This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Runyen-Janecky, L. J.
Right arrow Articles by Payne, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Runyen-Janecky, L. J.
Right arrow Articles by Payne, S. M.

 Previous Article  |  Next Article 

Infection and Immunity, August 2002, p. 4379-4388, Vol. 70, No. 8
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.8.4379-4388.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Identification of Chromosomal Shigella flexneri Genes Induced by the Eukaryotic Intracellular Environment

L. J. Runyen-Janecky and S. M. Payne*

Section for Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, Texas 78712-1095

Received 28 February 2002/ Returned for modification 16 April 2002/ Accepted 29 April 2002


arrow
ABSTRACT
 
Upon entry into the eukaryotic cytosol, the facultative intracellular bacterium Shigella flexneri is exposed to an environment that may necessitate the expression of particular genes for it to survive and grow intracellularly. To identify genes that are induced in response to the intracellular environment, we screened a library containing fragments of the S. flexneri chromosome fused to a promoterless green fluorescent protein gene (gfp). Bacteria containing promoter fusions that had a higher level of gfp expression when S. flexneri was intracellular (in Henle cells) than when S. flexneri was extracellular (in Luria-Bertani broth) were isolated by using fluorescence-activated cell sorting. Nine different genes with increased expression in Henle cells were identified. Several genes (uhpT, bioA, and lysA) were involved in metabolic processes. The uhpT gene, which encoded a sugar phosphate transporter, was the most frequently isolated gene and was induced by glucose-6-phosphate in vitro. Two of the intracellularly induced genes (pstS and phoA) encode proteins involved in phosphate acquisition and were induced by phosphate limitation in vitro. Additionally, three iron-regulated genes (sufA, sitA, and fhuA) were identified. The sufA promoter was derepressed in iron-limiting media and was also induced by oxidative stress. To determine whether intracellularly induced genes are required for survival or growth in the intracellular environment, we constructed mutations in the S. flexneri uhpT and pstS genes by allelic exchange. The uhpT mutant could not use glucose-6-phosphate as a sole carbon source in vitro but exhibited normal plaque formation on Henle cell monolayers. The pstS mutant had no apparent growth defect in low-phosphate media in vitro but formed smaller plaques on Henle cell monolayers than the parent strain. Both mutants were as effective as the parent strain in inducing apoptosis in a macrophage cell line.


arrow
INTRODUCTION
 
The facultative intracellular bacterium Shigella flexneri encounters a variety of environmental conditions during infection. After ingestion, Shigella must evade the host immune response, survive the acidic stomach, successfully traverse the small intestine, and invade and grow within the cytosol of colonic epithelial cells. The composition of the eukaryotic cytosol has not been well characterized. It is thought that the cytosol is low in sodium and calcium ions and high in potassium and magnesium, relative to the extracellular environment. The pH of the cytosol is neutral, and the cytosolic environment is considered to be reducing because the ratio of reduced glutathione to oxidized glutathione is at least 30:1 (18). Each of the environments that Shigella encounters may induce the expression of a particular set of S. flexneri genes that results in enhanced survival or multiplication in that environment.

Although much is known about gene induction in response to temperature and other discrete environmental signals in S. flexneri, less is known about the complex signals that the intracellular bacteria encounter in host cells and the genes that are induced in response to these signals. Most of the work to identify bacterial genes that are induced in response to eukaryotic signals has been done with Salmonella enterica serovar Typhimurium (13, 14, 23, 47). More than 30 different genes are induced when S. enterica serovar Typhimurium is in macrophage-like cell lines. Many of these genes are members of the PhoPQ regulon, which is induced by low magnesium concentrations, and encode a variety of proteins, including magnesium transporters, adhesins, metabolic genes, capsule biosynthesis proteins, and proteases (13, 14, 23, 47). Several S. enterica serovar Typhimurium genes whose expression is activated in response to low iron concentrations were also induced in eukaryotic cell lines. These genes include fhuA, cirA, and entF, which encode proteins that are components of siderophore-mediated iron uptake systems (13, 20). Genes encoding a high-affinity phosphate transport protein (PhoA), a phospholipid-recycling protein (Aas), and a type III secretion system component (SsaH) were also identified (47).

The intracellular environmental signals and conditions that S. enterica serovar Typhimurium encounters reflect its residence in the vacuole of the macrophage. In contrast, cytoplasmic intracellular pathogens such as Listeria monocytogenes, which resides in the cytosol of either epithelial cells or macrophages, and S. flexneri, which resides in the cytosol of epithelial cells, experience a different environment. Several groups have identified L. monocytogenes genes that are induced while the bacterium is in the macrophage cytosol or in mice (6, 10, 22, 50). These genes encode nucleotide metabolism proteins; sugar uptake systems; DNA topoisomerase; a hemolysin-like gene; listerolysin O, which lyses the phagosome; and ActA, which polymerizes actin to allow intercellular spread. Genes induced by Shigella growing in the intracellular environment have not been identified. The work described in this paper was undertaken to identify S. flexneri genes that are induced when the bacteria are growing in the cytosol of an epithelial cell line.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and growth conditions. The bacterial strains and plasmids used in this work are listed in Table 1. Escherichia coli strains were routinely grown in low-salt Luria-Bertani (LB) broth or LB agar, which contain 5 g of NaCl (21). S. flexneri strains were grown in LB broth or on tryptic soy broth agar plus 0.01% Congo red dye at 37°C. Intracellular salts medium (ISM) (pH 7.4) (12) and T medium (42) were made as previously described, and both contained nicotinic acid at 2 µg/ml. For the experiments described in this paper, both the ISM and T medium were supplemented with 40 µM iron sulfate. Antibiotics were used at the following amounts per milliliter: 125 µg of carbenicillin, 25 µg of kanamycin, 20 µg of nalidixic acid, 15 µg of chloramphenicol, and 200 µg of streptomycin. SN555-38 was isolated by plating 2 x 1010 cells of SA555-38 on tryptic soy broth agar plus 0.01% Congo red dye containing 20 µg of nalidixic acid per ml of medium to select for nalidixic acid-resistant mutants.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids

Recombinant DNA and PCR methods. Plasmids were isolated by using a QIAprep Spin Miniprep kit (Qiagen, Santa Clarita, Calif.). Isolation of DNA fragments from agarose gels was performed using a QIAquick Gel Extraction kit (Qiagen). Chromosomal DNA was isolated by the method of Marmur (25). Matings were done as described previously (37).

All PCRs were carried out using either Taq (Qiagen) or Pfu polymerase (Stratagene Cloning Systems, La Jolla, Calif.) according to the manufacturers' instructions. Taq was used for all PCRs unless the fragments were to be cloned or sequenced, in which case Pfu was used. Primers for individual PCRs are listed in the appropriate sections below.

Construction of S. flexneri DNA-gfp libraries. The promoterless green fluorescent protein gene (gfp) vector pLR29 was constructed as follows. pGTXN3 was partially digested with SspI, and the 5.3-kb fragment was ligated to a 1.7-kb BamHI-Klenow-treated fragment from pGP704 (29) that carries the RP4 mobilization region. pLR44 was constructed by digestion of pLR29 with SmaI and XbaI followed by insertion of an XbaI-digested synthetic oligonucleotide carrying the SmaI, ClaI, HindIII, and BamHI restriction enzyme sites. Chromosomal DNA from SA514 was partially digested with either Sau3A1 or TaqI, and fragments of 2 kb or less were ligated to pLR29 digested with BamHI or pLR44 digested with ClaI, respectively. The ligation mixture was electroporated into SM10{lambda}pir. Fifteen thousand colonies were obtained for each Sau3A1 library, and 10,000 colonies were obtained for each TaqI library. Three pools of each library, each containing 3,000 to 5,000 colonies from separate plates, were moved into S. flexneri SN555-38 by conjugation.

Tissue culture cell invasion and plaque assays. Monolayers of Henle cells (intestine 407 cells; American Type Culture Collection, Manassas, Va.) were used in all experiments and were routinely maintained in Henle medium, which consists of minimum essential medium, 10% tryptose phosphate broth, 2 mM glutamine, nonessential amino acids, and 10% fetal bovine serum (Life Technologies, Grand Island, N.Y.) in a 5% CO2 atmosphere at 37°C. Invasion assays were done as described previously (11, 15), with the addition of gentamicin after the phosphate-buffered saline (PBS) washes 30 min postinvasion. Plaque assays were done as described previously (31) with the modifications described by Hong et al. (15), and plaques were scored after 3 to 4 days.

Differential fluorescence induction (DFI). An overnight culture of each library was subcultured into LB broth containing carbenicillin and 0.1% deoxycholate and grown to mid-logarithmic phase. Each culture was allowed to invade Henle cells for 3 to 3.5 h. Bacteria were released from the Henle cells by treatment with 0.5 to 2.5% deoxycholate and pelleted for 2 min at 17,000 x g. These bacteria were resuspended in low-salt PBS (containing 4 instead of 8 g of NaCl per liter and 1 instead of 2 g of KCl per liter), and the bacteria with the highest fluorescence were collected using a FACsCaliber instrument and analyzed using CELLQUEST software (Becton Dickinson, Franklin Lakes, N.J.). The collected fluorescent bacteria were recovered onto a 0.45-µm filter (Nalgene, Rochester, N.Y.) which was suspended in LB broth containing antibiotics and incubated overnight at 37°C. The cultures were subcultured 1:1,000 into LB broth containing carbenicillin and grown to mid-logarithmic phase. Bacteria were diluted into low-salt PBS, and the bacteria with the lowest fluorescence were collected. The gate for recovering low-fluorescent cells was set to a maximum of about 10-fold higher than the fluorescence level of Shigella without the gfp plasmid, so as not to exclude promoters that have a basal level of expression. The recovered cells were subjected to additional rounds of differential fluorescence induction (DFI) as described above and in Results. FACsCaliber amplifier settings were as follows: forward scatter = E01, side scatter = 505, and relative fluorescence intensity from 515 to 545 nm = 798.

Amplification and recloning of the intracellularly induced promoters. The intracellularly induced promoters were amplified from the SA514 chromosomal DNA with the following primer pairs: lysA, TCTTCAAACAGACGCAGTCCTTG and GCTCTAGAGCAAACGCAGCAGATTTTC; sufA, TATTCTTATCGCCCCTTCAAGAGC and GCTCTAGAGCAGCCCGTTTGCTTCAC; pstS, CATCGTTGTCATCTCACCC and GCTCTAGATTTGCCCAGGTAGATGTC; phoA, TGGAGATTATCGTCACTGC and GCTCTAGAGGCATTTCTGGTGTC; bioA, GACGAGGATCGAAATGCTGGC and GCTCTAGACAAAGGCAAGATCGTCCG; fhuA, CGGGATCCAGGCGGCGTATCTGACACTATG and GCTCTAGAATCGGCGTATCGGTTTTAG; and sitA, CGGGATCCGGGCAAAAATCACAACTATC and GCTCTAGAGGTTATGGATGAGACTTCTGC. The PCR products were digested with XbaI or BamHI-XbaI (the sites are underlined in the primer sequences above) and cloned into pLR29 digested with SmaI-XbaI or BamHI-XbaI. The uhpT promoter was not recloned, as it was isolated numerous times as independent SIIG (see below) clones (Table 1). The IS600 clone was not reconstructed, because we believe that gfp expression may be driven by a cryptic promoter.

Sequence analysis of the S. flexneri promoter-gfp clones. For determining the nucleotide sequence, primers in the promoterless gfp gene (gfp-2, CTGTTTCATATGATCTGGG) and in the multicloning site upstream of the gfp gene (gfpUPMCS, CCATAAACTGCCAGGGAA) were used to sequence either purified plasmid DNA or PCR products generated with gfp-2 and gfpUPMCS. Nucleotide sequences were determined by the Molecular Biology Sequencing Facility at the University of Texas at Austin.

Construction of mutations in S. flexneri by allelic exchange. Allelic exchange with pHM5 (37) containing S. flexneri genes disrupted with the chloramphenicol resistance gene (described below) was done in SM100. SM100 is a streptomycin-resistant derivative of SA100 and shows the same invasion, intracellular growth, and plaque phenotypes as the parental strain (S. Seliger, personal communication). Disruption of the chromosomal genes was confirmed by PCR analysis.

For construction of the allelic exchange plasmids for generating the uhpT mutation, the uhpT gene was amplified from SA514 with primers uhpT1 (5'GCTGGTTGTATGGCGATAGTCG3') and uhpT2 (5'CCACTTTGGTCTGAATCACCTCG3') and was cloned into pWKS30 (49) digested with EcoRV and HincII to generate pLR59. A 1.6-kb fragment containing a chloramphenicol resistance gene (cam) was isolated from pMA9 (16) by digestion with HincII and was inserted into the MscI site in uhpT. The gene with the cam resistance cassette was excised as an XhoI-XbaI fragment and ligated into pHM5 digested with SalI-XbaI to generate pLR60.

For construction of the allelic exchange plasmids for generating the pstS mutation, the pstS gene was amplified from pSIIG5 with the gfp-2 and gfpUPMCS primers and digested with XbaI, treated with Klenow fragment of DNA polymerase I, and digested with EcoRI. The resulting fragment was cloned into pWKS30 digested with EcoRI and HincII to generate pLR77. A 1.6-kb fragment containing the cam gene was isolated from pMA9 by digestion with HincII and was inserted into the HincII sites in pstS. The gene with the cam resistance cassette was excised as an XhoI-XbaI fragment and ligated into pHM5 digested with SalI-XbaI to generate pLR78.

Screening of a chromosomal library for the pst operon. A cosmid library of S. flexneri chromosomal DNA (K. Lawlor, unpublished data) in E. coli HB101 (38) was screened by colony hybridization for clones that hybridize to the S. flexneri nucleotide sequences approximately 100 bp upstream of pstS. This strategy was chosen because the S. flexneri sequence upstream of pstS (beginning 107 bp 5' to the pstS translational start site) is not similar to the E. coli sequence or any other nucleotide sequence in the nonredundant database and because E. coli contains a pstS gene that would hybridize to the S. flexneri pstS probe. The deduced amino acid sequence of the 0.9-kb region 5' to S. flexneri pstS is 26% identical and 42% similar to amino acid residues 111 to 354 of the long polar fimbrial operon protein LpfD in S. enterica serovar Typhimurium. The 228-bp DNA fragment for the probe (which contains the lpfD but not the pstS sequences) was isolated as an EcoRV-SmaI fragment from a PCR product generated by using primers LR20 (5'GGAAGTGCGGTAACAACA3') and LR19 (5' TTTGCCCAGGTAGATGT3') and S. flexneri DNA as the template. Probe labeling, hybridization, and detection were performed as described in the instructions for the Genius II System (Boehringer Mannheim). Cosmids that hybridized with the lpfD probe were further screened for the pstS sequences by PCR with primers LR19 and LR20.

Macrophage apoptosis assays. Monolayers of the J774A.1 macrophage cell line (American Type Culture Collection) were routinely maintained in Dulbecco's modified Eagle's medium with 4 mM L-glutamine, 1.5 g of sodium bicarbonate per liter, 4.5g of glucose per liter, and 10% fetal bovine serum (Life Technologies) in a 5% CO2 atmosphere at 37°C. For apoptosis assays, semiconfluent J774A.1 cell monolayers in 35-mm-diameter plates were infected with 108 bacteria as described previously for Henle cell invasions (11). Apoptosis was assayed after an additional 60 to 90 min by using the ApoAlert Annexin V-fluorescein isothiocyanate kit (Clontech Laboratories, Inc., Palo Alto, Calif.).


arrow
RESULTS
 
Isolation of Shigella genes induced by the intracellular environment. To isolate S. flexneri genes whose expression is induced in response to the intracellular environment of the Henle cell (hereby designated SIIGs for Shigella intracellularly induced genes), we employed DFI. DFI uses fluorescence-activated cell sorting (FACS) to screen for promoters that activate the promoterless gfp reporter gene under one particular set of conditions (47). Here we screened for S. flexneri promoters that had a higher level of gfp expression when S. flexneri was intracellular (in Henle cells) than when S. flexneri was extracellular (in LB broth). Since we were interested in identifying Shigella genes that were induced in response to the initial exposure to the Henle cell cytosol as opposed to genes that may be induced in response to movement into an adjacent Henle cell, we chose to use an S. flexneri mutant that is defective in intercellular spread for this study. We used an rfaL mutant, SN555-38, which is unable to spread to adjacent Henle cells because the defect in lipopolysaccharide biosynthesis prevents proper polar localization of IcsA (16). However, SN555-38 invades Henle cells at a level similar to that for the wild-type strain SA100 and multiplies within the Henle cells (data not shown).

Six independent libraries of S. flexneri chromosomal DNA fragments fused to a plasmid-borne promoterless gfp gene in S. flexneri SN555-38 were used to infect Henle cells. After 3 to 3.5 h, the Henle cells were lysed to release the intracellular bacteria, and fluorescent bacteria (due to gfp expression driven by an active promoter) were separated from the nonfluorescent bacteria by FACS. The collected cells (1 to 3% of the original population) were then grown in LB broth, and the least fluorescent bacteria (16 to 35% of the populations), which contain promoters that are inactive or less active under laboratory conditions, were collected by FACS. This low-fluorescent population was used to reinfect Henle cells, and the most fluorescent bacteria were collected (0.1 to 2% of the populations). At this point, half of the libraries were subjected to one last round of growth in LB broth followed by FACS to obtain the least fluorescent bacteria.

Identification and characterization of the SIIGs isolated by DFI. One hundred thirty-two clones (22 from each library) isolated as described above were individually assessed for differential fluorescence, and 44 were verified as having increased gfp expression during growth in Henle cells compared to growth in LB broth (data not shown). Of these, 16 clones appeared to be unique, based on fluorescence levels and DNA insert size (data not shown).

The S. flexneri DNA fragment from each SIIG clone was sequenced, and the sequences were used to search GenBank to determine the identity of the intracellularly induced genes. Nine different promoters were found. Seven of the nine SIIGs had nucleotide sequences that were greater than 95% identical to E. coli K-12 genes (Table 2). These seven SIIGs include genes involved in metabolism (uhpT, bioA, and lysA), iron acquisition and metabolism (fhuA and sufA), and phosphate utilization (pstS and phoA). The deduced amino acid sequence of the insert from one SIIG was 85% similar to the S. enterica serovar Typhimurium SitA protein, a putative iron transporter that is not found in E. coli K-12. The nucleotide sequence from another SIIG insert was 97% identical to the nucleotide sequence of IS600, which encodes most of the transposase protein. However, the known promoter for IS600 is not part of the insert. It is possible that a cryptic, internal promoter in the insert is activating gfp expression.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Shigella intracellular induced genes

After the initial screen described above, the intracellularly induced promoters were amplified from S. flexneri chromosomal DNA, recloned into the promoterless gfp vector, and moved into wild-type S. flexneri strains to verify that the intracellular induction was not dependent on the rfaL strain background. The levels of intracellular induction of each promoter in SA100 or SM100 are shown in Table 2. Most of the genes activated by the Henle cell environment had modest but reproducible inductions ranging from 3- to 17-fold. None of the promoters was significantly induced by exposure to Henle medium during the invasion process (data not shown). The uhpT gene was one of the more strongly intracellularly induced genes compared to induction in LB broth (Fig. 1A and Table 2) and was also the most frequently isolated SIIG. Two of the genes isolated (pstS and phoA) showed an unusual pattern of induction: only part of the bacterial population induced gene expression. Specifically, only 51% of shigellae carrying the pstS-gfp fusion and 21% of shigellae carrying the phoA-gfp fusion showed significant induction of the fusions (Fig. 1B and C). This partial induction phenomenon was reproducible from experiment to experiment and was not due to loss of the plasmid-borne fusion by part of the population (data not shown).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. Induction of the uhpT-gfp, pst-gfp, and phoA-gfp fusions in Henle cells. Henle cells were infected with SA100 carrying either pSIIG33 (uhpT-gfp) (A), pLR66 (pstS-gfp) (B), or pLR83 (phoA-gfp) (C) for 3.5 h. Bacteria were released from Henle cells by deoxycholate treatment, and the relative fluorescence was quantitated by FACS. Solid lines on the histograms indicate gfp expression in bacteria grown in Henle cells, and lighter, dashed lines indicate gfp expression in bacteria from LB broth cultures used for invasions of Henle cells. The x axis shows the geometric mean fluorescence, and the y axis depicts the number of bacterial cells. M1 and M2 delineate uninduced and induced cell populations, respectively. Ten thousand bacterial cells were assayed for each experimental condition. The experiments were performed three times, and results from a representative experiment are shown.

In vitro regulation of SIIGs. Many of the SIIGs isolated in this screen are predicted to be involved in nutrient acquisition and metabolism, based on homology to E. coli K-12 genes, and are likely to be regulated by numerous environmental signals. Therefore, we analyzed the regulation of several of these genes in vitro to examine possible environmental signals that may regulate Shigella gene induction in the eukaryotic cytosol.

(i) SIIG expression in ISM. Headley and Payne (12) developed a defined medium (ISM) that mimics the intracellular environment in salt and ion composition. Since the SIIG promoters are induced in response to growth in Henle cells, it was possible that the signals inducing some of the promoters would also be reproduced in ISM. S. flexneri strains containing each SIIG-gfp fusion were grown in ISM, T medium (a minimal medium that does not mimic the intracellular environment), and LB broth, and the fluorescence was measured (Table 3). Expression of the sufA-gfp and IS600-gfp fusions was induced in ISM, but not T medium, relative to LB broth, suggesting that ISM does mimic the intracellular environment to some extent. Expression of the bioA-gfp and lysA-gfp fusions was induced in T medium relative to LB broth but was induced to an even higher level in ISM. The phoA and pstS promoters showed no induction in T medium and a very slight induction in ISM (approximately twofold). The sitA and fhuA promoters appeared to be repressed in T medium relative to LB broth. The uhpT promoter was not induced in either T medium or ISM. Thus, some but not all of the environmental signals encountered in the cell cytosol are reproduced by these in vitro conditions.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Induction of SIIGs in vitro

(ii) Regulation of uhpT expression in S. flexneri. The E. coli uhpT gene encodes a cytoplasmic membrane protein that transports sugar phosphates such as glucose-6-phosphate (G6P) into the cytoplasm (2, 43), and the uhpT promoter is induced in response to external hexose-6-phosphates (28). To determine whether this is the case for the S. flexneri uhpT promoter, we grew S. flexneri carrying the uhpT-gfp fusion in a defined medium (ISM) containing either glucose or G6P and measured GFP reporter activity. GFP expression in S. flexneri containing the uhpT-gfp fusion increased 154-fold at 3.5 h postinoculation, demonstrating that the S. flexneri uhpT promoter is induced by G6P (Fig. 2). Glucose did not induce the uhpT promoter (data not shown). Since G6P induces uhpT expression in vitro and since glucose is phosphorylated after transport into the eukaryotic cytosol, it is likely that G6P induces uhpT expression in the Henle cell.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Induction of the uhpT promoter by G6P. SA100 carrying pSIIG33 (uhpT-gfp) was grown in ISM containing 0.4% G6P, and the fluorescence was quantitated by FACS at the indicated times. Ten thousand bacterial cells were assayed for each experimental condition. The data presented are the means from three experiments, and the standard deviations of the means are indicated. The mean fluorescence for a SA100/pSIIG33 fusion grown in ISM containing 0.4% glucose was always less than 10 U and thus is not shown.

(iii) Regulation of pstS and phoA expression in S. flexneri. The pstS and phoA genes are part of the PhoBR regulon in E. coli, which is activated under phosphate-limiting conditions (24). To determine whether phosphate limitation is also a signal for pstS and phoA induction in S. flexneri, we grew S. flexneri containing the pstS-gfp or phoA-gfp fusion in T medium containing various concentrations of potassium phosphate and measured GFP reporter activity. For both promoters, induction of GFP expression increased as the phosphate concentration decreased (Fig. 3). GFP expression driven by the pstS and phoA promoters was induced 23-and 34-fold, respectively, in T medium containing 0.01 mM phosphate, relative to GFP expression in T medium containing 2 mM phosphate.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Induction of the S. flexneri pstS and phoA promoters by phosphate limitation. SA100 carrying either pLR66 (pstS-gfp) (A) or pLR83 (phoA-gfp) (B) was grown in T medium supplemented with potassium phosphate at the indicated levels, and the fluorescence was quantitated by FACS after 5 to 6 h. Ten thousand bacterial cells were assayed for each experimental condition. The experiments were performed two times, and results from a representative experiment are shown.

(iv) Regulation of sufA expression in S. flexneri. Because the sufA promoter was induced in both Henle cells and ISM, we were interested in characterizing signals that may regulate sufA expression. The SIIG clone that contained the sufA promoter and 5' end of the gene was 95% identical to E. coli sufA (32). Although E. coli SufA has not been well characterized, it is thought to be a part of a six-member operon, which encodes several proteins with homologies to Fe-S cluster biosynthesis proteins and ABC transporters. The deduced amino acid sequence of E. coli sufA is 78% similar to that of the Erwinia chrysanthemi SufA protein, which contributes to virulence (30); 70% similar to E. coli IscA, which is involved in the assembly of Fe-S clusters in proteins (45); and 56% similar to the cyanobacterium Synechococcus sp. HesB, which is part of the nitrogen fixation system (17). Because some of these proteins are implicated in redox reactions, we tested whether the sufA promoter was induced in response to oxidizing or reducing agents. S. flexneri containing the cloned sufA-gfp fusion was grown in LB broth to early logarithmic phase and then treated with either hydrogen peroxide or the reducing agent ß-mercaptoethanol. The sufA-gfp fusion was not induced by ß-mercaptoethanol at concentrations of 10, 100, and 500 mM (data not shown) but was induced sixfold by the addition of 10 mM hydrogen peroxide (Fig. 4A), consistent with oxidative stress induction.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. Induction of the S. flexneri sufA promoter. (A) SA100 carrying pLR67 (sufA-gfp) was grown in LB broth to mid-log phase and treated with hydrogen peroxide for 1.5 h as indicated, and the relative fluorescence was quantitated by FACS. (B) SA100 carrying pLR67 (sufA-gfp) was grown in LB broth containing EDDA as indicated, and the fluorescence was quantitated by FACS after 5 h. Ten thousand bacterial cells were assayed for each experimental condition. The data presented are the means from three experiments, and the standard deviations of the means are indicated.

Expression from the E. chrysanthemi sufA promoter is repressed in iron-replete media by Fur (30). When bound to ferrous iron, Fur binds to Fur boxes in iron-regulated promoters, thereby repressing transcription. The S. flexneri sufA promoter region contains a potential Fur box (5'TGAACTGATAATCATTATC3') 46 bp 5' of the SufA translational start site. Therefore, we examined whether expression from the sufA-gfp fusion was iron regulated. S. flexneri containing the sufA-gfp fusion was grown in LB broth containing increasing levels of the iron chelator ethylene diamino-o-dihydroxyphenyl acetic acid (EDDA). Induction of gfp expression driven by the sufA promoter increased as the concentration of the iron chelator increased (Fig. 4B), consistent with Fe2+-Fur-mediated repression.

Effects of mutations in SIIGs on survival or growth in the Henle cell. Mutations were constructed in several of the SIIGs to determine whether intracellular induction of genes correlated with their importance for survival and growth in the eukaryotic cell.

(i) Characterization of an S. flexneri uhpT mutant. Genes that are induced in response to the intracellular environment may be required for survival or growth in the intracellular environment. Since the uhpT gene is one of the more strongly induced SIIGs that was isolated and was also the most frequently isolated SIIG, we generated a uhpT disruption mutation in S. flexneri SM100 by allelic exchange. The uhpT mutant, SM165, was tested for the ability to grow with G6P as the sole carbon source (Fig. 5). SM165 showed significantly reduced growth in ISM with G6P as the sole carbon source compared to the parental strain SM100, whereas both strains grew equally well in ISM containing glucose as the sole carbon source.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 5. The S. flexneri uhpT mutant cannot use G6P as a carbon source. Overnight cultures of the parental strain SM100 (solid bars) and the uhpT mutant SM165 (stippled bars) were subcultured into ISM with either 0.4% glucose or G6P as the sole carbon source. The optical density at 650 nm (OD650) of the cultures was measured after 20 h. The data presented are the means from three experiments, and the standard deviations of the means are indicated.

We tested the uhpT mutant SM165 for the ability to invade Henle cells and found that it invaded at a frequency similar to that of the wild-type strain SM100 (data not shown). SM165 was also tested for the ability to survive and grow in the Henle cell intracellular environment by examining the strain for the ability to form plaques on a Henle cell monolayer. Although the uhpT gene is strongly induced in Henle cells, SM165 formed plaques of the same number and size as the parental strain SM100 (data not shown), suggesting that carbon sources in addition to hexose-6-phosphates are freely available to Shigella in the host cytosol. Finally, we also tested the ability of SM165 to cause apoptosis in the macrophage cell line J774A.1. Infection of J774A.1 with SM165 resulted in a similar level of apoptosis as did infection with the parental strain SM100 (data not shown).

(ii) Characterization of an S. flexneri pstS mutant. The S. enterica serovar Typhimurium pstS gene is induced when serovar Typhimurium is in the macrophage, but it is not required for survival in a macrophage-like cell line (47). Since S. flexneri pstS was induced in the Henle cell, we examined whether PstS is required for growth or survival in the Henle cell. A pstS deletion mutation in S. flexneri SM100 was generated by allelic exchange. We tested the pstS mutant for the ability to grow in phosphate-limited medium by monitoring the growth of cultures in T medium supplemented with either high (2 mM) or low (0.01 mM) levels of potassium phosphate. The pstS mutant SM169 grew similarly to the parent strain in both high- and low-phosphate media after 24 h (data not shown). These data suggest that other phosphate transport systems can compensate for the lack of PstS under low-phosphate conditions in vitro.

We tested the pstS mutant SM169 for the ability to invade and form plaques on Henle cells. SM169 invaded Henle cells and formed similar numbers of plaques as the parental strain SM100. However, the plaques were reduced in size, suggesting that the Pst system may be the major phosphate uptake system in Shigella within Henle cells (Fig. 6). Further, we tested the ability of SM169 to cause apoptosis in the macrophage cell line J774A.1. Infection of J774A.1 with SM169 resulted in a similar level of apoptosis as infection with the parental strain SM100 (data not shown).



View larger version (139K):
[in this window]
[in a new window]
 
FIG. 6. The S. flexneri pstS mutant forms small plaques on Henle cell monolayers. Confluent Henle cell monolayers were infected with 104 bacteria per 35-mm-diameter plate and the plaques were photographed after 4 days. SM100 containing the vector control pLAFR1 formed plaques of the same size as those formed by SM100.

pstS is the first gene in the five-gene pst operon (44). The cam insertion into pstS in SM169 is most likely polar on the downstream genes, and a clone carrying only the pstS gene did not complement the plaque formation defect of SM169 (data not shown). A cosmid library of S. flexneri chromosomal DNA in E. coli HB101 was screened by colony hybridization for pstS-containing clones as described in Materials and Methods, and a cosmid (pLR84) containing the entire pst operon was identified. pLR84 restored the ability of SM169 to form wild-type plaques on Henle cell monolayers (Fig. 6), indicating that one or more genes in addition to pstS were inactivated by the insertion into pstS and were needed to complement the mutation. Taken together, these data suggest that high-affinity phosphate transport through the Pst system is important for S. flexneri to either survive or grow inside a eukaryotic cell or to spread to adjacent cells.


arrow
DISCUSSION
 
Much is known about the virulence genes that are required for S. flexneri to invade eukaryotic cells and spread to adjacent cells via actin-based motility (5, 39). However, less is known about the genes that are important for survival and growth in the human host and colonic epithelial cells. Headley and Payne (12) showed that production of numerous S. flexneri proteins is either induced or repressed when S. flexneri is grown in HeLa cells. One way to identify the genes encoding these proteins is to isolate genes that are specifically induced in these environments. Robb et al. (36) used differential display to identify S. flexneri genes that are induced in a murine peritoneal culture model, in which shigellae are grown in a dialysis bag in the mouse peritoneal cavity, but it was not determined whether these genes were induced in epithelial cells. Since Shigella spends a portion of its life cycle in the cytosol of the colonic epithelial cells, we identified promoters that are activated in the intracellular environment of an epithelial cell by using DFI.

Identification of SIIGs and characterization of their regulation may provide insights about Shigella physiology in the eukaryotic cytosol and the nature this environment. For example, the S. flexneri uhpT gene, which encodes a cytoplasmic membrane transporter of hexose phosphates that mediated G6P utilization in vitro (2, 43), was induced by the Henle cytosol and by G6P in vitro. Because glucose is phosphorylated immediately after transport into the eukaryotic cytosol, G6P, not glucose, is probably the most plentiful and easily utilized carbon source for Shigella growing in the cytosol. Intracellular induction of uhpT would allow Shigella to take advantage of this carbon source. Additionally, intracellular induction of S. flexneri genes encoding phosphate utilization systems (pstS and phoA) and iron uptake and metabolism systems (sitA, fhuA, and sufA) suggests that phosphate and iron may be limiting in the cytosol, especially since these genes were induced by iron and phosphate limitation, respectively, in vitro. Intracellular induction of these S. flexneri genes would provide the bacterium with an increased ability to acquire phosphate and iron in the eukaryotic cytosol. Likewise, Henle cell induction of the S. flexneri lysA and bioA genes suggests that free lysine and biotin may be limiting in the eukaryotic intracellular environment, since in E. coli these genes are repressed by lysine and biotin, respectively (4, 7).

Although identification of individual SIIGs and the in vitro signals that regulate these genes may provide insights into Shigella physiology and the nature of the eukaryotic cytosolic environment, the in vivo situation is likely to be extremely complex, as there are numerous eukaryotic cytosolic signals and multiple bacterial systems to respond to these signals. For example, although the uhpT gene is strongly induced in the Henle cell, the S. flexneri uhpT mutant formed wild-type plaques on Henle cell monolayers, suggesting that the uhpT mutant was multiplying and spreading at a rate similar to that of the parent strain. Therefore, carbon sources in addition to hexose-6-phosphates must be available to Shigella in the host cytosol, and Shigella possesses systems in addition to UhpT for carbon acquisition and utilization.

Iron transport and the induction of expression of iron transport systems in intracellular Shigella are also likely to be complex due to the large number of Shigella iron acquisition genes. We had previously shown that an S. dysenteriae tonB mutant, in which all high-affinity iron transport is eliminated, was defective in intracellular growth in Henle cells, but no single iron transport system has been found to be essential in tissue culture assay (35). At least three S. flexneri genes encoding proteins predicted to be involved in iron transport or metabolism (sitA, fhuA, and sufA) were induced when S. flexneri was in the Henle cell. In Salmonella enterica serovar Typhimurium, fhuA, sitA, and the siderophore biosynthesis gene entF are also induced when the bacteria are in a macrophage cell line, suggesting the importance of iron acquisition in other intracellular pathogens (13, 14, 20). The promoters of the S. flexneri sitA, fhuA, and sufA intracellularly induced genes have putative binding sites for Fur, which represses gene expression when bound to iron, and these promoters were derepressed in the presence of the iron chelator EDDA in vitro (unpublished data and Fig. 4B). Induction of these S. flexneri genes in the Henle cells suggests that the iron level may be lower in the Henle cell cytosol than in LB broth. It is also possible that some of these S. flexneri promoters may be regulated in response to signals in Henle cells in addition to iron limitation. For example, the S. flexneri sufA promoter is induced in response to either iron limitation or oxidative stress in vitro. In the Henle cell, induction of an S. flexneri promoter may be in response to multiple signals that are integrated to give a particular level of induction.

The redox state of the intracellular environment may be a signal for Shigella gene expression in Henle cells. The redox state of the Henle cell cytoplasm has not been clearly defined but is thought to be reducing (18). However, our data are consistent with the possibility that there are also oxidative stress signals in the Henle cell. First, the sufA promoter is induced in response to oxidative stress in vitro. Furthermore, the uhpT gene is part of the OxyS regulon in E. coli, which is induced in response to oxidative stress, and the uhpT promoter was induced when oxyS was overexpressed in E. coli (1).

Intracellular induction of the S. flexneri pstS and phoA genes, which encode a component of a high-affinity phosphate transport system (44) and alkaline phosphatase (19), respectively, is complex, as only part of the bacterial population that was grown in Henle cells induced the pstS and phoA genes during the 3.5-h infection (Fig. 1). There are several possible reasons for this partial induction. First, individual Henle cells may have different levels of phosphate starvation, and the distribution of pstS and phoA induction may reflect the differences in phosphate levels in the infected cells. Second, different parts of the Henle cell may have different phosphate levels. Third, the pst operon may be under the control of a positive feedback loop such as the one for the ara promoter. Fusions of the ara promoter to gfp show partial induction in response to an intermediate level of the inducer arabinose at the individual cell level (41).

Although only part of the Shigella population induced the pstS and phoA genes during the 3.5-h Henle cell infection, the ability to induce pstS during the 3-day growth in Henle cells in a plaque assay is important because an S. flexneri pstS mutant formed smaller plaques than the parent strain on a Henle cell monolayer. While there are several possible reasons for the small-plaque phenotype, the most likely is that the pstS mutant grows slower due to a deficiency in phosphate uptake. This result was somewhat unexpected, since an S. enterica serovar Typhimurium pstS mutant was not attenuated in virulence (47). Furthermore, the S. flexneri pstS mutant grows as well as the parent strain in low-phosphate media in vitro, and it is likely that S. flexneri contains multiple systems for phosphate uptake. In E. coli, which is closely related to S. flexneri, inorganic phosphate can also be taken up by the low-affinity, but high-velocity, Pit transporter (8), and glycerol-3-phosphate can be taken up by the Ugp system (40). However, it is not known how many of these systems S. flexneri possesses. The fact that other phosphate uptake systems compensate for pstS defects in vitro but not in vivo suggests that the Pst system is the major phosphate uptake system in Shigella within Henle cells. It is also possible that the Pst system may transport another compound and that it is the defect in transport of this compound that is responsible for the small-plaque phenotype. We believe that this is unlikely, as the Pst system is extremely specific for the mono- and divalent phosphate ions and binds inorganic oxyanions such as arsenate and sulfate poorly (3, 26).

Previous studies to identify induction of genes when intracellular pathogens are in host environments yielded numerous bacterial genes, including those involved in metabolism and biosynthesis, those involved in transport of small molecules and compounds, and putative classical virulence genes that contribute solely to pathogenesis and not to basic metabolic functions. We did not identify any SIIGs that were classical Shigella virulence genes. Most of the virulence genes are on the large plasmid (48), but none of these genes were recovered when we did a DFI screen, as described in this study, using a virulence plasmid-gfp library (data not shown). This was not surprising given that many of the known virulence genes, including ipaB, ipaC, and the mxi-spa genes, are required for entry into the eukaryotic cell (27) and therefore must be induced in the extracellular environment. This may be true for other virulence plasmid-carried genes. Another factor that may contribute is the multicopy nature of the promoterless gfp plasmids, which may result in titrating out the binding of regulatory proteins to plasmid-carried virulence gene promoters. Also, promoters on the gfp fusion plasmid may have different levels of supercoiling than those on the virulence plasmid, which may interfere with normal regulatory patterns. Porter and Dorman (34) have shown that the level of supercoiling affects some of the virulence genes in S. flexneri.

The identification of SIIGs suggests that signals such as G6P, phosphate limitation, and iron limitation may be indicators that S. flexneri is inside a eukaryotic cell. It is possible that these signals may regulate other Shigella genes that are important for survival, growth, and cell-to-cell spread, although further work examining the effect of mutations in the regulatory genes that detect and potentiate these signals will be needed. Many of the SIIGs isolated are part of functionally redundant systems (e.g., iron transport), and it is likely that the loss of one system would be compensated for by the presence of other systems. An exception to this is the Pst system, which appears to be the major phosphate uptake system in Henle cells but not in phosphate-limited T medium. These data suggest that Shigella, and perhaps other invasive bacteria, have evolved multiple systems for survival and growth that are induced in response to the signals in the intracellular environment and that induction of each of these systems may contribute to survival and growth in the intracellular environment.


arrow
ACKNOWLEDGMENTS
 
We gratefully thank the following individuals for their generous help: Elizabeth Wykoff, Stephanie Griffin, and Alexandra Mey for their critical reading of the manuscript; Angela Kizzee for technical help; and Stefan Seliger for strain SM100.

This work was supported by Public Health Service grants AI09918 awarded to L. J. Runyen-Janecky and AI16935 awarded to S. M. Payne.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Section for Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712-1095. Phone: (512) 471-9258. Fax: (512) 471-7088. E-mail: payne{at}mail.utexas.edu. Back

Editor: D. L. Burns


arrow
REFERENCES
 
    1
  1. Altuvia, S., D. Weinstein-Fischer, A. Zhang, L. Postow, and G. Storz. 1997. A small, stable RNA induced by oxidative stress: role as a pleiotropic regulator and antimutator. Cell 90:43-53.[CrossRef][Medline]
  2. 2
  3. Ambudkar, S. V., T. J. Larson, and P. C. Maloney. 1986. Reconstitution of sugar phosphate transport systems of Escherichia coli. J. Biol. Chem. 261:9083-9086.[Abstract/Free Full Text]
  4. 3
  5. Bennett, R. L., and M. H. Malamy. 1970. Arsenate resistant mutants of Escherichia coli and phosphate transport. Biochem. Biophys. Res. Commun. 40:496-503.[CrossRef][Medline]
  6. 4
  7. Chenais, J., C. Richaud, J. Ronceray, H. Cherest, Y. Surdin-Kerjan, and J. C. Patte. 1981. Construction of hybrid plasmids containing the lysA gene of Escherichia coli: studies of expression in Escherichia coli and Saccharomyces cerevisiae. Mol. Gen. Genet. 182:456-461.[CrossRef][Medline]
  8. 5
  9. Dorman, C. J., and M. E. Porter. 1998. The Shigella virulence gene regulatory cascade: a paradigm of bacterial gene control mechanisms. Mol. Microbiol. 29:677-684.[CrossRef][Medline]
  10. 6
  11. Dubail, I., P. Berche, and A. Charbit. 2000. Listeriolysin O as a reporter to identify constitutive and in vivo-inducible promoters in the pathogen Listeria monocytogenes. Infect. Immun. 68:3242-3250.[Abstract/Free Full Text]
  12. 7
  13. Eisenberg, M. A. 1985. Regulation of the biotin operon in E. coli. Ann. N.Y. Acad. Sci. 447:335-349.[Medline]
  14. 8
  15. Elvin, C. M., N. E. Dixon, and H. Rosenberg. 1986. Molecular cloning of the phosphate (inorganic) transport (pit) gene of Escherichia coli K12. Identification of the pit+ gene product and physical mapping of the pit-gor region of the chromosome. Mol. Gen. Genet. 204:477-484.[CrossRef][Medline]
  16. 9
  17. Friedman, A. M., S. R. Long, S. E. Briwn, W. J. Buikema, and F. Ausubel. 1982. Construction of a broad host range cosmid cloning vector and its uses in the genetic analysis of Rhizobium meliloti. Gene 18:289-296.[CrossRef][Medline]
  18. 10
  19. Gahan, C. G., and C. Hill. 2000. The use of listeriolysin to identify in vivo induced genes in the gram-positive intracellular pathogen Listeria monocytogenes. Mol. Microbiol. 36:498-507.[CrossRef][Medline]
  20. 11
  21. Hale, T. L., and S. B. Formal. 1981. Protein synthesis in HeLa or Henle 407 cells infected with Shigella dysenteriae 1, Shigella flexneri 2a, or Salmonella typhimurium W118. Infect. Immun. 32:137-144.[Abstract/Free Full Text]
  22. 12
  23. Headley, V. L., and S. M. Payne. 1990. Differential protein expression by Shigella flexneri in intracellular and extracellular environments. Proc. Natl. Acad. Sci. USA 87:4179-4183.[Abstract/Free Full Text]
  24. 13
  25. Heithoff, D. M., C. P. Conner, P. C. Hanna, S. M. Julio, U. Hentschel, and M. J. Mahan. 1997. Bacterial infection as assessed by in vivo gene expression. Proc. Natl. Acad. Sci. USA 94:934-939.[Abstract/Free Full Text]
  26. 14
  27. Heithoff, D. M., C. P. Conner, U. Hentschel, F. Govantes, P. C. Hanna, and M. J. Mahan. 1999. Coordinate intracellular expression of Salmonella genes induced during infection. J. Bacteriol. 181:799-807.[Abstract/Free Full Text]
  28. 15
  29. Hong, M., Y. Gleason, E. E. Wyckoff, and S. M. Payne. 1998. Identification of two Shigella flexneri chromosomal loci involved in intercellular spreading. Infect. Immun. 66:4700-4710.[Abstract/Free Full Text]
  30. 16
  31. Hong, M., and S. M. Payne. 1997. Effect of mutations in Shigella flexneri chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and serum resistance. Mol. Microbiol. 24:779-791.[CrossRef][Medline]
  32. 17
  33. Huang, T. C., R. F. Lin, M. K. Chu, and H. M. Chen. 1999. Organization and expression of nitrogen-fixation genes in the aerobic nitrogen-fixing unicellular cyanobacterium Synechococcus sp. strain RF-1. Microbiology 145:743-753.[CrossRef][Medline]
  34. 18
  35. Hwang, C., A. J. Sinskey, and H. F. Lodish. 1992. Oxidized redox state of glutathione in the endoplasmic reticulum. Science 257:1496-1502.[Abstract/Free Full Text]
  36. 19
  37. Inouye, H., S. Michaelis, A. Wright, and J. Beckwith. 1981. Cloning and restriction mapping of the alkaline phosphatase structural gene (phoA) of Escherichia coli and generation of deletion mutants in vitro. J. Bacteriol. 146:668-675.[Abstract/Free Full Text]
  38. 20
  39. Janakiraman, A., and J. M. Slauch. 2000. The putative iron transport system SitABCD encoded on SPI1 is required for full virulence of Salmonella typhimurium. Mol. Microbiol. 35:1146-1155.[CrossRef][Medline]
  40. 21
  41. Kennedy, C. 1971. Induction of colicin production by high temperature or inhibition of protein synthesis. J. Bacteriol. 108:10-19.[Abstract/Free Full Text]
  42. 22
  43. Klarsfeld, A. D., P. L. Goossens, and P. Cossart. 1994. Five Listeria monocytogenes genes preferentially expressed in infected mammalian cells: plcA, purH, purD, pyrE and an arginine ABC transporter gene, arpJ. Mol. Microbiol. 13:585-597.[Medline]
  44. 23
  45. Mahan, M. J., J. M. Slauch, and J. J. Mekalanos. 1993. Selection of bacterial virulence genes that are specifically induced in host tissues. Science 259:686-688.[Abstract/Free Full Text]
  46. 24
  47. Makino, K., H. Shinagawa, M. Amemura, S. Kimura, A. Nakata, and A. Ishihama. 1988. Regulation of the phosphate regulon of Escherichia coli. Activation of pstS transcription by PhoB protein in vitro. J. Mol. Biol. 203:85-95.[CrossRef][Medline]
  48. 25
  49. Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3:208-218.
  50. 26
  51. Medveczky, N., and H. Rosenberg. 1971. Phosphate transport in Escherichia coli. Biochim. Biophys. Acta 241:494-506.[Medline]
  52. 27
  53. Menard, R., P. J. Sansonetti, and C. Parsot. 1993. Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J. Bacteriol. 175:5899-5906.[Abstract/Free Full Text]
  54. 28
  55. Merkel, T. J., D. M. Nelson, C. L. Brauer, and R. J. Kadner. 1992. Promoter elements required for positive control of transcription of the Escherichia coli uhpT gene. J. Bacteriol. 174:2763-2770.[Abstract/Free Full Text]
  56. 29
  57. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583.[Abstract/Free Full Text]
  58. 30
  59. Nachin, L., M. El Hassouni, L. Loiseau, D. Expert, and F. Barras. 2001. SoxR-dependent response to oxidative stress and virulence of Erwinia chrysanthemi: the key role of SufC, an orphan ABC ATPase. Mol. Microbiol. 39:960-972.[CrossRef][Medline]
  60. 31
  61. Oaks, E. V., M. E. Wingfield, and S. B. Formal. 1985. Plaque formation by virulent Shigella flexneri. Infect. Immun. 48:124-129.[Abstract/Free Full Text]
  62. 32
  63. Patzer, S. I., and K. Hantke. 1999. SufS is a NifS-like protein, and SufD is necessary for stability of the [2Fe-2S] FhuF protein in Escherichia coli. J. Bacteriol. 181:3307-3309.[Abstract/Free Full Text]
  64. 33
  65. Payne, S. M., D. W. Niesel, S. S. Peixotto, and K. M. Lawlor. 1983. Expression of hydroxamate and phenolate siderophores by Shigella flexneri. J. Bacteriol. 155:949-955.[Abstract/Free Full Text]
  66. 34
  67. Porter, M. E., and C. J. Dorman. 1997. Differential regulation of the plasmid-encoded genes in the Shigella flexneri virulence regulon. Mol. Gen. Genet. 256:93-103.[CrossRef][Medline]
  68. 35
  69. Reeves, S. A., A. G. Torres, and S. M. Payne. 2000. TonB is required for intracellular growth and virulence of Shigella dysenteriae. Infect. Immun. 68:6329-6336.[Abstract/Free Full Text]
  70. 36
  71. Robb, C. W., C. J. Orihuela, M. B. Ekkelenkamp, and D. W. Niesel. 2001. Identification and characterization of an in vivo regulated D15/Oma87 homologue in Shigella flexneri using differential display polymerase chain reaction. Gene 262:169-177.[CrossRef][Medline]
  72. 37
  73. Runyen-Janecky, L. J., M. Hong, and S. M. Payne. 1999. The virulence plasmid-encoded impCAB operon enhances survival and induced mutagenesis in Shigella flexneri after exposure to UV radiation. Infect. Immun. 67:1415-1423.[Abstract/Free Full Text]
  74. 38
  75. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  76. 39
  77. Sansonetti, P. J., and C. Egile. 1998. Molecular bases of epithelial cell invasion by Shigella flexneri. Antonie Leeuwenhoek 74:191-197.
  78. 40
  79. Schweizer, H., and W. Boos. 1983. Cloning of the ugp region containing the structural genes for the pho regulon-dependent sn-glycerol-3-phosphate transport system of Escherichia coli. Mol. Gen. Genet. 192:177-186.[CrossRef][Medline]
  80. 41
  81. Siegele, D. A., and J. C. Hu. 1997. Gene expression from plasmids containing the araBAD promoter at subsaturating inducer concentrations represents mixed populations. Proc. Natl. Acad. Sci. USA 94:8168-8172.[Abstract/Free Full Text]
  82. 42
  83. Simon, E. H., and I. Tessman. 1963. Thymidine requiring mutants of phage T4. Proc. Natl. Acad. Sci. USA 50:526-532.[Free Full Text]
  84. 43
  85. Sonna, L. A., S. V. Ambudkar, and P. C. Maloney. 1988. The mechanism of glucose 6-phosphate transport by Escherichia coli. J. Biol. Chem. 263:6625-6630.[Abstract/Free Full Text]
  86. 44
  87. Surin, B. P., H. Rosenberg, and G. B. Cox. 1985. Phosphate-specific transport system of Escherichia coli: nucleotide sequence and gene-polypeptide relationships. J. Bacteriol. 161:189-198.[Abstract/Free Full Text]
  88. 45
  89. Takahashi, Y., and M. Nakamura. 1999. Functional assignment of the ORF2-iscS-iscU-iscA-hscB-hscA-fdx-ORF3 gene cluster involved in the assembly of Fe-S clusters in Escherichia coli. J. Biochem. (Tokyo) 126:917-926.[Abstract/Free Full Text]
  90. 46
  91. Taylor, R. K., C. Manoil, and J. J. Mekalanos. 1989. Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of Vibrio cholerae. J. Bacteriol. 171:1870-1878.[Abstract/Free Full Text]
  92. 47
  93. Valdivia, R. H., and S. Falkow. 1997. Fluorescence-based isolation of bacterial genes expressed within host cells. Science 277:2007-2111.[Abstract/Free Full Text]
  94. 48
  95. Venkatesan, M. M., M. B. Goldberg, D. J. Rose, E. J. Grotbeck, V. Burland, and F. R. Blattner. 2001. Complete DNA sequence and analysis of the large virulence plasmid of Shigella flexneri. Infect. Immun. 69:3271-3285.[Abstract/Free Full Text]
  96. 49
  97. Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199.[CrossRef][Medline]
  98. 50
  99. Wilson., R. L., A. R. Tvinnereim, B. D. Jones, and J. T. Harty. 2001. Identification of Listeria monocytogenes in vivo-induced genes by fluorescence-activated cell sorting. Infect. Immun. 69:5016-5024.[Abstract/Free Full Text]


Infection and Immunity, August 2002, p. 4379-4388, Vol. 70, No. 8
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.8.4379-4388.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Fisher, C. R., Davies, N. M. L. L., Wyckoff, E. E., Feng, Z., Oaks, E. V., Payne, S. M. (2009). Genetics and Virulence Association of the Shigella flexneri Sit Iron Transport System. Infect. Immun. 77: 1992-1999 [Abstract] [Full Text]  
  • Runyen-Janecky, L., Daugherty, A., Lloyd, B., Wellington, C., Eskandarian, H., Sagransky, M. (2008). Role and Regulation of Iron-Sulfur Cluster Biosynthesis Genes in Shigella flexneri Virulence. Infect. Immun. 76: 1083-1092 [Abstract] [Full Text]  
  • Sabri, M., Caza, M., Proulx, J., Lymberopoulos, M. H., Bree, A., Moulin-Schouleur, M., Curtiss, R. III, Dozois, C. M. (2008). Contribution of the SitABCD, MntH, and FeoB Metal Transporters to the Virulence of Avian Pathogenic Escherichia coli O78 Strain {chi}7122. Infect. Immun. 76: 601-611 [Abstract] [Full Text]  
  • Boulette, M. L., Payne, S. M. (2007). Anaerobic Regulation of Shigella flexneri Virulence: ArcA Regulates fur and Iron Acquisition Genes. J. Bacteriol. 189: 6957-6967 [Abstract] [Full Text]  
  • Murphy, E. R., Payne, S. M. (2007). RyhB, an Iron-Responsive Small RNA Molecule, Regulates Shigella dysenteriae Virulence. Infect. Immun. 75: 3470-3477 [Abstract] [Full Text]  
  • Runyen-Janecky, L., Dazenski, E., Hawkins, S., Warner, L. (2006). Role and Regulation of the Shigella flexneri Sit and MntH Systems.. Infect. Immun. 74: 4666-4672 [Abstract] [Full Text]  
  • Diaz, M., Esteban, A., Fernandez-Abalos, J. M., Santamaria, R. I. (2005). The high-affinity phosphate-binding protein PstS is accumulated under high fructose concentrations and mutation of the corresponding gene affects differentiation in Streptomyces lividans. Microbiology 151: 2583-2592 [Abstract] [Full Text]  
  • Rediers, H., Rainey, P. B., Vanderleyden, J., De Mot, R. (2005). Unraveling the Secret Lives of Bacteria: Use of In Vivo Expression Technology and Differential Fluorescence Induction Promoter Traps as Tools for Exploring Niche-Specific Gene Expression. Microbiol. Mol. Biol. Rev. 69: 217-261 [Abstract] [Full Text]  
  • Runyen-Janecky, L. J., Boyle, A. M., Kizzee, A., Liefer, L., Payne, S. M. (2005). Role of the Pst System in Plaque Formation by the Intracellular Pathogen Shigella flexneri. Infect. Immun. 73: 1404-1410 [Abstract] [Full Text]  
  • Lucchini, S., Liu, H., Jin, Q., Hinton, J. C. D., Yu, J. (2005). Transcriptional Adaptation of Shigella flexneri during Infection of Macrophages and Epithelial Cells: Insights into the Strategies of a Cytosolic Bacterial Pathogen. Infect. Immun. 73: 88-102 [Abstract] [Full Text]  
  • Mason, K. M., Munson, R. S. Jr., Bakaletz, L. O. (2003). Nontypeable Haemophilus influenzae Gene Expression Induced In Vivo in a Chinchilla Model of Otitis Media. Infect. Immun. 71: 3454-3462 [Abstract] [Full Text]  
  • Wei, J., Goldberg, M. B., Burland, V., Venkatesan, M. M., Deng, W., Fournier, G., Mayhew, G. F., Plunkett, G. III, Rose, D. J., Darling, A., Mau, B., Perna, N. T., Payne, S. M., Runyen-Janecky, L. J., Zhou, S., Schwartz, D. C., Blattner, F. R. (2003). Complete Genome Sequence and Comparative Genomics of Shigella flexneri Serotype 2a Strain 2457T. Infect. Immun. 71: 2775-2786 [Abstract] [Full Text]  
  • Runyen-Janecky, L. J., Reeves, S. A., Gonzales, E. G., Payne, S. M. (2003). Contribution of the Shigella flexneri Sit, Iuc, and Feo Iron Acquisition Systems to Iron Acquisition In Vitro and in Cultured Cells. Infect. Immun. 71: 1919-1928 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Runyen-Janecky, L. J.
Right arrow Articles by Payne, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Runyen-Janecky, L. J.
Right arrow Articles by Payne, S. M.