IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldi, D. L.
Right arrow Articles by Cowman, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldi, D. L.
Right arrow Articles by Cowman, A. F.

 Previous Article  |  Next Article 

Infection and Immunity, September 2002, p. 5236-5245, Vol. 70, No. 9
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.9.5236-5245.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Identification and Disruption of the Gene Encoding the Third Member of the Low-Molecular-Mass Rhoptry Complex in Plasmodium falciparum

Deborah L. Baldi, Robert Good, Manoj T. Duraisingh, Brendan S. Crabb, and Alan F. Cowman*

The Walter and Eliza Hall Institute of Medical Research, Melbourne 3050, Australia

Received 16 April 2002/ Returned for modification 29 May 2002/ Accepted 4 June 2002


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The low-molecular-mass rhoptry complex of Plasmodium falciparum consists of three proteins, rhoptry-associated protein 1 (RAP1), RAP2, and RAP3. The genes encoding RAP1 and RAP2 are known; however, the RAP3 gene has not been identified. In this study we identify the RAP3 gene from the P. falciparum genome database and show that this protein is part of the low-molecular-mass rhoptry complex. Disruption of RAP3 demonstrated that it is not essential for merozoite invasion, probably because RAP2 can complement the loss of RAP3. RAP3 has homology with RAP2, and the genes are encoded on chromosome 5 in a head-to-tail fashion. Analysis of the genome databases has identified homologous genes in all Plasmodium spp., suggesting that this protein plays a role in merozoite invasion. The region surrounding the RAP3 homologue in the Plasmodium yoelii genome is syntenic with the same region in P. falciparum; however, there is a single gene. Phylogenetic comparison of the RAP2/3 protein family from Plasmodium spp. suggests that the RAP2/3 duplication occurred after divergence of these parasite species.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The merozoite form of the asexual life cycle in the blood stage of Plasmodium spp. attaches to the surface of the erythrocyte, thus initiating the invasion process (23). Ultrastructural and biochemical studies of merozoites have suggested that the rhoptries play an essential role in the invasion process. These electron-dense organelles, part of the apical complex, are connected to the surface of the apical end of the merozoite by a duct-like structure, and their contents are expelled during erythrocyte invasion (1). Proteins located on the surface of merozoites and those released from the apical organelles, the rhoptries and micronemes, are exposed to the immune system. Consequently, these proteins are potential vaccine candidates, and there is considerable interest in the identification and characterization of proteins in these organelles (2).

A number of proteins located in the rhoptries have been identified and characterized, such as the low-molecular-mass rhoptry protein complex of Plasmodium falciparum (28). This complex consists of various polypeptides, ranging in size from 86 to 37 kDa, that are immunoprecipitated by antibodies to rhoptry-associated protein 1 (RAP1) (7, 11, 29, 43). Several studies established that the largest product, reported to be 86 kDa, is a short-lived precursor of the 82-kDa RAP1 protein and that this 82-kDa protein is further processed to a 67-kDa protein (7, 26, 27, 29). The 42-kDa protein (also reported as 39 kDa) was found to be the product of a second gene, RAP2 (7, 11, 28, 39, 42). Debate remained regarding the origin of the 40-kDa (or 37-kDa) protein also immunoprecipitated as a part of the RAP1 complex. It was suggested that this protein was a breakdown product of either RAP1 or RAP2 (41). It was subsequently shown, however, that RAP1, RAP2, and RAP3 yield different V8 protease cleavage patterns and are thus products of three distinct genes (28). The RAP2 and RAP3 proteins, in particular, were hypothesized to be related molecules, possibly precursor and product. The V8 protease digestion patterns for these two proteins were readily distinguishable, and additionally it was shown via immunodepletion experiments that either RAP2 or RAP3, but not both molecules, were bound to a given RAP complex (28).

The precise function of the RAP complex is unknown, but it is thought to play a role in invasion. Disruption of the RAP1 gene showed that it was not required for merozoite invasion, although obtaining the gene knockout was difficult, suggesting some role for the complex in blood stage growth, albeit a nonessential one (4). Truncation of RAP1 disrupted the interaction with RAP2 and RAP3 in the complex. The truncated form of RAP1 was able to traffic to the rhoptries; however, RAP2 was apparently retained in the endoplasmic reticulum (ER). This suggests that a function of RAP1 is to act as an escorter protein of RAP2 to the rhoptries in P. falciparum (4).

The RAP1 and RAP2 genes have been characterized and sequenced (41, 42), but the RAP3 gene has yet to be identified. In this report, we describe the gene encoding RAP3 and show that this protein is closely related to RAP2. Disruption of the RAP3 gene showed that the RAP3 protein associated with RAP1 in the low-molecular-mass complex.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sequence analysis. Preliminary sequence data at the Sanger Centre website (http://www.sanger.ac.uk) were searched for sequence homology to the RAP2 protein by using tblastn. Predicted protein sequences were aligned using ClustalX 1.81. The RAP2/RAP3 locus of chromosome 5 was analyzed using the resources at the PlasmoDB web site (http://plasmodb.org) (3).

Parasites and transfection. P. falciparum asexual erythrocytic-stage parasites were cultivated (47) and synchronized by standard procedures (31). The parasite line W2mef from Thailand was used in this study (35). W2mef parasites were transfected, for stable transfection, according to previously published protocols (22, 49) with 80 µg of plasmid that had been purified using the Qiagen (Hilden, Germany) plasmid maxi kit. WR99210-resistant transfected parasites were detectable after 2 to 3 weeks of continuous culture. Parasites containing integrated forms of the plasmid were selected, and cloned lines were obtained by limiting dilution (15, 50).

The transfection plasmid pHH1{Delta}RAP3 was constructed by cloning an 810-bp RAP3 insert with a mutated start codon into the pHH1 transfection vector (38). This fragment was amplified by using a D10 genomic DNA template and the forward primer HHR35 (CCCCAGATCTTGTACAGGCGCGCCTAAAAAACGATTAGAAAATTTTTGATTTCG [nucleotides -6 to +24]) and the reverse primer HHR33 (CCCCCTCGAGCCCCCCTAGGGGGATCATCTAAAGAAAATGTTTTACTACG [nucleotides 779 to 804 of the coding region]). A BglII restriction enzyme site (shown in boldface for the forward primer) was introduced at the 5' end of the fragment, and an XhoI restriction enzyme site (shown in boldface for the reverse primer) was introduced at the 3' end of the fragment for cloning. The start codon was mutated from ATG to ACG, as indicated by the underlined base pair in the forward primer. (A schematic representation of the plasmid is shown in Fig. 3A.)



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 3. Disruption of the RAP3 gene. (A) Integration of the pHH1{Delta}RAP3 plasmid by single-site homologous recombination produces a "pseudodiploid," in which the upstream copy of RAP3 is truncated while the downstream copy lacks a promoter element and has a mutated start codon. Two copies of the plasmid have been integrated as shown. E, EcoRI; B, BsrGI. (B) Hybridization of a pulsed-field gel electrophoresis blot, containing separated P. falciparum chromosomes, with pGem plasmid sequences alone (left panel) reveals multiple transgenic sequences in W2mef{Delta}RAP3/0, corresponding to episomal plasmid DNA. After cycling of cultures with or without WR99210, stable parasite line W2mef{Delta}RAP3/1 exhibits a band that comigrates with chromosome 5 along with a more slowly migrating band that does not correspond to any chromosome. Two independent clonal isolates derived from the W2mef{Delta}RAP3/1 transfectants, W2mef{Delta}RAP3c1 and W2mef{Delta}RAP3c2, exhibit a single band that comigrates with chromosome 5. The upper band on both blots corresponds to DNA remaining in the wells. Hybridization of an identical blot with labeled RAP3 (right) confirms that the pGem sequences are present on the same chromosome as RAP3. (C) Digestion of genomic DNA with EcoRI or BsrGI confirms that the RAP3 gene has been disrupted in W2mef{Delta}RAP3c1 and W2mef{Delta}RAP3c2, yielding the expected restriction pattern.

 
Nucleic acids and pulsed-field gel electrophoresis. Genomic DNA was extracted from trophozoite-stage parasites as described previously (12). The analysis of nucleic acids by Southern blot hybridization and recombinant DNA techniques were carried out by using standard procedures. Chromosomes were prepared from trophozoite- and schizont-stage parasites and separated by pulsed-field gel electrophoresis (9) as described previously (13).

RT-PCR. Total RNA was extracted from synchronized parasite cultures (harvested at 10 to 15% parasitemia) by using the RNeasy mini kit (Qiagen) according to the manufacturer's protocol. DNase treatment was performed using the RNase-free DNase set from Qiagen on the RNeasy mini spin columns as prescribed by the manufacturer. For reverse transcriptase PCR (RT-PCR), 10 µl of total RNA from W2mef parasites was reverse transcribed to cDNA by using an oligo(dT) primer and the Superscript II First Strand cDNA Synthesis Kit (Gibco BRL, Gaithersburg, Md.). One microliter of cDNA was then used for each PCR. The oligonucleotides used for RT-PCR were as follows: forward primer R3 RTPCR, GTATATATTAACACATTTGAG (RAP3 5' untranslated region); reverse primer R3int, CACAAAAAGCAAATATATTGG (RAP3 nucleotides 814 to 836 of the coding region); and reverse primer PBDT, CAGTTATAAATACAATCAATTGG (pHH1 Plasmodium berghei DT 3' terminator).

Biosynthetic radiolabeling and immunoprecipitation. Trophozoites from synchronized parasite lines were incubated with 300 µCi of [35S]methionine (NEN, Boston, Mass.) per ml until multinucleated schizonts were apparent, and proteins were extracted as described previously (27) in 1-ml volumes of 1% T-NET (1% Triton X-100, 50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 5 mM EDTA) with Complete (Roche, Mannheim, Germany) protease inhibitor. Immunoprecipitations were performed with the RAP1 monoclonal antibody 7H8/50 (43) and protein G-Sepharose (Pharmacia Biotech, Uppsala, Sweden). Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and visualized by enhancement with Amplify (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom) and autoradiography.

Immunofluorescence. Immunofluorescence of synchronized parasitized erythrocytes was performed on air-dried thin smears after fixation at room temperature in acetone-methanol (9:1) for 5 min. RAP1 was detected using rabbit antibodies raised to a glutathione S-transferase-RAP1 fusion protein and rhodamine-labeled goat anti-rabbit antibodies (Chemicon, Temecula, Calif.). RAP2 was detected using mouse monoclonal antibody 7B2/1H1 and fluorescein isothiocyanate-labeled sheep anti-mouse antibodies (Silenus, Melbourne, Australia). All parasites were also labeled with the 4',6-diamidino-2-phenylindole (DAPI) DNA stain (Molecular Probes Inc., Eugene, Oreg.).

Enzymatic treatment of erythrocytes and invasion assays. W2mef-infected erythrocytes are unable to be purified by Percoll gradient centrifugation, and as a result a novel method was devised to measure erythrocyte invasion (37). This method is dependent on the inability of W2mef merozoites to invade erythrocytes treated with both neuraminidase and trypsin. This method was also adapted to include the use of [3H]hypoxanthine incorporation to determine the invasion rate (10). Erythrocytes were treated as reported previously (17) with various concentrations of either a single enzyme or a combination of enzymes, i.e., 1 mg of TPCK (L-1-tosylamide-2-phenylethyl chloromethyl ketone)-treated trypsin (Sigma, St. Louis, Mo.) per ml, 0.5 mg of soybean trypsin inhibitor (Sigma) per ml, and 0.66 U of Vibrio cholerae neuraminidase (Calbiochem, La Jolla, Calif.) per ml. Enzyme-treated erythrocytes were then washed twice and adjusted to 4% hematocrit in hypoxanthine-free culture medium supplemented with 5% serum and 5% albumax. Parasites were sorbitol synchronized 48 h prior to the invasion assay. On the day of the assay, ring stage parasites were sorbitol synchronized once again and then placed back into culture for 2 h. Parasites were adjusted to 2.5% parasitemia in 4% hematocrit. Pellets of parasitized erythrocytes were then treated with 1 mg of TPCK-treated trypsin per ml and 0.66 U of neuraminidase per ml for 1 h at 37°C. After washing twice, the parasites were treated with 0.5 mg of soybean trypsin inhibitor per ml. Finally the parasites were washed and resuspended in hypoxanthine-free culture medium supplemented with 5% human serum and 5% albumax. The assay was then set up in triplicate, in a final volume of 100 µl, at 0.5% parasitemia in 4% hematocrit in a flat-bottomed 96-well microtiter plate (Becton Dickinson). To allow for reinvasion, parasites were incubated for 48 h before [3H]hypoxanthine (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom) was added at a final concentration of 1 µCi per well. After a further 24 h, the cells were frozen and thawed to lyse infected erythrocytes. Samples were then transferred to glass fiber filters via a cell harvester (Packard), and [3H]hypoxanthine incorporation was quantitated using a scintillation counter. The mean number of counts from the triplicate wells was calculated and expressed as a percentage of the mean counts observed in parallel cultures of each parasite line in untreated, control erythrocytes.

Nucleotide sequence accession number. The GenBank accession number for RAP3 is AF516606.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The RAP3 gene is located on chromosome 5 adjacent to RAP2 in P. falciparum. As RAP2 and RAP3 have similar molecular masses and they both interact with RAP1 (7, 11, 29, 43), it was considered likely that they may share some homology. To test this hypothesis, the RAP2 gene sequence (42) was used to search the P. falciparum genome sequence database (http://www.sanger.ac.uk). RAP2 showed homology to a gene predicted to encode a protein of 44.4 kDa. An alignment of the putative RAP3 protein with RAP2 shows that these proteins are homologous, exhibiting 68% similarity and 44% identity (Fig. 1). The five cysteine residues present in RAP2 are conserved in the putative RAP3 protein, as is the signal sequence cleavage site (39, 42). The RAP3 gene from W2mef was cloned and sequenced and found to be identical to the 3D7 gene present in the genome database, suggesting that polymorphisms in this protein may be limited in the P. falciparum population.



View larger version (113K):
[in this window]
[in a new window]
 
FIG. 1. Sequence alignment of PfRAP2, PfRAP3, and the RAP2/3 homologues from P. yoelii, P. berghei, P. knowlesi, and P. vivax. Identical residues are shown in black, whereas conserved residues are shown in gray. Conserved cysteine residues are indicated by asterisks. The putative signal cleavage site is indicated by an arrow. PLAFA, P. falciparum; PLAYO, P. yoelii; PLABE, P. berghei; PLAKN, P. knowlesi; PLAVI, P. vivax.

 
The RAP2-RAP3 locus of chromosome 5 from P. falciparum was further analyzed, and a schematic of the genes surrounding this locus is shown in Fig. 2. RAP2 and RAP3 are in a subtelomeric location, closely linked to the P. falciparum interspersed repeat antigen (FIRA) (45, 46) and skeleton binding protein (Pfsbp1) (6) genes. A gene predicted to encode a nuclear scaffold-like protein similar to nuc2+ of fission yeast (25) was also closely linked to RAP2 on the centromeric side of the locus. The close linkage of the RAP2 and RAP3 genes in a head-to-tail fashion as well as the high level of similarity suggests that they arose in a gene duplication event.



View larger version (6K):
[in this window]
[in a new window]
 
FIG. 2. Organization of the chromosomal region around the RAP2, RAP3, and RAP2/3 genes of P. falciparum and P. yoelii. The nuc2+ gene encodes a nuclear scaffold-like protein of fission yeast. The FIRA gene encodes the P. falciparum interspersed repeat antigen. The sbp1 gene encodes skeleton binding protein 1.

 
Search analysis of the murine malaria databases (http://plasmodb.org) (The Plasmodium Genome Consortium, 2001) identified a full-length gene in Plasmodium yoelii (PyRAP2/3) and a partial gene in P. berghei (PbRAP2/3) that have similarity to RAP2 (PfRAP2) and RAP3 (PfRAP3) from P. falciparum. Additionally, searching of the Plasmodium vivax (PvRAP2/3) and Plasmodium knowlesi (PkRAP2/3) sequence databases has shown that both of these species also have a gene that is homologous to RAP2 and RAP3. Alignments of the protein sequences encoded by these genes with the protein sequences of PfRAP2 and PfRAP3 show that the P. yoelii, P. berghei, P. knowlesi, and P. vivax proteins have similarity (Fig. 1). The PyRAP2/3 protein shows 30% identity and 49% similarity to PfRAP2 and 32% identity and 55% similarity to PfRAP3. Similarly, PkRAP2/3 has 44% identity and 63% similarity to both PfRAP2 and PfRAP3. The signal sequence cleavage site is conserved in all proteins, as are the positions of three of the five cysteine residues present in RAP2 and RAP3.

The PyRAP2/3 from P. yoelii was found on a 14.7-kb contig from the sequence database. The genes surrounding PyRAP2/3 on this contig were predicted to encode homologues to FIRA (45, 46) and nuc2+ (25), the same genes that flank PfRAP2 and PfRAP3 in P. falciparum (Fig. 2). Therefore P. yoelii has a single RAP2/3 gene, compared to the duplicated PfRAP2 and PfRAP3 genes of P. falciparum.

Targeted disruption of the RAP3 gene in P. falciparum. To disrupt the RAP3 gene, a transfection plasmid was constructed by cloning an 810-bp fragment from the RAP3 gene into the vector pHH1 (38) to produce pHH1{Delta}RAP3 (Fig. 3). The parasite line W2mef was transfected with pHH1{Delta}RAP3 and selected with WR99210. Drug-resistant parasites were selected for those containing integrated forms of the plasmid by one cycle of cultivation without drug (to permit loss of episomal plasmid) (Fig. 3). Chromosomes were analyzed from the W2mef parent and transfected populations W2mefRAP3/0 and W2mef{Delta}RAP3/1, corresponding to parasites isolated shortly after transfection or after one round of cycling, respectively (Fig. 3B). As expected, the pGem probe did not recognize the parental W2mef line but hybridized with several bands in W2mef{Delta}RAP3/0, corresponding to episomal plasmids that typically migrate near chromosomes 6 to 8 under these conditions (15, 34). In contrast, W2mef{Delta}RAP3/1 contained a hybridizing band migrating with chromosome 5, after one cycle for integration, along with a more slowly migrating band that did not correspond to a chromosome. This suggested that there was some integration into the RAP3 gene after one cycle of selection. Hybridization of an identical filter with RAP3 confirmed that the pGem sequences are present on the same chromosome as RAP3 along with the more slowly migrating band (Fig. 3B). The latter band is likely to be a concatameric form of the plasmid, previously observed with other constructs, that has been shown to consist of several copies of the plasmid arranged in a head-to-tail orientation in a complex structure (34). The parasite line W2mef{Delta}RAP3/1 was cloned by limiting dilution, and chromosomes from two independent clonal lines derived from W2mef{Delta}RAP3/1 were analyzed. These lines, designated W2mef{Delta}RAP3c1 and W2mef{Delta}RAP3c2, showed a single hybridizing band migrating with chromosome 5 when hybridized with both plasmid pGem and RAP3 DNA, suggesting plasmid integration into chromosome 5 (Fig. 3B). These clonal lines were used for all further experiments.

In order to confirm that the transfected plasmid pHH1{Delta}RAP3 had integrated by homologous recombination into the RAP3 gene on chromosome 5, purified genomic DNAs from W2mef, W2mef{Delta}RAP3c1, and W2mef{Delta}RAP3c2 were digested with BsrGI and EcoRI prior to Southern blotting (Fig. 3C). The RAP3 probe in W2mef detected a single 14.6-kb BsrGI band, whereas W2mef{Delta}RAP3c1 and W2mef{Delta}RAP3c2 showed a 12.9-kb band and two smaller hybridizing bands of 8.3 and 6.6 kb. Similarly, the RAP3 probe detected a 14.8-kb EcoRI fragment in W2mef, whereas in W2mef{Delta}RAP3c1 and W2mef{Delta}RAP3c2, fragments of 11.5, 9.9, and 6.6 kb were obtained. The extra bands present for EcoRI-digested W2mef are probably the result of enzyme star activity. Two copies of the plasmid had integrated, as evidenced by the 6.6-kb BsrGI and EcoRI fragments, which correspond in size to an extra copy of the plasmid. These results are consistent with a single-site homologous recombination between the transfection plasmid and the endogenous locus, producing a "pseudodiploid" in which the upstream copy of RAP3 is truncated, while the downstream copy lacks a promoter element and has a mutated start codon (Fig. 3A) (14-16, 50).

Several attempts were made to produce antibodies specific to RAP3. Fusion proteins between RAP3 and glutathione S-transferase were expressed in Escherichia coli and injected into rabbits and mice (44), and synthetic RAP3 peptides were also injected into mice and rabbits. Unfortunately, none of these numerous attempts was successful. Therefore, in the absence of specific antisera, RT-PCR was used to analyze the mRNA transcripts produced by both wild-type and {Delta}RAP3 parasites to verify that the RAP3 gene was transcribed and had indeed been disrupted (Fig. 4). Two sets of primers were used to amplify cDNA synthesized from total RNA purified from schizont stages of W2mef, W2mef{Delta}RAP3c1, and W2mef{Delta}RAP3c2 parasites. One set of primers was specific for a wild-type RAP3 transcript (R3 RTPCR and R3int), while the other primers were specific for a transcript that would be produced only if the RAP3 gene was disrupted (R3 RTPCR and PBDT) (Fig. 4A). A product of approximately 916 bp was obtained using W2mef cDNA with the R3 RTPCR and R3int oligonucleotides (wild-type primers) (Fig. 4B, lane 1). A product of the same size was also obtained by PCR amplification of W2mef genomic DNA with the wild-type primers (Fig. 4B, lane 5). As a control to demonstrate that there was no genomic DNA contamination of the RNA preparation we used primers to the dihydropteroate synthase (DHPS) gene, which has a number of introns (48). A DNA band of 480 bp was obtained with these primers, which span an intron, showing no contamination of the RNA with genomic DNA (Fig. 4B, lane 3). Additionally, controls that did not include reverse transcriptase failed to show any bands when they were PCR amplified with wild-type primers (Fig. 4B, lane 4). As expected, there were no bands amplified from either wild-type RNA or genomic DNA when mutant-specific primers (R3 RTPCR and PBDT) were used (Fig. 4B, lanes 2 and 6). These results demonstrate that the RAP3 gene is transcribed in wild-type W2mef parasites.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 4. Transcription of the RAP3 gene is disrupted in W2mef{Delta}RAP3c1 and W2mef{Delta}RAP3c2. (A) Schematic of the wild-type RAP3 gene, showing the locations of the wild-type-specific primers and the expected 916-bp transcript as well as the locations of the mutant-specific primers and the expected 1,044-bp transcript. Restriction sites shown: E, EcoRI; B, BamHI. (B) PCR products obtained from W2mef wild-type cDNA and genomic DNA show that the RAP3 gene is transcribed in W2mef parasites. Lanes 1, 4, and 5, wild-type primers; lanes 2 and 6, mutant primers; lane 3, DHPS control primers. (C) W2mef{Delta}RAP3c1 cDNA and genomic DNA PCR products indicate that wild-type RAP3 transcripts are not made in {Delta}RAP3 mutant parasites. Instead, a mutant transcript is produced, which suggests that a truncated RAP3 protein may be expressed. Lanes 1 and 5, wild-type primers; lanes 2, 4, and 6, mutant primers; lane 3, DHPS control primers. (D) PCR products from W2mef{Delta}RAP3c2 cDNA and genomic DNA also show that a mutant transcript but not a wild-type transcript is produced. Lanes 1 and 5, wild-type primers; lanes 2, 4, and 6, mutant primers; lane 3, DHPS control primers. gDNA, genomic DNA; RT, reverse transcriptase.

 
In contrast, there were no products amplified by using wild-type-specific primers with W2mef{Delta}RAP3c1 and W2mef{Delta}RAP3c2 RNA or genomic DNA, suggesting that the RAP3 gene had been disrupted (Fig. 4C and D, lanes 1 and 5). There was, however, a product of 1,044 bp amplified by using mutant-specific primers with both the cDNA and genomic DNA from {Delta}RAP3 mutants (Fig. 4C and D, lanes 2 and 6). Once again, control reactions with primers across an intron of DHPS and mutant primers with cDNA but no reverse transcriptase verified that there was no genomic DNA contamination of the RNA purified from the {Delta}RAP3 mutant parasites (Fig. 4C and D, lanes 3 and 4). These results confirm that the RAP3 gene has been disrupted in the W2mef{Delta}RAP3c1 and W2m3f{Delta}RAP3c2 parasite lines and show that the wild-type mRNA is not transcribed in these parasites.

Disruption of RAP3 results in loss of the RAP3 protein from the RAP complex. Due to a lack of specific antisera to RAP3, it was not possible to directly analyze protein expression in the {Delta}RAP3 mutant parasites. Therefore, we used immunoprecipitation of the RAP complex with monoclonal antibodies specific to RAP1 (Fig. 5). As expected, in W2mef parasites, both RAP2 (42 kDa) and RAP3 (40 kDa) were coprecipitated with RAP1 (82 and 67 kDa) (27, 28, 43). However, in {Delta}RAP3 mutant parasites the 42-kDa RAP2 protein coprecipitated with RAP1, but the 40-kDa RAP3 band was no longer present (Fig. 5). Therefore, the lack of a 40-kDa band in the RAP complex of {Delta}RAP3 mutant parasites demonstrated that the RAP3 gene encodes the RAP3 component of the low-molecular-mass rhoptry protein complex.



View larger version (75K):
[in this window]
[in a new window]
 
FIG. 5. Immunoprecipitation of the RAP complex from W2mef, W2mef{Delta}RAP3c1, and W2mef{Delta}RAP3c2. Purified trophozoites were metabolically labeled for 6 h with [35S]methionine and immunoprecipitated with monoclonal antibody 7H8/50 (left panel); background binding to protein G beads alone is shown (center panel), and total labeled protein is also shown (right panel). Both RAP2 (42 kDa) and RAP3 (40 kDa) were coprecipitated with RAP1 (82 and 67 kDa) in wild-type W2mef parasites. In the {Delta}RAP3 mutant parasites the 40-kDa RAP3 protein no longer coprecipitates with RAP1 and RAP2.

 
The {Delta}RAP3 mutant parasites were analyzed by using immunofluorescence microscopy to determine if loss of RAP3 expression had an effect on RAP1 and RAP2 subcellular localization. Immunofluorescence microscopy of W2mef schizonts with either polyclonal rabbit anti-RAP1 or monoclonal anti-RAP2 antibodies revealed a punctate fluorescence pattern typical of rhoptry staining (Fig. 6, top row) (11, 27, 29, 41, 43). Immunofluorescence microscopy of W2mef{Delta}RAP3c1 parasites with the same anti-RAP1 or anti-RAP2 antibodies showed a fluorescence pattern similar to that for wild-type parasites (Fig. 6, bottom row). Therefore, the subcellular localization of RAP1 and RAP2 was unaltered in {Delta}RAP3 mutant parasites, indicating that trafficking of these proteins to the rhoptries is not affected by disruption of the RAP3 gene.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 6. Subcellular localization of RAP1 and RAP2 in W2mef and W2mef{Delta}RAP3c1. Antibodies to RAP1 (green) or RAP2 (red) were incubated with either W2mef or W2mef{Delta}RAP3c1. The yellow in the merged image indicates colocalization.

 
Invasion of erythrocytes by {Delta}RAP3 mutant parasites. Erythrocyte invasion by P. falciparum is a complex process that is believed to incorporate redundancies (24, 32, 33). A number of invasion pathways have been described to date (8, 17, 24). These pathways are defined by entry via the erythrocyte surface proteins glycophorin A, glycophorin B, and an unknown receptor X. It has been shown previously that W2mef parasites are capable of invading erythrocytes via sialic acid residues present on both glycophorins A and B (17). To determine if invasion via these pathways was affected by disruption of RAP3, the ability of {Delta}RAP3 mutant parasites to invade human erythrocytes that had been pretreated with neuraminidase and/or trypsin was examined. As expected, W2mef parasites invade these erythrocytes inefficiently (approximately 7.6% of invasion into normal cells). No significant difference from W2mef controls in the ability of either the W2mef{Delta}RAP3c1 or W2mef{Delta}RAP3c2 parasites to invade untreated erythrocytes versus treated erythrocytes was observed (data not shown).

To determine if disruption of RAP3 had an effect on the growth rate of these parasites, we compared the growth of wild-type and mutant parasites over a 72-h period. The invasion rates of the W2mef parent and {Delta}RAP3 mutant parasites in normal erythrocytes showed no statistically significant difference. Therefore, disruption of RAP3, and loss of the RAP3 protein from the RAP complex, has not affected the efficiency of in vitro blood stage growth.

Phylogenetic analysis of the RAP2/3 proteins from plasmodia. A phylogenetic analysis of the six RAP2/3 proteins from Plasmodium spp. was generated by using the neighbor-joining algorithm implemented in ClustalX 1.81 of the multiple alignment (Fig. 7). The tree shows the divergence between the primate and murine strains of Plasmodium spp. as determined by the bootstrap score. Sequence comparison of the C termini of the proteins in the alignment suggests that the P. knowlesi and P. vivax proteins have diverged little since speciation of these two parasites (85% identity and 98% similarity over 69 amino acids). This is in agreement with phylogenetic trees based on cytochrome b and rRNA sequences (19-21). The phylogenetic tree shows deep branching of PfRAP2 and PfRAP3, equal in depth to that of the P. knowlesi protein, indicating that there has been considerable mutation since the duplication of these genes and implying that the RAP2-RAP3 gene duplication was an ancient event.



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 7. Phylogenetic analysis of the RAP2/3 proteins from Plasmodium spp. A phylogram was generated by using the neighbor-joining algorithm implemented in ClustalX 1.81 of the multiple alignment depicted in Fig. 1. The bootstrap values are shown on the branches and indicate the number of times out of 1,000 replications that the branching was supported. This tree is unrooted, as no outgroup homologous protein exist.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ultrastructural and biochemical studies have suggested that the rhoptry organelles play an essential role in the invasion process. The RAP complex, consisting of RAP1, -2, and -3, is localized to this organelle and may function in merozoite invasion (7, 11, 29, 43). This is supported by the observations that antibodies to RAP1 inhibit parasite invasion and immunization with purified RAP complex can protect against P. falciparum challenge in Saimiri monkeys (36, 40). It is likely that the RAP3 protein together with the other components of this complex contributed to the protective response observed in those studies, but without a known gene or protein sequence, further analysis has not been possible. We have identified the gene encoding RAP3 and have shown that this protein forms a complex with RAP1.

The identification of the RAP3 gene in the P. falciparum genome was based on the strong homology shown with RAP2 and the demonstration that the protein forms a complex with RAP1. We reasoned that RAP3 would share homology with RAP2, as they had approximately the same molecular mass and both interacted with RAP1 separately in the RAP complex. Importantly, disruption of the RAP3 gene resulted in the loss of the corresponding protein in the RAP complex as shown by immunoprecipitation with anti-RAP1 antibodies. This unequivocally demonstrates that the protein encoded by the RAP3 gene is the 40-kDa RAP3 protein that forms a complex with RAP1.

Previously, it has been shown that association with RAP1 is essential for trafficking of RAP2 to the rhoptries during development of these organelles (4). Disruption of RAP1-RAP2/3 interactions results in RAP2 being retained in the ER and in the absence of this complex within the rhoptries. It is likely that RAP3 was also mislocalized to the ER in parasites expressing truncated RAP1 (4); however, in the absence of specific antisera to RAP3, it is not possible to prove this unequivocally. These results have shown that the RAP complex is not essential for merozoite invasion in the D10 parasite line. Subsequent attempts to disrupt RAP1 and RAP2 in other P. falciparum lines have been unsuccessful, suggesting that the proteins encoded by these genes provide an important advantage for the parasite. This is consistent with the conservation of RAP2/3 within Plasmodium spp. and suggests that this complex plays a role in merozoite invasion of erythrocytes from the broad range of host organisms that these parasites infect.

It was possible to disrupt RAP3, and it is likely that the RAP2 protein is able to complement the loss of function of RAP3. This is consistent with RAP2 and RAP3 forming separate heterodimers with RAP1 rather than a trimeric complex (28). It is interesting that P. falciparum has two homologous RAP2/3 proteins compared to P. yoelii. This is analogous to MSP4/5, which is also conserved across Plasmodium spp. Only one gene has been identified in Plasmodium chabaudi, P. yoelii, and P. berghei whereas P. falciparum has the two related genes MSP4 and MSP5 (5, 30). The functional role of two independent RAP2/3 proteins in P. falciparum is unknown, but it is possible that they may play a role in alternate invasion pathways for human erythrocytes by P. falciparum. In order to pursue this possibility, it will be important to determine if the RAP1, -2, and -3 genes can be disrupted in different parasite lines by using the new negative-selection transfection vector that has recently become available (18).

The proteins of the RAP complex are vaccine candidates, and it is important to develop an understanding of their function and also their potential role in induction of host protective immune responses. The identification of the RAP3 gene in this study will provide the tools to address these questions and to help understand the functional relationship between RAP1, RAP2, and RAP3 in P. falciparum.


    ACKNOWLEDGMENTS
 
We acknowledge the Red Cross Blood Service (Melbourne, Australia) for supply of human erythrocytes and serum. We thank the scientists and funding agencies comprising the international Malaria Genome Project for making sequence data from the genome of P. falciparum (3D7) public prior to publication of the completed sequence. The Sanger Centre (Cambridge, United Kingdom) provided sequence for chromosomes 1, 3 to 9, and 13. A consortium composed of The Institute for Genome Research, along with the U.S. Naval Medical Research Center, sequenced chromosomes 2, 10, 11, and 14. The Stanford Genome Technology Center (Stanford, Calif.) sequenced chromosome 12. The Plasmodium Genome Database is a collaborative effort of investigators at the University of Pennsylvania (Philadelphia, Pa.) and Monash University (Melbourne, Australia). Preliminary sequence and/or preliminary annotated sequence data from the P. yoelii genome were obtained from The Institute for Genomic Research website (www.tigr.org). This sequencing program is carried out in collaboration with the Naval Medical Research Center.

This work is supported by a grant from the National Health and Medical Research Council of Australia. D.L.B. is supported by an Australian Postgraduate Research Award. A.F.C. and B.S.C. are supported by International Research Scholarships from the Howard Hughes Medical Institute. M.T.D. is supported by a Wellcome Trust Advanced Training Fellowship (Tropical Medicine). Sequencing performed by The Sanger Centre was supported by the Wellcome Trust. Sequencing performed by The Institute for Genome Research and the Naval Medical Research Center was supported by NIAID/NIH, the Burroughs Wellcome Fund, and the Department of Defense. Sequencing performed by the Stanford Genome Technology Center was supported by the Burroughs Wellcome Fund. The Plasmodium Genome Database is supported by the Burroughs Wellcome Fund. The P. yoelii sequencing program at The Institute for Genomic Research is supported by the U.S. Department of Defense.


    FOOTNOTES
 
* Corresponding author. Mailing address: The Walter and Eliza Hall Institute of Medical Research, P.O. Royal Melbourne Hospital, Melbourne, 3050 Australia. Phone: 62-3-93452555. Fax: 62-3-93470852. E-mail: cowman{at}wehi.edu.au. Back

Editor: W. A. Petri, Jr.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Aikawa, M., L. H. Miller, J. Johnson, and J. Rabbege. 1978. Erythrocyte entry by malarial parasites. A moving junction between erythrocyte and parasite. J. Cell Biol. 77:72-82.[Abstract/Free Full Text]
2. Anders, R. F. 1997. Vaccines against asexual blood-stages of Plasmodium falciparum, p. 1037-1057. In M. M. Levine, G. Woodrow, G. Cobon, J. Kaper, and G. Garrett (ed.), New generation vaccines, 2nd ed., vol. 63. Marcel Dekker, Inc., New York, N.Y.
3. Bahl, A., B. Brunk, R. L. Coppel, J. Crabtree, S. J. Diskin, M. J. Fraunholz, G. R. Grant, D. Gupta, R. L. Huestis, J. C. Kissinger, P. Labo, L. Li, S. K. McWeeney, A. J. Milgram, D. S. Roos, J. Schug, and C. J. Stoeckert, Jr. 2002. PlasmoDB: the Plasmodium genome resource. An integrated database providing tools for accessing, analyzing and mapping expression and sequence data (both finished and unfinished). Nucleic Acids Res. 30:87-90.[Abstract/Free Full Text]
4. Baldi, D. L., K. T. Andrews, R. S. Waller, D. Roos, B. S. Crabb, and A. F. Cowman. 2000. RAP1 controls rhoptry targeting of RAP2 in the malaria parasite Plasmodium falciparum. EMBO J. 19:2435-2443.[CrossRef][Medline]
5. Black, C. G., L. Wang, A. R. Hibbs, E. Werner, and R. L. Coppel. 1999. Identification of the Plasmodium chabaudi homologue of merozoite surface proteins 4 and 5 of Plasmodium falciparum. Infect. Immun. 67:2075-2081.[Abstract/Free Full Text]
6. Blisnick, T., M. E. Morales Betoulle, J. Barale, P. Uzureau, L. Berry, S. Desroses, H. Fujioka, D. Mattei, and C. Braun Breton. 2000. Pfsbp1, a Maurer's cleft Plasmodium falciparum protein, is associated with the erythrocyte skeleton. Mol. Biochem. Parasitol. 111:107-121.[CrossRef][Medline]
7. Bushell, G. R., L. T. Ingram, C. A. Fardoulys, and J. A. Cooper. 1988. An antigenic complex in the rhoptries of Plasmodium falciparum. Mol. Biochem. Parasitol. 28:105-112.[CrossRef][Medline]
8. Camus, D., and T. J. Hadley. 1985. A Plasmodium falciparum antigen that binds to host erythrocytes and merozoites. Science 230:553-556.[Abstract/Free Full Text]
9. Chu, G., D. Vollrath, and R. Davis. 1986. Separation of large DNA molecules by contour clamped homogeneous electric fields. Science 234:1582-1585.[Abstract/Free Full Text]
10. Chulay, J. D., J. D. Haynes, and C. L. Diggs. 1983. Plasmodium falciparum: assessment of in vitro growth by [3H]hypoxanthine incorporation. Exp. Parasitol. 55:138-146.[CrossRef][Medline]
11. Clark, J. T., R. Anand, T. Akoglu, and J. S. McBride. 1987. Identification and characterisation of proteins associated with the rhoptry organelles of Plasmodium falciparum merozoites. Parasitol. Res. 73:425-434.[CrossRef][Medline]
12. Coppel, R. L., A. E. Bianco, J. G. Culvenor, P. E. Crewther, G. V. Brown, R. F. Anders, and D. J. Kemp. 1987. A cDNA clone expressing a rhoptry protein of Plasmodium falciparum. Mol. Biochem. Parasitol. 25:73-81.[CrossRef][Medline]
13. Corcoran, L. M., K. P. Forsyth, A. E. Bianco, G. V. Brown, and D. J. Kemp. 1986. Chromosome size polymorphisms in Plasmodium falciparum can involve deletions and are frequent in natural parasite populations. Cell 44:87-95.[CrossRef][Medline]
14. Crabb, B. S., B. M. Cooke, J. C. Reeder, R. F. Waller, S. R. Caruana, K. M. Davern, M. E. Wickham, G. V. Brown, R. L. Coppel, and A. F. Cowman. 1997. Targeted gene disruption shows that knobs enable malaria-infected red cells to cytoadhere under physiological shear stress. Cell 89:287-296.[CrossRef][Medline]
15. Crabb, B. S., and A. F. Cowman. 1996. Characterization of promoters and stable transfection by homologous and nonhomologous recombination in Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 93:7289-7294.[Abstract/Free Full Text]
16. Crabb, B. S., T. Triglia, J. G. Waterkeyn, and A. F. Cowman. 1997. Stable transgene expression in Plasmodium falciparum. Mol. Biochem. Parasitol. 90:131-144.[CrossRef][Medline]
17. Dolan, S. A., J. L. Proctor, D. W. Alling, Y. Okubo, T. E. Wellems, and L. H. Miller. 1994. Glycophorin B as an EBA-175 independent Plasmodium falciparum receptor of human erythrocytes. Mol. Biochem. Parasitol. 64:55-63.[CrossRef][Medline]
18. Duraisingh, M. T., T. Trigia, and A. F. Cowman. 2002. Negative selection of Plasmodium falciparum reveals targeted gene deletion by double crossover recombination. Int. J. Parasitol. 32:81-89.[CrossRef][Medline]
19. Escalante, A. A., and F. J. Ayala. 1994. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences. Proc. Natl. Acad. Sci. USA 91:11373-11377.[Abstract/Free Full Text]
20. Escalante, A. A., D. E. Freeland, W. E. Collins, and A. A. Lal. 1998. The evolution of primate malaria parasites based on the gene encoding cytochrome b from the linear mitochondrial genome. Proc. Natl. Acad. Sci. USA 95:8124-8129.[Abstract/Free Full Text]
21. Escalante, A. A., I. F. Goldman, P. De Rijk, R. De Wachter, W. E. Collins, S. H. Qari, and A. A. Lal. 1997. Phylogenetic study of the genus Plasmodium based on the secondary structure-based alignment of the small subunit ribosomal RNA. Mol. Biochem. Parasitol. 90:317-321.[CrossRef][Medline]
22. Fidock, D. A., and T. E. Wellems. 1997. Transformation with human dihydrofolate reductase renders malaria parasites insensitive to WR99210 but does not affect the intrinsic activity of proguanil. Proc. Natl. Acad. Sci. USA 94:10931-10936.[Abstract/Free Full Text]
23. Gratzer, W. B., and A. R. Dluzewski. 1993. The red blood cell and malaria parasite invasion. Semin. Hematol. 30:232-247.[Medline]
24. Hadley, T. J., F. W. Klotz, G. Pasvol, J. D. Haynes, and M. H. McGinniss. 1987. Falciparum malaria parasites invade erythrocytes that lack glycophorin A and B (MkMk). Strain differences indicate receptor heterogeneity and two pathways for invasion. J. Clin. Investig. 80:1190-1193.
25. Hirano, T., Y. Hiraoka, and M. Yanagida. 1988. A temperature-sensitive mutation of the Schizosaccharomyces pombe gene nuc2+ that encodes a nuclear scaffold-like protein blocks spindle elongation in mitotic anaphase. J. Cell Biol. 106:1171-1183.[Abstract/Free Full Text]
26. Howard, R. F. 1990. The lower-molecular-weight protein complex (RI) of the Plasmodium falciparum rhoptries lacks the glycolytic enzyme aldolase. Mol. Biochem. Parasitol. 42:235-240.[CrossRef][Medline]
27. Howard, R. F., D. L. Narum, M. Blackman, and J. Thurman. 1998. Analysis of the processing of Plasmodium falciparum rhoptry-associated protein 1 and localization of Pr86 to schizont rhoptries and p67 to free merozoites. Mol. Biochem. Parasitol. 92:111-122.[CrossRef][Medline]
28. Howard, R. F., and R. T. Reese. 1990. Plasmodium falciparum: hetero-oligomeric complexes of rhoptry polypeptides. Exp. Parasitol. 71:330-342.[CrossRef][Medline]
29. Howard, R. F., H. A. Stanley, G. H. Campbell, and R. T. Reese. 1984. Proteins responsible for a punctate fluorescence pattern in Plasmodium falciparum merozoites. Am. J. Trop. Med. Hyg. 33:1055-1059.
30. Kedzierski, L., C. G. Black, and R. L. Coppel. 2000. Characterization of the merozoite surface protein 4/5 gene of Plasmodium berghei and Plasmodium yoelii. Mol. Biochem. Parasitol. 105:137-147.[CrossRef][Medline]
31. Lambros, C., and J. P. Vanderberg. 1979. Synchronization of Plasmodium falciparum erythrocytic stages in culture. J. Parasitol. 65:418-420.[CrossRef][Medline]
32. Miller, L. H., J. D. Haynes, F. M. McAuliffe, T. Shiroishi, and J. R. Durocher. 1977. Evidence for differences in erythrocyte surface receptors for the malarial parasites Plasmodium falciparum and Plasmodium knowlesi. J. Exp. Med. 146:277-281.[Abstract/Free Full Text]
33. Mitchell, G. H., T. J. Hadley, M. H. McGinniss, F. W. Klotz, and L. H. Miller. 1986. Invasion of erythrocytes by Plasmodium falciparum malaria parasites: evidence for receptor heterogeneity and two receptors. Blood. 67:1519-1521.[Abstract/Free Full Text]
34. O'Donnell, R. A., P. R. Preiser, D. H. Williamson, P. W. Moore, A. F. Cowman, and B. S. Crabb. 2001. An alteration in concatameric structure is associated with efficient segregation of plasmids in transfected Plasmodium falciparum parasites. Nucleic Acids Res. 29:716-724.[Abstract/Free Full Text]
35. Oduola, A. M., W. K. Milhous, N. F. Weatherly, J. H. Bowdre, and R. E. Desjardins. 1988. Plasmodium falciparum: induction of resistance to mefloquine in cloned strains by continuous drug exposure in vitro. Exp. Parasitol. 67:354-360.[CrossRef][Medline]
36. Perrin, L. H., B. Merkli, M. S. Gabra, J. W. Stocker, C. Chizzolini, and R. Richle. 1985. Immunization with a Plasmodium falciparum merozoite surface antigen induces a partial immunity in monkeys. J. Clin. Investig. 75:1718-1721.
37. Reed, M. B., S. R. Caruana, A. H. Batchelor, J. K. Thompson, B. S. Crabb, and A. F. Cowman. 2000. Targeted disruption of an erythrocyte binding antigen in Plasmodium falciparum is associated with a switch toward a sialic acid independent pathway of invasion. Proc. Natl. Acad. Sci. USA 97:7509-7514.[Abstract/Free Full Text]
38. Reed, M. B., K. J. Saliba, S. R. Caruana, K. Kirk, and A. F. Cowman. 2000. Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum. Nature 403:906-909.[CrossRef][Medline]
39. Ridley, R. G., H. W. Lahm, B. Takacs, and J. G. Scaife. 1991. Genetic and structural relationships between components of a protective rhoptry antigen complex from Plasmodium falciparum. Mol. Biochem. Parasitol. 47:245-246.[CrossRef][Medline]
40. Ridley, R. G., B. Takacs, H. Etlinger, and J. G. Scaife. 1990. A rhoptry antigen of Plasmodium falciparum is protective in Saimiri monkeys. Parasitology 101:187-192.
41. Ridley, R. G., B. Takacs, H. W. Lahm, C. J. Delves, M. Goman, U. Certa, H. Matile, G. R. Woollett, and J. G. Scaife. 1990. Characterisation and sequence of a protective rhoptry antigen from Plasmodium falciparum. Mol. Biochem. Parasitol. 41:125-134.[CrossRef][Medline]
42. Saul, A., J. Cooper, D. Hauquitz, D. Irving, Q. Cheng, A. Stowers, and T. Limpaiboon. 1992. The 42-kilodalton rhoptry-associated protein of Plasmodium falciparum. Mol. Biochem. Parasitol. 50:139-150.[CrossRef][Medline]
43. Schofield, L., G. R. Bushell, J. A. Cooper, A. J. Saul, J. A. Upcroft, and C. Kidson. 1986. A rhoptry antigen of Plasmodium falciparum contains conserved and variable epitopes recognized by inhibitory monoclonal antibodies. Mol. Biochem. Parasitol. 18:183-195.[CrossRef][Medline]
44. Smith, D. B., and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67:31-40.[CrossRef][Medline]
45. Stahl, H. D., P. E. Crewther, R. F. Anders, G. V. Brown, R. L. Coppel, A. E. Bianco, G. F. Mitchell, and D. J. Kemp. 1985. Interspersed blocks of repetitive and charged amino acids in a dominant immunogen of Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 82:543-547.[Abstract/Free Full Text]
46. Stahl, H. D., P. E. Crewther, R. F. Anders, and D. J. Kemp. 1987. Structure of the FIRA gene of Plasmodium falciparum. Mol. Biol. Med. 4:199-211.[Medline]
47. Trager, W., and J. B. Jensen. 1976. Human malaria parasites in continuous culture. Science 193:673-675.[Abstract/Free Full Text]
48. Triglia, T., and A. F. Cowman. 1994. Primary structure and expression of the dihydropteroate synthetase gene of Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 91:7149-7153.[Abstract/Free Full Text]
49. Triglia, T., P. Wang, P. F. G. Sims, J. E. Hyde, and A. F. Cowman. 1998. Allelic exchange at the endogenous genomic locus in Plasmodium falciparum proves the role of dihydropteroate synthase in sulfadoxine-resistant malaria. EMBO J. 17:3807-3815.[CrossRef][Medline]
50. Wu, Y., L. A. Kirkman, and T. E. Wellems. 1996. Transformation of Plasmodium falciparum malaria parasites by homologous integration of plasmids that confer resistance to pyrimethamine. Proc. Natl. Acad. Sci. USA 93:1130-1134.[Abstract/Free Full Text]


Infection and Immunity, September 2002, p. 5236-5245, Vol. 70, No. 9
0019-9567/02/$04.00+0     DOI: 10.1128/IAI.70.9.5236-5245.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baldi, D. L.
Right arrow Articles by Cowman, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baldi, D. L.
Right arrow Articles by Cowman, A. F.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals