermediate in the biosynthesis of aromatic amino acids. Mutation in the aroA gene creates a dependence for growth on aromatic compounds that are not available in the host, as this pathway is not operative in mammalian cells. This means that aroA mutants are capable of only limited replication before they are cleared from the host. Attenuated aroA mutants of P. multocida serotype A, which causes fowl cholera, have been described (14, 15) and have been shown to provide protection against challenge in chickens (28). However, serotype A strains do not cross-protect against challenge with serotype B strains (1, 2, 26). The aims of this work were to construct defined mutations in the aroA genes of two serotype B:2 strains, to test these strains in a mouse experimental model to determine their degree of attenuation and their protective properties, and to compare the mutant derivatives with the parent strains for spread and persistence within the host.
|
|
|---|
-hydroxybenzoic acid, each at a concentration of 10 µg ml-1. Escherichia coli strains were grown in Luria broth in flasks shaken at 150 rpm at 37°C or on Luria agar containing 1% (wt/vol) agar. For E. coli hosts containing low-copy-number plasmids, such as pAKA19 and pEG18.3, Terrific broth (30) supplemented with 1% (wt/vol) yeast nitrogen base (Difco) was used to improve the plasmid yield. Antibiotics (Sigma) were used at the following concentrations: ampicillin, 50 µg ml-1; chloramphenicol, 30 µg ml-1; tetracycline, 15 µg ml-1; kanamycin, 50 µg ml-1; and streptomycin, 100 µg ml-1. |
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids
|
(field strength, 10 kV cm-1) for E. coli and at 2.5 kV, 25 µF, and 400
(field strength, 25 kV cm-1) for P. multocida. Following electroporation, cells were incubated in broth medium for 1 h in the case of E. coli and for 3 h in the case of P. multocida before aliquots of the cell suspension were spread on the appropriate antibiotic selective agar. Conjugation was performed by plate mating late-exponential-growth-phase cultures as described previously (5). For this purpose, spontaneous streptomycin-resistant derivatives of the parent P. multocida strains were isolated and used as recipients to select against the E. coli strain used as the donor.
Construction of aroA mutants of P. multocida HS strains.
Forward and reverse primers were designed from the aroA sequence of P. multocida serotype A:1 strain PBA100 (14; GenBank accession number Z14100). The aroA genes of P. multocida strains 85020 and Quetta were amplified by PCR as 1.2-kb amplimers by using forward primer AroA1 (TTACTCTCAATCCCATCAGC; nucleotides 315 to 334) and reverse primer AroA2 (ACAATGCGATTAAAGCAAAG; nucleotides 1495 to 1514). The PCR products were purified and cloned into pCR2.1-TOPO. For transfer of cloned genes to P. multocida, the aroA fragments were removed as BamHI/XhoI fragments and cloned into the suicide vector pAKA19 cut with the same enzymes. A cassette encoding kanamycin resistance (Kmr) was removed as a 1.24-kb PstI fragment (nucleotides 421 to 1661) from plasmid pUC4K (Pharmacia) and inserted into the aroA genes at a unique NsiI site (nucleotide 718). Allelic exchange of the Kmr-disrupted aroA genes with the native genes in the P. multocida chromosome was successfully achieved with strain 85020 by electroporation and with the Smr Quetta strain by conjugation. For the latter procedure, the plasmid was first transferred to E. coli SM10
pir by electroporation. Aliquots of bacteria were spread onto BHI blood agar containing only kanamycin for strain 85020 and kanamycin plus streptomycin for Smr strain Quetta in order to select Kmr and Kmr Smr colonies, respectively. For each strain, 50 single colonies were picked and subcultured on BHI blood agar containing kanamycin for 5 days to encourage loss of the pAKA19 plasmid and exchange of the aroA::Kmr insert with the native aroA gene on the recipient chromosome. Chromosomal DNA was then prepared from at least 20 single clones of each strain and checked by PCR by using the AroA1 and AroA2 primers. Clones designated P. multocida JRMT1 for the 85020 strain and JRMT2 for the Quetta Smr strain were chosen for further study. Each of these clones produced
2.4-kb amplimers, the pattern of PCR amplimers predicted after allelic exchange with the aroA allele containing the Kmr insert, while
1.2-kb amplimers were produced by the parent strains (data not shown).
Marker-free aroA deletion derivatives of the 85020 and Quetta strains were constructed by removing a 142-bp internal AflII/SacII fragment (nucleotides 938 to 1080) from the aroA genes cloned in pCR2.1-TOPO. The deleted genes were exchanged with the wild-type alleles in the chromosome by using the sacB-based allelic exchange procedure (25). The deleted aroA genes were first cloned into pAKA19 as 1.05-kb BamHI/XhoI fragments, and the 3.8-kb Kmr-sacBR cassette from pEG18.3 was then introduced into the constructs at the BamHI site. These plasmids were transferred to P. multocida strains by electroporation, and Kmr colonies were selected after incubation for 48 h on BHI blood agar containing kanamycin. This first step selected for clones in which recombination at the aroA sequence had incorporated the whole plasmid into the recipient chromosome. Resulting colonies were patched onto BHI blood agar containing 5% (wt/vol) sucrose. After incubation for 48 h, sucrose-resistant colonies exhibiting a nonmucoid phenotype were picked and tested for the Kms phenotype, which was indicative of loss of vector sequences. Sucrose-resistant and Kms colonies were then screened by PCR by using the AroA1 and AroA2 primers. Clones designated P. multocida JRMT12 for the 85020 strain and P. multocida JRMT13 for the Quetta strain were chosen for further study. Each of these clones produced amplimers of the predicted size,1.05 kb for the deleted aroA gene, compared with the
1.2-kb amplimer for the native gene (data not shown).
The Bacillus subtilis sacBR genes encode a levansucrase whose expression in the presence of sucrose is lethal in most gram-negative bacteria. This feature provides positive selection for directed allelic exchange of unmarked mutations (25). Sucrose metabolism via expression of sacB in P. multocida creates a mucoid and liquefied colony phenotype after 48 h of incubation that has been reported previously (18), but the authors indicated that sucrose metabolism via expression of sacB was not lethal in P. multocida serogroup A1 and therefore not useful as a positive selection procedure for allelic exchange. However, in our hands, lack of expression of sacB and the resulting absence of the mucoid phenotype in the presence of sucrose acted as a good indicator of allelic exchange and loss of the vector sequences containing the sacB gene.
Southern blot hybridization. Southern blot hybridization was done by standard procedures (3) by using a nylon membrane (Hybond N+; Amersham Pharmacia Biotech, Little Chalfont, United Kingdom) for DNA transfer from agarose gels and DNA probes labeled with a digoxigenin (DIG) random priming kit (Boehringer, Mannheim, Germany) according to the manufacturer's instructions. Hybridization was performed in a rolling hybridization oven (Techne, Cambridge, United Kingdom) under high-stringency conditions, and DIG-labeled hybrid DNA was detected with anti-DIG-alkaline phosphatase conjugate antibody and a DIG luminescence detection kit (Boehringer, Lewes, United Kingdom). Blots were exposed to photosensitive film (X-ray film; Kodak, Hemel Hempstead, United Kingdom) for up to 1 h.
Enzyme assay.
EPSP synthase was assayed by the reverse reaction (19). This reaction couples phosphenolpyruvate release from EPSP to the pyruvate kinase and lactic dehydrogenase reactions and measures NADH oxidation at 340 nm (
= 6,220 M-1 cm-1). One unit of activity oxidized 1 nmol of NADH per min at 25°C. EPSP was kindly provided by J. R. Coggins (Glasgow University), and pyruvate kinase and lactic dehydrogenase were obtained from Boehringer. Cell extracts were prepared from exponential-phase cultures of P. multocida strains grown in BHI broth. Cells were harvested by centrifugation, resuspended (10%, wt/vol) in 100 mM KH2PO4 (pH 7.0), and lysed by sonication (three times, 20 s each) with intermittent cooling. Interfering NADH oxidase activity present in crude extracts was minimized by preparing cytoplasmic S100 extracts by centrifugation at 100,000 x g for 2 h (19). Supernatants were stored at -20°C. Protein concentrations were determined by using a bicinchoninic acid protein assay kit (Pierce Chemical Co., Rockford, Ill.).
Virulence and protection tests.
The mouse provides a good model for HS infection as it manifests a septicemic form of disease similar to HS in the natural hosts (6, 9). Groups of female BALB/c mice (Harlan Olac, Bicester, United Kingdom) that were 5 to 6 weeks old were used for the first set of experiments involving aroA strains JRMT1 and JRMT2, and groups of female BALB/c mice that were 6 to 7 weeks old were used for the second set of experiments involving aroA strain JRMT12. Mice were injected intraperitoneally (i.p.) with 500 µl of 10-fold serial dilutions in phosphate-buffered saline (PBS) of exponential-phase cultures (E540nm,
1) grown in BHI broth. For intranasal (i.n.) inoculation, the method of Rushton (27) was used. Mice were anesthetized with halothane, and 50 µl of an appropriate bacterial dilution was applied to the nares and allowed to be inhaled. s.c. vaccination was done by injecting 200 µl of an appropriate bacterial dilution into the nape of the neck of an anesthetized mouse. Mice were weighed daily and checked regularly for up to 10 days, and the mice which became moribund were euthanized in accordance with animal ethics guidelines. For virulence determinations, a 50% lethal dose (LD50) was estimated by direct observation of dose-response data. For collection of blood samples and internal organs, mice were sacrificed and samples were collected aseptically in preweighed bottles. Organs were homogenized in 10-ml portions of PBS, and 10-fold serial dilutions were plated on BHI blood agar and incubated overnight at 37°C. For mouse protection tests, groups of mice vaccinated with attenuated mutant strains were challenged 2 weeks later with different doses of the P. multocida 85020 and Quetta parent strains. Numbers of survivors were recorded at 6 days postchallenge.
|
|
|---|
0.8). The parent strains had an E540nm of
0.9 in PMM alone.
Genomic DNA was prepared from the parent and mutant strains. In the case of JRMT1 and JRMT2 the DNA was digested with EcoRV, and a Southern blot was probed with an aroA probe (the aroA gene of P. multocida 85020 amplified by PCR and DIG labeled) and with the Kmr cassette (the PstI fragment of plasmid pUC4K). The aroA probe hybridized to two bands at
1.6 and
1.8 kb in the EcoRV-digested DNA from the parent strains, confirming the presence of an EcoRV site in the aroA gene (nucleotide 931) (Fig. 1A), and no hybridization was detected with the Kmr probe (Fig. 1B). For the mutant strains, two bands at
1.8 and
2.8 kb were visible with the aroA probe (Fig. 1A), and the Kmr probe hybridized only with the larger band (Fig. 1B). This confirmed insertion of the Kmr cassette into the section of aroA represented by the 1.6-kb EcoRV fragment. For Southern blot analysis of JRMT12 and JRMT13, chromosomal DNA was digested with EarI (the EarI site at position 1052 in the native aroA gene was removed by the 142-bp internal AflII/SacII deletion) and, following electrophoresis and blotting onto a membrane, was hybridized with the aroA probe used previously. The probe hybridized to two bands at
1.3 and
1.6 kb for the parent strains, a pattern predicted from internal digestion of the native aroA gene by EarI, but to only one band at
2.75 kb for the aroA deletion mutants (Fig. 2), a pattern predicted after removal of the internal fragment containing the EarI site from the native gene.
![]() View larger version (45K): [in a new window] |
FIG. 1. Southern blot analysis of parent and aroA derivatives JMRT1 and JMRT2. Chromosomal DNA prepared from parent and mutant strains was digested with EcoRV, separated by electrophoresis, and transferred to a nylon membrane. (A) Hybridization with an aroA probe prepared by PCR with the AroA1 and AroA2 primers from chromosomal DNA of the 85020 parent strain. (B) Hybridization with a Kmr cassette prepared from plasmid pUC4K. Lanes 1, aroA derivative JRMT1; lanes 2, parent strain 85020; lanes 3, aroA derivative JRMT2; lanes 4, parent strain Quetta. The positions of size markers (in kilobases) are indicated between the blots.
|
![]() View larger version (104K): [in a new window] |
FIG. 2. Southern blot analysis of parent and aroA derivatives JMRT12 and JMRT13. Chromosomal DNA prepared from parent and mutant strains was digested with EarI, separated by electrophoresis, and transferred to a nylon membrane. The blot was hybridized with an aroA probe prepared by PCR with the AroA1 and AroA2 primers from chromosomal DNA of the 85020 parent strain. Lane 1, parent strain 85020; lane 2, aroA derivative JRMT12; lane 3, parent strain Quetta; lane 4, aroA derivative JRMT13. The positions of size markers (in kilobases) are indicated on the right.
|
Mouse virulence tests with aroA strains JRMT1 and JRMT2. Initial tests were done with the 85020 parent strain and the aroA derivative JRMT1, and groups of mice were injected i.p. with graded doses of these strains. The parent strain, 85020, was highly virulent by this route (Table 2) and could kill mice within 1 to 2 days with a very small inoculum. The aroA derivative, JRMT1, was greatly attenuated. LD50s of <20 CFU per mouse for the parent strain and >3 x 108 CFU per mouse for JRMT1 were obtained. Similar results were obtained with the Quetta strain and its aroA derivative, JRMT2 (Table 2). The toxicity of very high doses of the attenuated strain was evident from experiment 2 (Table 2), in which all of the mice injected with 3 x 109 CFU died within 48 h. Mice given 3 x 108 CFU showed some weight loss during the first day postchallenge, but by the second day all of these mice had recovered their original weight (data not shown).
|
View this table: [in a new window] |
TABLE 2. Mouse virulence testsa
|
103 CFU/mouse. For the aroA mutant derivative JRMT1, the LD50 delivered by the s.c. and i.n. routes was >2 x 109 CFU per mouse, and no obvious toxicity was noted at the highest dose tested (2 x 109 CFU per mouse). Similar results were obtained with the Quetta parent strain and its aroA derivative, JRMT2, except that the Quetta strain appeared to be less virulent than strain 85020 when it was delivered by the i.n. route (the LD50 was
105 CFU per mouse for the Quetta strain, compared to
103 CFU per mouse for strain 85020) (data not shown). |
View this table: [in a new window] |
TABLE 3. Mouse virulence tests in which different routes of inoculation were useda
|
107 CFU per mouse was used as it offered good protection and resulted in no apparent toxicity. The protective properties of the aroA strains after inoculation via different routes and with one-and two-dose vaccination regimens were compared. Mice given two doses of 2 x 107 CFU of JRMT1 i.p. or i.n. were completely protected against i.p. challenge after an additional 2 weeks with high doses (1,000 or 10,000 LD50s) of the parent 85020 strain (Table 4). In fact, one i.p. inoculation of JRMT1 was sufficient to protect all the mice against challenge. However, this was not the case for i.n. inoculation of JRMT1 followed by i.p. challenge, where two doses were required for full protection. With the s.c. route of inoculation, mice given one dose of JRMT1 showed no protection and mice given two doses showed some protection, but this was the least efficient route examined. Similar results were obtained after vaccination with JRMT2 and challenge with the parent Quetta strain (data not shown). Good cross-protection by each aroA mutant against challenge with the heterologous parent strain was also evident (Table 4 and data not shown). |
View this table: [in a new window] |
TABLE 4. Protective properties of aroA mutant JRMT1 inoculated by different routesa
|
|
View this table: [in a new window] |
TABLE 5. Effects of different vaccination routes and different challenge routesa
|
|
View this table: [in a new window] |
TABLE 6. Virulence and protective properties of aroA mutant JRMT12a
|
|
View this table: [in a new window] |
TABLE 7. Viable counts of P. multocida strains in different organs following inoculation by two different routesa
|
|
|
|---|
For the constructs JRMT1 and JRMT2, repeated subculturing in the presence of kanamycin but in the absence of ampicillin was sufficient to promote loss of the vector plasmid. When the attenuated and protective properties of these strains were established, marker-free aroA mutants containing a deletion of a central portion of the aroA gene were constructed. Selection for allelic exchange with the native aroA sequence on the P. multocida chromosome was done by using sucrose sensitivity as a marker for elimination of vector sequences carrying the sacB gene. These strains are more suitable as vaccine candidates than the strains containing the Kmr insert in the aroA gene as they possess no antibiotic-encoding genes and deletion within the aroA gene eliminates the possibility of reversion to the wild type.
HS working parties set up by the United Nations Food and Agricultural Organisation have recommended the use of the mouse for testing new HS vaccines (6). Survival of mice and the LD50s demonstrated that the P. multocida aroA mutants are highly attenuated for virulence and for colonization and persistence in internal organs compared to the wild-type parent strains. When inoculated i.p. or i.n. into mice, the aroA mutant strains showed an obvious loss of virulence, and no illness was observed following administration of 107 and 109 CFU per mouse by the i.p. and i.n. routes, respectively. This compares with LD50s of less than 20 and 103 CFU per mouse for the parent strains inoculated by the i.p. and i.n. routes, respectively. The inability to isolate the aroA mutants from peripheral blood of mice 48 h after i.p. injection indicated that these strains had greatly reduced abilities to spread and survive in vivo.
Immunization with two i.p. or i.n. doses of P. multocida JRMT1 (aroA mutant of strain 85020) completely protected mice against homologous and heterologous i.p. challenge with 1,000 LD50s of the wild-type strains (Table 4). Similar results were obtained after vaccination with JRMT2 (aroA mutant of strain Quetta) followed by challenge with either parent strain. The route of natural infection by P. multocida is probably via the respiratory tract. However, unlike i.p. inoculation, one i.n. dose of live aroA vaccine of either strain induced relatively poor levels of protection against i.p. challenge with the homologous wild-type P. multocida strains. This protection was not affected by increasing the time between vaccination and challenge. However, mice vaccinated i.n. with a single dose were better protected against challenge via the same route (Tables 5 and 6). After a second dose of live cells inoculated i.n., there was a sharp increase in the number of survivors from a homologous or heterologous i.p. challenge (Table 4). Mice given two doses s.c. showed only partial protection against challenge, but a single s.c. dose provided no protection against challenge by any route examined. Thus, the route of inoculation has a significant effect on the protective efficacy of attenuated aroA strains in the mouse model.
The BALB/c mice were highly susceptible to infection by wild-type P. multocida B:2 strains whether they were introduced i.p. or i.n.. The growth of the challenge organism in the liver, lung, spleen, and blood was quantified daily for up to 4 days. P. multocida parent strains were able to multiply very rapidly in vivo, so that introduction of a small number of viable bacteria into the peritoneal cavities of nonvaccinated mice quickly resulted in an in vivo population of >109 viable organisms per g of liver, lung, spleen, or blood, which resulted in death of the mice within 36 h. As suggested by Collins (8), it is probable that unrestricted extracellular growth of the unopsonized organisms occurs within the peritoneal cavity. This is due to the virtual absence of phagocytosis and inactivation of the challenge inoculum by the host macrophages, which allows the organism to grow in the tissue at rates normally achievable only in vitro. When mice were inoculated i.n. with the parent strains at an initial challenge dose of 104 CFU, bacteria spread into the liver, spleen, and blood by 24 h, but the numbers were much lower than those after i.p. inoculation. The bacterial load persisted in all tissues up to 96 h but not at a level that resulted in death of the mice. A similar situation was reported by Collins (8), who used a wild-type P. multocida serotype 5:A turkey isolate which, when inoculated i.n. into mice, spread into the internal organs by 24 h.
With the attenuated JRMT1 and JRMT2 aroA mutant strains, after a single high i.n. challenge dose (>109 CFU per mouse), large numbers of bacteria were detected in the lungs by 24 h, but only small numbers were present in the blood and no bacteria were present in the liver and spleen (Table 5). By contrast, bacteria were clearly present in the blood, liver, and spleen after a single high i.p. dose (>107 CFU per mouse), but the numbers of viable bacteria were greatly reduced compared to the numbers of cells of the parent strains. In the lungs, however, no colonies were detected. Following administration of a single dose by either route, attenuated bacteria were cleared from the blood, liver, and spleen by 48 h, but after i.n. inoculation the attenuated bacteria persisted in the lungs for up to 96 h, although the numbers did not appear to increase significantly like the numbers of the parent strain. The protection studies (Table 4) showed that after one dose, mice were fully protected after i.p. vaccination but were only partially protected after i.n. vaccination, when they were challenged by the i.p. route. Yet, one i.n. dose fully protected against i.n. challenge (Table 5). These differences in efficacy between the i.p. and i.n. routes of vaccination may be a reflection of the smaller numbers of bacteria able to pass from the lungs into the blood and other tissues after a single i.n. inoculation in order to stimulate a fully protective immune response.
HS pathogenesis in cattle and buffaloes involves the rapid translocation of bacteria from the respiratory tract to the blood, liver, and spleen (10, 36), suggesting that the bacteria are able to invade via the mucosal epithelial layers. A similar disease progression occurs in fowl cholera caused by serotype A isolates of P. multocida, which can manifest as an acute septicemia. An avian strain of P. multocida serotype A:3 has been shown to invade polarized epithelial cells in an actin-dependent manner (24), and several studies with avian isolates have shown uptake by and survival in turkey and chicken macrophages and neutrophils (12, 13, 23). Thus, dissemination to the deeper tissues may well occur by vascular migration facilitated by association with phagocytic cells (32, 33). Truscott and Hirsh (31) reported that a P. multocida strain of avian origin produced a substance(s) that interfered with the function of phagocytic cells. The potential for cell invasion and intracellular survival of P. multocida B:2 strains in macrophages and other cell types deserves further study, because significant persistence in an intracellular environment, where humoral immune responses should be ineffective, might indicate that cellular immune mechanisms play a vital role in clearing the infection.
The aroA derivatives of the P. multocida B:2 strains are thus candidate organisms for a live attenuated vaccine against HS as the safety and efficacy of these strains have been demonstrated in a mouse model of infection. Vaccine trials with either cattle or buffaloes, however, are needed in order to establish that the safety and protective properties demonstrated in the mouse are reflected in similar properties in the target species.
Present address: Faculty of Veterinary Medicine, Zabol University, Zabol, Iran. ![]()
Present address: Center for Integrated Plant Systems, Michigan State University, East Lansing, MI 48824. ![]()
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»