Previous Article | Next Article ![]()
Infection and Immunity, August 2002, p. 4379-4388, Vol. 70, No. 8
0019-9567/02/$04.00+0 DOI: 10.1128/IAI.70.8.4379-4388.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Section for Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, Texas 78712-1095
Received 28 February 2002/ Returned for modification 16 April 2002/ Accepted 29 April 2002
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Although much is known about gene induction in response to temperature and other discrete environmental signals in S. flexneri, less is known about the complex signals that the intracellular bacteria encounter in host cells and the genes that are induced in response to these signals. Most of the work to identify bacterial genes that are induced in response to eukaryotic signals has been done with Salmonella enterica serovar Typhimurium (13, 14, 23, 47). More than 30 different genes are induced when S. enterica serovar Typhimurium is in macrophage-like cell lines. Many of these genes are members of the PhoPQ regulon, which is induced by low magnesium concentrations, and encode a variety of proteins, including magnesium transporters, adhesins, metabolic genes, capsule biosynthesis proteins, and proteases (13, 14, 23, 47). Several S. enterica serovar Typhimurium genes whose expression is activated in response to low iron concentrations were also induced in eukaryotic cell lines. These genes include fhuA, cirA, and entF, which encode proteins that are components of siderophore-mediated iron uptake systems (13, 20). Genes encoding a high-affinity phosphate transport protein (PhoA), a phospholipid-recycling protein (Aas), and a type III secretion system component (SsaH) were also identified (47).
The intracellular environmental signals and conditions that S. enterica serovar Typhimurium encounters reflect its residence in the vacuole of the macrophage. In contrast, cytoplasmic intracellular pathogens such as Listeria monocytogenes, which resides in the cytosol of either epithelial cells or macrophages, and S. flexneri, which resides in the cytosol of epithelial cells, experience a different environment. Several groups have identified L. monocytogenes genes that are induced while the bacterium is in the macrophage cytosol or in mice (6, 10, 22, 50). These genes encode nucleotide metabolism proteins; sugar uptake systems; DNA topoisomerase; a hemolysin-like gene; listerolysin O, which lyses the phagosome; and ActA, which polymerizes actin to allow intercellular spread. Genes induced by Shigella growing in the intracellular environment have not been identified. The work described in this paper was undertaken to identify S. flexneri genes that are induced when the bacteria are growing in the cytosol of an epithelial cell line.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
All PCRs were carried out using either Taq (Qiagen) or Pfu polymerase (Stratagene Cloning Systems, La Jolla, Calif.) according to the manufacturers' instructions. Taq was used for all PCRs unless the fragments were to be cloned or sequenced, in which case Pfu was used. Primers for individual PCRs are listed in the appropriate sections below.
Construction of S. flexneri DNA-gfp libraries.
The promoterless green fluorescent protein gene (gfp) vector pLR29 was constructed as follows. pGTXN3 was partially digested with SspI, and the 5.3-kb fragment was ligated to a 1.7-kb BamHI-Klenow-treated fragment from pGP704 (29) that carries the RP4 mobilization region. pLR44 was constructed by digestion of pLR29 with SmaI and XbaI followed by insertion of an XbaI-digested synthetic oligonucleotide carrying the SmaI, ClaI, HindIII, and BamHI restriction enzyme sites. Chromosomal DNA from SA514 was partially digested with either Sau3A1 or TaqI, and fragments of 2 kb or less were ligated to pLR29 digested with BamHI or pLR44 digested with ClaI, respectively. The ligation mixture was electroporated into SM10
pir. Fifteen thousand colonies were obtained for each Sau3A1 library, and 10,000 colonies were obtained for each TaqI library. Three pools of each library, each containing 3,000 to 5,000 colonies from separate plates, were moved into S. flexneri SN555-38 by conjugation.
Tissue culture cell invasion and plaque assays. Monolayers of Henle cells (intestine 407 cells; American Type Culture Collection, Manassas, Va.) were used in all experiments and were routinely maintained in Henle medium, which consists of minimum essential medium, 10% tryptose phosphate broth, 2 mM glutamine, nonessential amino acids, and 10% fetal bovine serum (Life Technologies, Grand Island, N.Y.) in a 5% CO2 atmosphere at 37°C. Invasion assays were done as described previously (11, 15), with the addition of gentamicin after the phosphate-buffered saline (PBS) washes 30 min postinvasion. Plaque assays were done as described previously (31) with the modifications described by Hong et al. (15), and plaques were scored after 3 to 4 days.
Differential fluorescence induction (DFI). An overnight culture of each library was subcultured into LB broth containing carbenicillin and 0.1% deoxycholate and grown to mid-logarithmic phase. Each culture was allowed to invade Henle cells for 3 to 3.5 h. Bacteria were released from the Henle cells by treatment with 0.5 to 2.5% deoxycholate and pelleted for 2 min at 17,000 x g. These bacteria were resuspended in low-salt PBS (containing 4 instead of 8 g of NaCl per liter and 1 instead of 2 g of KCl per liter), and the bacteria with the highest fluorescence were collected using a FACsCaliber instrument and analyzed using CELLQUEST software (Becton Dickinson, Franklin Lakes, N.J.). The collected fluorescent bacteria were recovered onto a 0.45-µm filter (Nalgene, Rochester, N.Y.) which was suspended in LB broth containing antibiotics and incubated overnight at 37°C. The cultures were subcultured 1:1,000 into LB broth containing carbenicillin and grown to mid-logarithmic phase. Bacteria were diluted into low-salt PBS, and the bacteria with the lowest fluorescence were collected. The gate for recovering low-fluorescent cells was set to a maximum of about 10-fold higher than the fluorescence level of Shigella without the gfp plasmid, so as not to exclude promoters that have a basal level of expression. The recovered cells were subjected to additional rounds of differential fluorescence induction (DFI) as described above and in Results. FACsCaliber amplifier settings were as follows: forward scatter = E01, side scatter = 505, and relative fluorescence intensity from 515 to 545 nm = 798.
Amplification and recloning of the intracellularly induced promoters. The intracellularly induced promoters were amplified from the SA514 chromosomal DNA with the following primer pairs: lysA, TCTTCAAACAGACGCAGTCCTTG and GCTCTAGAGCAAACGCAGCAGATTTTC; sufA, TATTCTTATCGCCCCTTCAAGAGC and GCTCTAGAGCAGCCCGTTTGCTTCAC; pstS, CATCGTTGTCATCTCACCC and GCTCTAGATTTGCCCAGGTAGATGTC; phoA, TGGAGATTATCGTCACTGC and GCTCTAGAGGCATTTCTGGTGTC; bioA, GACGAGGATCGAAATGCTGGC and GCTCTAGACAAAGGCAAGATCGTCCG; fhuA, CGGGATCCAGGCGGCGTATCTGACACTATG and GCTCTAGAATCGGCGTATCGGTTTTAG; and sitA, CGGGATCCGGGCAAAAATCACAACTATC and GCTCTAGAGGTTATGGATGAGACTTCTGC. The PCR products were digested with XbaI or BamHI-XbaI (the sites are underlined in the primer sequences above) and cloned into pLR29 digested with SmaI-XbaI or BamHI-XbaI. The uhpT promoter was not recloned, as it was isolated numerous times as independent SIIG (see below) clones (Table 1). The IS600 clone was not reconstructed, because we believe that gfp expression may be driven by a cryptic promoter.
Sequence analysis of the S. flexneri promoter-gfp clones. For determining the nucleotide sequence, primers in the promoterless gfp gene (gfp-2, CTGTTTCATATGATCTGGG) and in the multicloning site upstream of the gfp gene (gfpUPMCS, CCATAAACTGCCAGGGAA) were used to sequence either purified plasmid DNA or PCR products generated with gfp-2 and gfpUPMCS. Nucleotide sequences were determined by the Molecular Biology Sequencing Facility at the University of Texas at Austin.
Construction of mutations in S. flexneri by allelic exchange. Allelic exchange with pHM5 (37) containing S. flexneri genes disrupted with the chloramphenicol resistance gene (described below) was done in SM100. SM100 is a streptomycin-resistant derivative of SA100 and shows the same invasion, intracellular growth, and plaque phenotypes as the parental strain (S. Seliger, personal communication). Disruption of the chromosomal genes was confirmed by PCR analysis.
For construction of the allelic exchange plasmids for generating the uhpT mutation, the uhpT gene was amplified from SA514 with primers uhpT1 (5'GCTGGTTGTATGGCGATAGTCG3') and uhpT2 (5'CCACTTTGGTCTGAATCACCTCG3') and was cloned into pWKS30 (49) digested with EcoRV and HincII to generate pLR59. A 1.6-kb fragment containing a chloramphenicol resistance gene (cam) was isolated from pMA9 (16) by digestion with HincII and was inserted into the MscI site in uhpT. The gene with the cam resistance cassette was excised as an XhoI-XbaI fragment and ligated into pHM5 digested with SalI-XbaI to generate pLR60.
For construction of the allelic exchange plasmids for generating the pstS mutation, the pstS gene was amplified from pSIIG5 with the gfp-2 and gfpUPMCS primers and digested with XbaI, treated with Klenow fragment of DNA polymerase I, and digested with EcoRI. The resulting fragment was cloned into pWKS30 digested with EcoRI and HincII to generate pLR77. A 1.6-kb fragment containing the cam gene was isolated from pMA9 by digestion with HincII and was inserted into the HincII sites in pstS. The gene with the cam resistance cassette was excised as an XhoI-XbaI fragment and ligated into pHM5 digested with SalI-XbaI to generate pLR78.
Screening of a chromosomal library for the pst operon. A cosmid library of S. flexneri chromosomal DNA (K. Lawlor, unpublished data) in E. coli HB101 (38) was screened by colony hybridization for clones that hybridize to the S. flexneri nucleotide sequences approximately 100 bp upstream of pstS. This strategy was chosen because the S. flexneri sequence upstream of pstS (beginning 107 bp 5' to the pstS translational start site) is not similar to the E. coli sequence or any other nucleotide sequence in the nonredundant database and because E. coli contains a pstS gene that would hybridize to the S. flexneri pstS probe. The deduced amino acid sequence of the 0.9-kb region 5' to S. flexneri pstS is 26% identical and 42% similar to amino acid residues 111 to 354 of the long polar fimbrial operon protein LpfD in S. enterica serovar Typhimurium. The 228-bp DNA fragment for the probe (which contains the lpfD but not the pstS sequences) was isolated as an EcoRV-SmaI fragment from a PCR product generated by using primers LR20 (5'GGAAGTGCGGTAACAACA3') and LR19 (5' TTTGCCCAGGTAGATGT3') and S. flexneri DNA as the template. Probe labeling, hybridization, and detection were performed as described in the instructions for the Genius II System (Boehringer Mannheim). Cosmids that hybridized with the lpfD probe were further screened for the pstS sequences by PCR with primers LR19 and LR20.
Macrophage apoptosis assays. Monolayers of the J774A.1 macrophage cell line (American Type Culture Collection) were routinely maintained in Dulbecco's modified Eagle's medium with 4 mM L-glutamine, 1.5 g of sodium bicarbonate per liter, 4.5g of glucose per liter, and 10% fetal bovine serum (Life Technologies) in a 5% CO2 atmosphere at 37°C. For apoptosis assays, semiconfluent J774A.1 cell monolayers in 35-mm-diameter plates were infected with 108 bacteria as described previously for Henle cell invasions (11). Apoptosis was assayed after an additional 60 to 90 min by using the ApoAlert Annexin V-fluorescein isothiocyanate kit (Clontech Laboratories, Inc., Palo Alto, Calif.).
| RESULTS |
|---|
|
|
|---|
Six independent libraries of S. flexneri chromosomal DNA fragments fused to a plasmid-borne promoterless gfp gene in S. flexneri SN555-38 were used to infect Henle cells. After 3 to 3.5 h, the Henle cells were lysed to release the intracellular bacteria, and fluorescent bacteria (due to gfp expression driven by an active promoter) were separated from the nonfluorescent bacteria by FACS. The collected cells (1 to 3% of the original population) were then grown in LB broth, and the least fluorescent bacteria (16 to 35% of the populations), which contain promoters that are inactive or less active under laboratory conditions, were collected by FACS. This low-fluorescent population was used to reinfect Henle cells, and the most fluorescent bacteria were collected (0.1 to 2% of the populations). At this point, half of the libraries were subjected to one last round of growth in LB broth followed by FACS to obtain the least fluorescent bacteria.
Identification and characterization of the SIIGs isolated by DFI. One hundred thirty-two clones (22 from each library) isolated as described above were individually assessed for differential fluorescence, and 44 were verified as having increased gfp expression during growth in Henle cells compared to growth in LB broth (data not shown). Of these, 16 clones appeared to be unique, based on fluorescence levels and DNA insert size (data not shown).
The S. flexneri DNA fragment from each SIIG clone was sequenced, and the sequences were used to search GenBank to determine the identity of the intracellularly induced genes. Nine different promoters were found. Seven of the nine SIIGs had nucleotide sequences that were greater than 95% identical to E. coli K-12 genes (Table 2). These seven SIIGs include genes involved in metabolism (uhpT, bioA, and lysA), iron acquisition and metabolism (fhuA and sufA), and phosphate utilization (pstS and phoA). The deduced amino acid sequence of the insert from one SIIG was 85% similar to the S. enterica serovar Typhimurium SitA protein, a putative iron transporter that is not found in E. coli K-12. The nucleotide sequence from another SIIG insert was 97% identical to the nucleotide sequence of IS600, which encodes most of the transposase protein. However, the known promoter for IS600 is not part of the insert. It is possible that a cryptic, internal promoter in the insert is activating gfp expression.
|
|
(i) SIIG expression in ISM. Headley and Payne (12) developed a defined medium (ISM) that mimics the intracellular environment in salt and ion composition. Since the SIIG promoters are induced in response to growth in Henle cells, it was possible that the signals inducing some of the promoters would also be reproduced in ISM. S. flexneri strains containing each SIIG-gfp fusion were grown in ISM, T medium (a minimal medium that does not mimic the intracellular environment), and LB broth, and the fluorescence was measured (Table 3). Expression of the sufA-gfp and IS600-gfp fusions was induced in ISM, but not T medium, relative to LB broth, suggesting that ISM does mimic the intracellular environment to some extent. Expression of the bioA-gfp and lysA-gfp fusions was induced in T medium relative to LB broth but was induced to an even higher level in ISM. The phoA and pstS promoters showed no induction in T medium and a very slight induction in ISM (approximately twofold). The sitA and fhuA promoters appeared to be repressed in T medium relative to LB broth. The uhpT promoter was not induced in either T medium or ISM. Thus, some but not all of the environmental signals encountered in the cell cytosol are reproduced by these in vitro conditions.
|
|
|
|
Effects of mutations in SIIGs on survival or growth in the Henle cell. Mutations were constructed in several of the SIIGs to determine whether intracellular induction of genes correlated with their importance for survival and growth in the eukaryotic cell.
(i) Characterization of an S. flexneri uhpT mutant. Genes that are induced in response to the intracellular environment may be required for survival or growth in the intracellular environment. Since the uhpT gene is one of the more strongly induced SIIGs that was isolated and was also the most frequently isolated SIIG, we generated a uhpT disruption mutation in S. flexneri SM100 by allelic exchange. The uhpT mutant, SM165, was tested for the ability to grow with G6P as the sole carbon source (Fig. 5). SM165 showed significantly reduced growth in ISM with G6P as the sole carbon source compared to the parental strain SM100, whereas both strains grew equally well in ISM containing glucose as the sole carbon source.
|
(ii) Characterization of an S. flexneri pstS mutant. The S. enterica serovar Typhimurium pstS gene is induced when serovar Typhimurium is in the macrophage, but it is not required for survival in a macrophage-like cell line (47). Since S. flexneri pstS was induced in the Henle cell, we examined whether PstS is required for growth or survival in the Henle cell. A pstS deletion mutation in S. flexneri SM100 was generated by allelic exchange. We tested the pstS mutant for the ability to grow in phosphate-limited medium by monitoring the growth of cultures in T medium supplemented with either high (2 mM) or low (0.01 mM) levels of potassium phosphate. The pstS mutant SM169 grew similarly to the parent strain in both high- and low-phosphate media after 24 h (data not shown). These data suggest that other phosphate transport systems can compensate for the lack of PstS under low-phosphate conditions in vitro.
We tested the pstS mutant SM169 for the ability to invade and form plaques on Henle cells. SM169 invaded Henle cells and formed similar numbers of plaques as the parental strain SM100. However, the plaques were reduced in size, suggesting that the Pst system may be the major phosphate uptake system in Shigella within Henle cells (Fig. 6). Further, we tested the ability of SM169 to cause apoptosis in the macrophage cell line J774A.1. Infection of J774A.1 with SM169 resulted in a similar level of apoptosis as infection with the parental strain SM100 (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
Identification of SIIGs and characterization of their regulation may provide insights about Shigella physiology in the eukaryotic cytosol and the nature this environment. For example, the S. flexneri uhpT gene, which encodes a cytoplasmic membrane transporter of hexose phosphates that mediated G6P utilization in vitro (2, 43), was induced by the Henle cytosol and by G6P in vitro. Because glucose is phosphorylated immediately after transport into the eukaryotic cytosol, G6P, not glucose, is probably the most plentiful and easily utilized carbon source for Shigella growing in the cytosol. Intracellular induction of uhpT would allow Shigella to take advantage of this carbon source. Additionally, intracellular induction of S. flexneri genes encoding phosphate utilization systems (pstS and phoA) and iron uptake and metabolism systems (sitA, fhuA, and sufA) suggests that phosphate and iron may be limiting in the cytosol, especially since these genes were induced by iron and phosphate limitation, respectively, in vitro. Intracellular induction of these S. flexneri genes would provide the bacterium with an increased ability to acquire phosphate and iron in the eukaryotic cytosol. Likewise, Henle cell induction of the S. flexneri lysA and bioA genes suggests that free lysine and biotin may be limiting in the eukaryotic intracellular environment, since in E. coli these genes are repressed by lysine and biotin, respectively (4, 7).
Although identification of individual SIIGs and the in vitro signals that regulate these genes may provide insights into Shigella physiology and the nature of the eukaryotic cytosolic environment, the in vivo situation is likely to be extremely complex, as there are numerous eukaryotic cytosolic signals and multiple bacterial systems to respond to these signals. For example, although the uhpT gene is strongly induced in the Henle cell, the S. flexneri uhpT mutant formed wild-type plaques on Henle cell monolayers, suggesting that the uhpT mutant was multiplying and spreading at a rate similar to that of the parent strain. Therefore, carbon sources in addition to hexose-6-phosphates must be available to Shigella in the host cytosol, and Shigella possesses systems in addition to UhpT for carbon acquisition and utilization.
Iron transport and the induction of expression of iron transport systems in intracellular Shigella are also likely to be complex due to the large number of Shigella iron acquisition genes. We had previously shown that an S. dysenteriae tonB mutant, in which all high-affinity iron transport is eliminated, was defective in intracellular growth in Henle cells, but no single iron transport system has been found to be essential in tissue culture assay (35). At least three S. flexneri genes encoding proteins predicted to be involved in iron transport or metabolism (sitA, fhuA, and sufA) were induced when S. flexneri was in the Henle cell. In Salmonella enterica serovar Typhimurium, fhuA, sitA, and the siderophore biosynthesis gene entF are also induced when the bacteria are in a macrophage cell line, suggesting the importance of iron acquisition in other intracellular pathogens (13, 14, 20). The promoters of the S. flexneri sitA, fhuA, and sufA intracellularly induced genes have putative binding sites for Fur, which represses gene expression when bound to iron, and these promoters were derepressed in the presence of the iron chelator EDDA in vitro (unpublished data and Fig. 4B). Induction of these S. flexneri genes in the Henle cells suggests that the iron level may be lower in the Henle cell cytosol than in LB broth. It is also possible that some of these S. flexneri promoters may be regulated in response to signals in Henle cells in addition to iron limitation. For example, the S. flexneri sufA promoter is induced in response to either iron limitation or oxidative stress in vitro. In the Henle cell, induction of an S. flexneri promoter may be in response to multiple signals that are integrated to give a particular level of induction.
The redox state of the intracellular environment may be a signal for Shigella gene expression in Henle cells. The redox state of the Henle cell cytoplasm has not been clearly defined but is thought to be reducing (18). However, our data are consistent with the possibility that there are also oxidative stress signals in the Henle cell. First, the sufA promoter is induced in response to oxidative stress in vitro. Furthermore, the uhpT gene is part of the OxyS regulon in E. coli, which is induced in response to oxidative stress, and the uhpT promoter was induced when oxyS was overexpressed in E. coli (1).
Intracellular induction of the S. flexneri pstS and phoA genes, which encode a component of a high-affinity phosphate transport system (44) and alkaline phosphatase (19), respectively, is complex, as only part of the bacterial population that was grown in Henle cells induced the pstS and phoA genes during the 3.5-h infection (Fig. 1). There are several possible reasons for this partial induction. First, individual Henle cells may have different levels of phosphate starvation, and the distribution of pstS and phoA induction may reflect the differences in phosphate levels in the infected cells. Second, different parts of the Henle cell may have different phosphate levels. Third, the pst operon may be under the control of a positive feedback loop such as the one for the ara promoter. Fusions of the ara promoter to gfp show partial induction in response to an intermediate level of the inducer arabinose at the individual cell level (41).
Although only part of the Shigella population induced the pstS and phoA genes during the 3.5-h Henle cell infection, the ability to induce pstS during the 3-day growth in Henle cells in a plaque assay is important because an S. flexneri pstS mutant formed smaller plaques than the parent strain on a Henle cell monolayer. While there are several possible reasons for the small-plaque phenotype, the most likely is that the pstS mutant grows slower due to a deficiency in phosphate uptake. This result was somewhat unexpected, since an S. enterica serovar Typhimurium pstS mutant was not attenuated in virulence (47). Furthermore, the S. flexneri pstS mutant grows as well as the parent strain in low-phosphate media in vitro, and it is likely that S. flexneri contains multiple systems for phosphate uptake. In E. coli, which is closely related to S. flexneri, inorganic phosphate can also be taken up by the low-affinity, but high-velocity, Pit transporter (8), and glycerol-3-phosphate can be taken up by the Ugp system (40). However, it is not known how many of these systems S. flexneri possesses. The fact that other phosphate uptake systems compensate for pstS defects in vitro but not in vivo suggests that the Pst system is the major phosphate uptake system in Shigella within Henle cells. It is also possible that the Pst system may transport another compound and that it is the defect in transport of this compound that is responsible for the small-plaque phenotype. We believe that this is unlikely, as the Pst system is extremely specific for the mono- and divalent phosphate ions and binds inorganic oxyanions such as arsenate and sulfate poorly (3, 26).
Previous studies to identify induction of genes when intracellular pathogens are in host environments yielded numerous bacterial genes, including those involved in metabolism and biosynthesis, those involved in transport of small molecules and compounds, and putative classical virulence genes that contribute solely to pathogenesis and not to basic metabolic functions. We did not identify any SIIGs that were classical Shigella virulence genes. Most of the virulence genes are on the large plasmid (48), but none of these genes were recovered when we did a DFI screen, as described in this study, using a virulence plasmid-gfp library (data not shown). This was not surprising given that many of the known virulence genes, including ipaB, ipaC, and the mxi-spa genes, are required for entry into the eukaryotic cell (27) and therefore must be induced in the extracellular environment. This may be true for other virulence plasmid-carried genes. Another factor that may contribute is the multicopy nature of the promoterless gfp plasmids, which may result in titrating out the binding of regulatory proteins to plasmid-carried virulence gene promoters. Also, promoters on the gfp fusion plasmid may have different levels of supercoiling than those on the virulence plasmid, which may interfere with normal regulatory patterns. Porter and Dorman (34) have shown that the level of supercoiling affects some of the virulence genes in S. flexneri.
The identification of SIIGs suggests that signals such as G6P, phosphate limitation, and iron limitation may be indicators that S. flexneri is inside a eukaryotic cell. It is possible that these signals may regulate other Shigella genes that are important for survival, growth, and cell-to-cell spread, although further work examining the effect of mutations in the regulatory genes that detect and potentiate these signals will be needed. Many of the SIIGs isolated are part of functionally redundant systems (e.g., iron transport), and it is likely that the loss of one system would be compensated for by the presence of other systems. An exception to this is the Pst system, which appears to be the major phosphate uptake system in Henle cells but not in phosphate-limited T medium. These data suggest that Shigella, and perhaps other invasive bacteria, have evolved multiple systems for survival and growth that are induced in response to the signals in the intracellular environment and that induction of each of these systems may contribute to survival and growth in the intracellular environment.
| ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grants AI09918 awarded to L. J. Runyen-Janecky and AI16935 awarded to S. M. Payne.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
| 1. | Altuvia, S., D. Weinstein-Fischer, A. Zhang, L. Postow, and G. Storz. 1997. A small, stable RNA induced by oxidative stress: role as a pleiotropic regulator and antimutator. Cell 90:43-53.[CrossRef][Medline] |
| 2. | Ambudkar, S. V., T. J. Larson, and P. C. Maloney. 1986. Reconstitution of sugar phosphate transport systems of Escherichia coli. J. Biol. Chem. 261:9083-9086. |
| 3. | Bennett, R. L., and M. H. Malamy. 1970. Arsenate resistant mutants of Escherichia coli and phosphate transport. Biochem. Biophys. Res. Commun. 40:496-503.[CrossRef][Medline] |
| 4. | Chenais, J., C. Richaud, J. Ronceray, H. Cherest, Y. Surdin-Kerjan, and J. C. Patte. 1981. Construction of hybrid plasmids containing the lysA gene of Escherichia coli: studies of expression in Escherichia coli and Saccharomyces cerevisiae. Mol. Gen. Genet. 182:456-461.[CrossRef][Medline] |
| 5. | Dorman, C. J., and M. E. Porter. 1998. The Shigella virulence gene regulatory cascade: a paradigm of bacterial gene control mechanisms. Mol. Microbiol. 29:677-684.[CrossRef][Medline] |
| 6. | Dubail, I., P. Berche, and A. Charbit. 2000. Listeriolysin O as a reporter to identify constitutive and in vivo-inducible promoters in the pathogen Listeria monocytogenes. Infect. Immun. 68:3242-3250. |
| 7. | Eisenberg, M. A. 1985. Regulation of the biotin operon in E. coli. Ann. N.Y. Acad. Sci. 447:335-349.[Medline] |
| 8. | Elvin, C. M., N. E. Dixon, and H. Rosenberg. 1986. Molecular cloning of the phosphate (inorganic) transport (pit) gene of Escherichia coli K12. Identification of the pit+ gene product and physical mapping of the pit-gor region of the chromosome. Mol. Gen. Genet. 204:477-484.[CrossRef][Medline] |
| 9. | Friedman, A. M., S. R. Long, S. E. Briwn, W. J. Buikema, and F. Ausubel. 1982. Construction of a broad host range cosmid cloning vector and its uses in the genetic analysis of Rhizobium meliloti. Gene 18:289-296.[CrossRef][Medline] |
| 10. | Gahan, C. G., and C. Hill. 2000. The use of listeriolysin to identify in vivo induced genes in the gram-positive intracellular pathogen Listeria monocytogenes. Mol. Microbiol. 36:498-507.[CrossRef][Medline] |
| 11. | Hale, T. L., and S. B. Formal. 1981. Protein synthesis in HeLa or Henle 407 cells infected with Shigella dysenteriae 1, Shigella flexneri 2a, or Salmonella typhimurium W118. Infect. Immun. 32:137-144. |
| 12. | Headley, V. L., and S. M. Payne. 1990. Differential protein expression by Shigella flexneri in intracellular and extracellular environments. Proc. Natl. Acad. Sci. USA 87:4179-4183. |
| 13. | Heithoff, D. M., C. P. Conner, P. C. Hanna, S. M. Julio, U. Hentschel, and M. J. Mahan. 1997. Bacterial infection as assessed by in vivo gene expression. Proc. Natl. Acad. Sci. USA 94:934-939. |
| 14. | Heithoff, D. M., C. P. Conner, U. Hentschel, F. Govantes, P. C. Hanna, and M. J. Mahan. 1999. Coordinate intracellular expression of Salmonella genes induced during infection. J. Bacteriol. 181:799-807. |
| 15. | Hong, M., Y. Gleason, E. E. Wyckoff, and S. M. Payne. 1998. Identification of two Shigella flexneri chromosomal loci involved in intercellular spreading. Infect. Immun. 66:4700-4710. |
| 16. | Hong, M., and S. M. Payne. 1997. Effect of mutations in Shigella flexneri chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and serum resistance. Mol. Microbiol. 24:779-791.[CrossRef][Medline] |
| 17. | Huang, T. C., R. F. Lin, M. K. Chu, and H. M. Chen. 1999. Organization and expression of nitrogen-fixation genes in the aerobic nitrogen-fixing unicellular cyanobacterium Synechococcus sp. strain RF-1. Microbiology 145:743-753.[Medline] |
| 18. | Hwang, C., A. J. Sinskey, and H. F. Lodish. 1992. Oxidized redox state of glutathione in the endoplasmic reticulum. Science 257:1496-1502. |
| 19. | Inouye, H., S. Michaelis, A. Wright, and J. Beckwith. 1981. Cloning and restriction mapping of the alkaline phosphatase structural gene (phoA) of Escherichia coli and generation of deletion mutants in vitro. J. Bacteriol. 146:668-675. |
| 20. | Janakiraman, A., and J. M. Slauch. 2000. The putative iron transport system SitABCD encoded on SPI1 is required for full virulence of Salmonella typhimurium. Mol. Microbiol. 35:1146-1155.[CrossRef][Medline] |
| 21. | Kennedy, C. 1971. Induction of colicin production by high temperature or inhibition of protein synthesis. J. Bacteriol. 108:10-19. |
| 22. | Klarsfeld, A. D., P. L. Goossens, and P. Cossart. 1994. Five Listeria monocytogenes genes preferentially expressed in infected mammalian cells: plcA, purH, purD, pyrE and an arginine ABC transporter gene, arpJ. Mol. Microbiol. 13:585-597.[Medline] |
| 23. | Mahan, M. J., J. M. Slauch, and J. J. Mekalanos. 1993. Selection of bacterial virulence genes that are specifically induced in host tissues. Science 259:686-688. |
| 24. | Makino, K., H. Shinagawa, M. Amemura, S. Kimura, A. Nakata, and A. Ishihama. 1988. Regulation of the phosphate regulon of Escherichia coli. Activation of pstS transcription by PhoB protein in vitro. J. Mol. Biol. 203:85-95.[CrossRef][Medline] |
| 25. | Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3:208-218. |
| 26. | Medveczky, N., and H. Rosenberg. 1971. Phosphate transport in Escherichia coli. Biochim. Biophys. Acta 241:494-506.[Medline] |
| 27. | Menard, R., P. J. Sansonetti, and C. Parsot. 1993. Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J. Bacteriol. 175:5899-5906. |
| 28. | Merkel, T. J., D. M. Nelson, C. L. Brauer, and R. J. Kadner. 1992. Promoter elements required for positive control of transcription of the Escherichia coli uhpT gene. J. Bacteriol. 174:2763-2770. |
| 29. | Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583. |
| 30. | Nachin, L., M. El Hassouni, L. Loiseau, D. Expert, and F. Barras. 2001. SoxR-dependent response to oxidative stress and virulence of Erwinia chrysanthemi: the key role of SufC, an orphan ABC ATPase. Mol. Microbiol. 39:960-972.[CrossRef][Medline] |
| 31. | Oaks, E. V., M. E. Wingfield, and S. B. Formal. 1985. Plaque formation by virulent Shigella flexneri. Infect. Immun. 48:124-129. |
| 32. | Patzer, S. I., and K. Hantke. 1999. SufS is a NifS-like protein, and SufD is necessary for stability of the [2Fe-2S] FhuF protein in Escherichia coli. J. Bacteriol. 181:3307-3309. |
| 33. | Payne, S. M., D. W. Niesel, S. S. Peixotto, and K. M. Lawlor. 1983. Expression of hydroxamate and phenolate siderophores by Shigella flexneri. J. Bacteriol. 155:949-955. |
| 34. | Porter, M. E., and C. J. Dorman. 1997. Differential regulation of the plasmid-encoded genes in the Shigella flexneri virulence regulon. Mol. Gen. Genet. 256:93-103.[CrossRef][Medline] |
| 35. | Reeves, S. A., A. G. Torres, and S. M. Payne. 2000. TonB is required for intracellular growth and virulence of Shigella dysenteriae. Infect. Immun. 68:6329-6336. |
| 36. | Robb, C. W., C. J. Orihuela, M. B. Ekkelenkamp, and D. W. Niesel. 2001. Identification and characterization of an in vivo regulated D15/Oma87 homologue in Shigella flexneri using differential display polymerase chain reaction. Gene 262:169-177.[CrossRef][Medline] |
| 37. | Runyen-Janecky, L. J., M. Hong, and S. M. Payne. 1999. The virulence plasmid-encoded impCAB operon enhances survival and induced mutagenesis in Shigella flexneri after exposure to UV radiation. Infect. Immun. 67:1415-1423. |
| 38. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 39. | Sansonetti, P. J., and C. Egile. 1998. Molecular bases of epithelial cell invasion by Shigella flexneri. Antonie Leeuwenhoek 74:191-197. |
| 40. | Schweizer, H., and W. Boos. 1983. Cloning of the ugp region containing the structural genes for the pho regulon-dependent sn-glycerol-3-phosphate transport system of Escherichia coli. Mol. Gen. Genet. 192:177-186.[CrossRef][Medline] |
| 41. | Siegele, D. A., and J. C. Hu. 1997. Gene expression from plasmids containing the araBAD promoter at subsaturating inducer concentrations represents mixed populations. Proc. Natl. Acad. Sci. USA 94:8168-8172. |
| 42. | Simon, E. H., and I. Tessman. 1963. Thymidine requiring mutants of phage T4. Proc. Natl. Acad. Sci. USA 50:526-532. |
| 43. | Sonna, L. A., S. V. Ambudkar, and P. C. Maloney. 1988. The mechanism of glucose 6-phosphate transport by Escherichia coli. J. Biol. Chem. 263:6625-6630. |
| 44. | Surin, B. P., H. Rosenberg, and G. B. Cox. 1985. Phosphate-specific transport system of Escherichia coli: nucleotide sequence and gene-polypeptide relationships. J. Bacteriol. 161:189-198. |
| 45. | Takahashi, Y., and M. Nakamura. 1999. Functional assignment of the ORF2-iscS-iscU-iscA-hscB-hscA-fdx-ORF3 gene cluster involved in the assembly of Fe-S clusters in Escherichia coli. J. Biochem. (Tokyo) 126:917-926. |
| 46. | Taylor, R. K., C. Manoil, and J. J. Mekalanos. 1989. Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of Vibrio cholerae. J. Bacteriol. 171:1870-1878. |
| 47. | Valdivia, R. H., and S. Falkow. 1997. Fluorescence-based isolation of bacterial genes expressed within host cells. Science 277:2007-2111. |
| 48. | Venkatesan, M. M., M. B. Goldberg, D. J. Rose, E. J. Grotbeck, V. Burland, and F. R. Blattner. 2001. Complete DNA sequence and analysis of the large virulence plasmid of Shigella flexneri. Infect. Immun. 69:3271-3285. |
| 49. | Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199.[CrossRef][Medline] |
| 50. | Wilson., R. L., A. R. Tvinnereim, B. D. Jones, and J. T. Harty. 2001. Identification of Listeria monocytogenes in vivo-induced genes by fluorescence-activated cell sorting. Infect. Immun. 69:5016-5024. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||