IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, W.
Right arrow Articles by Kan, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, W.
Right arrow Articles by Kan, B.

 Previous Article  |  Next Article 

Infection and Immunity, October 2003, p. 5498-5504, Vol. 71, No. 10
0019-9567/03/$08.00+0     DOI: 10.1128/IAI.71.10.5498-5504.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Construction and Evaluation of a Safe, Live, Oral Vibrio cholerae Vaccine Candidate, IEM108

Weili Liang, Shixia Wang,{dagger} Fenggang Yu,{ddagger} Lijuan Zhang, Guoming Qi, Yanqing Liu, Shouyi Gao, and Biao Kan*

Priority Laboratory of Medical Molecular Bacteriology of the Ministry of Health, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing102206, People's Republic of China

Received 21 March 2003/ Returned for modification 6 May 2003/ Accepted 17 July 2003


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IEM101, a Vibrio cholerae O1 El Tor Ogawa strain naturally deficient in CTX{Phi}, was previously selected as a live cholera vaccine candidate. To make a better and safer vaccine that can induce protective immunity against both the bacteria and cholera toxin (CT), a new vaccine candidate, IEM108, was constructed by introducing a ctxB gene and an El Tor-derived rstR gene into IEM101. The ctxB gene codes for the protective antigen CTB subunit, and the rstR gene mediates phage immunity. The stable expression of the two genes was managed by a chromosome-plasmid lethal balanced system based on the housekeeping gene thyA. Immunization studies indicate that IEM108 generates good immune responses against both the bacteria and CT. After a single-dose intraintestinal vaccination with 109 CFU of IEM108, both anti-CTB immunoglobulin G and vibriocidal antibodies were detected in the immunized-rabbit sera. However, only vibriocidal antibodies are detected in rabbits immunized with IEM101. In addition, IEM108 but not IEM101 conferred full protection against the challenges of four wild-type toxigenic strains of V. cholerae O1 and 4 µg of CT protein in a rabbit model. By introducing the rstR gene, the frequency of conjugative transfer of a recombinant El Tor-derived RS2 suicidal plasmid to IEM108 was decreased 100-fold compared to that for IEM101. This indicated that the El Tor-derived rstR cloned in IEM108 was fully functional and could effectively inhibit the El Tor-derived CTX{Phi} from infecting IEM108. Our results demonstrate that IEM108 is an efficient and safe live oral cholera vaccine candidate that induces antibacterial and antitoxic immunity and CTX{Phi} phage immunity.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cholera is a severe secretory diarrheal disease caused by toxigenic Vibrio cholerae (7). V. cholerae is classified into about 200 serogroups on the basis of its somatic antigens. However, only serogroups O1 and O139 have been implicated in epidemics. Serogroup O1 can be further distinguished into two biotypes, classical and El Tor. The classical biotype was responsible for the first six pandemics, and the El Tor biotype was responsible for the seventh pandemic, which began in 1961 and is ongoing. Aside from O1, the new cholera pathogen V. cholerae O139 has caused epidemics in Southeast Asia since 1992. But, at present the El Tor biotype is still the main pathogen causing epidemics and isolated cases.

The most important virulence properties of V. cholerae are the production of cholera toxin (CT) and the ability to adhere to and colonize the small intestine of the host (18). CT is an enterotoxin consisting of one A (CTA) and five B (CTB) subunits encoded by ctxA and ctxB, respectively. The 11.6-kDa CTB is a nontoxic protective antigen responsible for mediating toxin binding to the GM1 ganglioside receptor on host intestinal epithelial cells. The 28-kDa CTA activates the cellular adenylate cyclase and accelerates the secretion of chloride and bicarbonate from the mucosal cells to the intestinal lumen (8).

Vaccination against cholera is a powerful and feasible disease prevention strategy, because recovery from infection results in long-term protective immunity (11, 27). Many parenteral cholera vaccines have been developed, including killed-whole-cell vaccines with or without various adjuvants and a purified lipopolysaccharide vaccine. Because of their poor immunogenicity and high reactogenicity and the mucosal nature of a V. cholerae infection, attempts to develop oral formulations that stimulate the mucosal immune system began in the 1980s (22). Generally, two strategies are being used to develop oral vaccines against cholera. One is based on a combination of killed whole V. chlolerae cells with CTB (17, 19, 22). The other is based on live, attenuated, CT-defective V. cholerae strains, thereby mimicking natural infection (11, 17, 19). Field trials showed that a vaccine consisting of whole cells plus a B subunit produced limited protection in children younger than 5 years. It also required multiple doses because of noncolonization in the human intestine (22, 27).

Compared to the killed-whole-cell vaccine, a live oral attenuated vaccine offers great promise for preventing cholera because a single dose could cause active colonization, elicit high-titer serum vibriocidal antibodies, and stimulate mucosal immunity that is able to block bacterial adherence, kill the bacteria, and neutralize the toxin, thus providing excellent protection (4, 26, 27). Several engineered live attenuated oral vaccine candidates have been developed, including CVD101, CVD103, CVD103-HgR, CVD111, Peru-14, and Peru-15 (9, 11, 13, 19, 27), and some have been used in clinical trials.

However, the discovery of ctxAB as part of the lysogenic phage CTX{Phi} genome showed that CTX{Phi} may transfer this enterotoxin gene from a toxigenic strain to a nontoxigenic strain (29) and thus raised safety concerns over the use of those genetically engineered live oral vaccines (12). Live vaccine strains may potentially regain virulence by acquiring the enterotoxin gene horizontally from toxigenic strains in the host intestine or in the environment, especially when they are used in epidemic areas where wild toxigenic strains may exist. So construction of a protective and safe live attenuated vaccine that is immune to CTX{Phi} infection is a problem to be solved.

The CTX{Phi} genome may be partitioned into the core region, which carries ctxAB and the genes required for virion morphogenesis, and the RS2 region, which carries rstA and rstB, which are required for replication and integration of the genome, and a repressor gene, rstR (28). Based on rstR sequences and their bacterial hosts, CTX{Phi} has several alleles (5, 12). Intraintestinal CTX{Phi} transduction assays have shown that the El Tor lysogens are immune to infection with El Tor-derived CTX{Phi} (CTXET{Phi}), whereas the classical lysogen strains are not (12). This kind of CTX{Phi} immunity is biotype specific and is mediated by its repressor, RstR, through repressing expression of rstA and rstB (12). Therefore, introduction of a stably maintained rstR gene into a live V. cholerae vaccine strain will lower the possibility of vaccine reversion to toxigenicity due to CTX{Phi} infection and will thereby make it safer (12).

IEM101 (16, 17) is an ideal natural vaccine candidate strain selected in our laboratory previously. It is safe, protective, and immunogenic in rabbit models and human volunteers. To prevent it from regaining the ctxAB gene and bestow on it antitoxin immunity, an El Tor rstR gene and a ctxB gene were introduced into IEM101 by using a chromosome-plasmid lethal balanced system based on the housekeeping gene thyA. Thus a new vaccine candidate, IEM108, was constructed and evaluated for its immunogenicity and protective immunity against challenges in a rabbit model.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
V. cholerae O1 strains. The bacterial strains used in this study are listed in Table 1. IEM101 (16), a live cholera vaccine candidate strain of the El Tor biotype, is naturally CTX{Phi} negative but has toxin-coregulated pilus (TCP) pili. Classical strains O395 (Ogawa) and 1119 (Inaba), as well as El Tor strains Wujiang-2 (Inaba) and Bin-43 (Ogawa), were used as the challenge strains in challenge and protection studies with rabbit models. All V. cholerae strains were propagated in Luria-Bertani (LB) broth or on gentamicin agar (GTA; peptone [10 g/liter], beef extract [3.0 g/liter], NaCl [5.0 g/liter], sucrose [10.0 g/liter], sodium citrate [10.0 g/liter], sodium sulfite [3.0 g/liter], agar [15 g/liter], gentamicin [500 µg/liter], polymyxin B [3,000 µg/liter]; pH 8.4 ± 0.1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains used in this study

 
IEM101-T is a thymidine-auxotrophic strain derived from IEM101. It was previously constructed in our laboratory and has the central one-third of the thymidylate synthase gene (thyA) deleted from its genome. IEM101-T can grow in LB broth only with the addition of thymidine (50 µg/ml). However, when IEM101-T was transformed with the plasmid pXXB106 (30) (Table 2) carrying the Escherichia coli-derived thyA to complement its chromosomal thyA deletion, the transformed bacteria could be grown in LB broth without thymidine. This thyA-based chromosome-plasmid lethal balanced system was used to construct IEM108 by introducing plasmid pUTBL3 (Table 2) into IEM101-T.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Plasmid constructs involved in this study

 
E. coli strains used in molecular cloning and conjugation. The E. coli strains used in this study are listed in Table 1. PL101 (30), a spontaneous E. coli DH5{alpha} thyA mutant, was used as the recipient of plasmid pUTBL3 containing ctxB, rstR, E. coli-derived thyA, and truncated bla. PL101 was grown in CBT medium (M9 minimal medium containing 0.5% glucose, 0.5% casein hydrolysate, and 0.1 µg of VitB/ml) supplemented with trimethoprim (15 µg/ml) and thymidine (50 µg/ml). For conjugation, SM10{lambda}pir (25) was used as the recipient strain of recombinant suicide plasmids pKRSn and pKRSe (Table 2). The E. coli strain JM109 was used for transformation in general molecular cloning.

Genetic constructs. The plasmid constructs involved in genetic cloning and conjugation are listed in Table 2.

Construction of the candidate IEM108. The 1.15-kb XbaI fragment containing the upstream regulatory and coding regions of ctxB was recovered from pBR (a pUC19-derived plasmid carrying ctxB and rstR, constructed in our laboratory before) and cloned into the XbaI site of pXXB106, containing E. coli-derived thyA (30), resulting in two new constructs, pUTBL1-5 and pUTB1-6. ctxB and thyA have the same transcriptional direction in pUTBL1-5 and opposite directions in pUTBL1-6 (Fig. 1).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1. Linear diagrams of plasmid constructs. Open boxes, gene segments; arrows, gene orientations; solid box, RS2 region, including rstR, rstA, and rstB genes from V. cholerae O1 El Tor strain in plasmid pKRSe or from a classical strain in pKRSn; arrowheads, PvuI sites.

 
The rstR gene and its upstream sequence were amplified from El Tor strain Bin-43 with primers PrstR1 (CCGAATTCACTCACCTTGTATTCG) and PrstR2 (CGGAATTCTCGACATCAAATGGCATG). The amplified fragment was then cloned into the EcoRI site of pUTBL1-5, yielding new construct pUTBL2. Subsequently, an 0.8-kb PvuI fragment of the bla gene in pUTBL2 was deleted to generate pUTBL3. pUTBL3 was then electroporated into IEM101-T to construct IEM108.

Conjugation. Plasmid pCT5A11 (8) contains a 15-kb HindIII fragment of El Tor strain 1621 including the CTXET{Phi} genome and its flanking sequence. After digestion with PstI, the plasmid was blunt ended with T4 DNA polymerase and further digested with SacI. The 3.6-kb fragment containing the RS2 sequence was gel purified and ligated into the suicide vector pKTN701 (pKTN701 was digested with XbaI, blunt ended with the Klenow fragment of DNA polymerase I, and then digested with SacI) to generate plasmid pKRSe, which contains RS derived from the CTXET{Phi} genome. Plasmid pKRSn is also pKTN701 based and contains the RS sequence derived from the CTXclass{Phi} genome that was constructed in our previous work. These two recombinant suicide plasmids were used as a model to evaluate CTX{Phi} immunity.

SM10 carrying pKRSe or pKRSn was used as the donor strain to mate with IEM108 and IEM101, respectively. Mating mixtures were plated on the 0.22-µm-pore-size filter membrane stuck on the surface of LB agar and then cultured at 37°C for 6 h. The bacteria were washed and diluted with phosphate-buffered saline (PBS) and then plated on GTA selective media supplemented with 15 µg of chloramphenicol/ml to enumerate the number of transconjugants and on GTA without chloramphenicol to determine the total number of recipient strains. Transconjugant frequency is calculated as the ratio of transconjugants among recipients, as determined from the ratio of CFU of Cmr Getr colonies to CFU of Getr colonies.

GM1-ELISA. A GM1-enzyme-linked immunosorbent assay (GM1-ELISA) was used to determine the expression of CTB in pUTBL1-5 and pUTB1-6 and anti-CTB titers in sera of immunized rabbits. A 96-well plate was coated with 2 µg of GM1(Sigma)/ml (100 µl/well) overnight at 4°C. Wells were washed three times with PBS plus 0.05% Tween 20 (PBT) and blocked with 1% bovine serum albumin (300 µl/well) in PBS for 1 h at 37°C. One hundred microliters of supernatant of JM109 cell lysate transformed with pUTBL1-5 and pUTB1-6 was added to each well, and the plate was incubated at 37°C for 1 h and washed again with PBT. The plate was then incubated with 100 µl of a 1:2,000 dilution of a polyclonal rabbit anti-CT antiserum/well for 1 h at 37°C, washed with PBT, and incubated for 1 h at 37°C with 100 µl of a 1:1,000 dilution of horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG). The plate was subsequently washed with PBT. HRP-bound antibodies were visualized by adding o-phenylenediamine (Sigma) as the substrate. After 15 to 30 min the reaction was blocked by the addition of H2SO4 at a final concentration of 1 M and the absorption was read at 492 nm. Positive results were determined if the ratio of the sample to the control was >=2. For the control we added supernatant of JM109 cell lysate.

The titer of the serum anti-CTB IgG antibody for the immunized rabbits was measured by GM1-ELISA as described above. Briefly, each well was coated with 100 µl of GM1 (2 µg/ml), saturated, and washed. Then 100 µl of CT (1 µg/ml) was added to each well, and the plates were incubated for 1 h at 37°C and washed again. The 1:5-diluted test sera (100 µl) were added to 100 µl of PBS in the first wells and then doubly diluted serially to 1:10,240. Plates were incubated and washed, and HRP-conjugated goat anti-rabbit IgG was added as described above. The preimmune sera were used as the negative control, and a 1:2,000 dilution of a polyclonal rabbit anti-CT antiserum was used as the positive control. The reciprocal titer is defined as the highest dilution of serum that gave an A492 ratio of sample to negative of >=2.0.

Serum vibriocidal antibody assay. Serum vibriocidal antibody titers were measured in a microassay using 96-well plates. The immunized rabbit sera were inactivated at 56°C for 30 min and diluted 1:5 with PBS before use. The prediluted rabbit sera were added into the first well and then serially diluted threefold in PBS. PBS was added to the last well as a negative control. The plates were incubated for 30 min at 37°C with 25 µl of a solution containing 102 CFU of V. cholerae Bin-43/ml of culture and 20% guinea pig serum as a complement source in PBS. One hundred fifty microliters of 0.01% 2,3,5-trihenyltetrazolium chloride in LB broth was added to each well, and the plates were further incubated for 4 to 6 h at 37°C until the negative-control wells showed a color change. The reciprocal vibriocidal titer is defined as the highest dilution of serum that completely inhibits growth of Bin-43, i.e., no color change.

Rabbit immunization. Eight adult New Zealand White rabbits (2 to 2.5 kg) were divided into naive, IEM101, and IEM108 groups. The naive group consisted of two rabbits that were not immunized. Each immunization group had three rabbits. After fasting for 24 h, the rabbits in both immunization groups were anesthetized with ether. After the abdominal skin was sterilized with an iodine tincture and alcohol, the abdominal cavity was opened by vertical incision (under sterile conditions). General exploration was performed to find the ileocecal region. This region was ligated to the inner wall of the abdomen. Then 109 CFU of vaccine strain IEM101 or IEM108 were injected into the proximal ileum. Finally, the abdominal cavity was closed. The ligature that tied the ileocecal region to the abdominal wall was removed 2 h later, and the rabbits were given water and feed for 28 days. One rabbit of the IEM101 group died after the operation, probably because of heavy anesthesia. Serum samples were collected from the immunized rabbits prior to the immunization and on days 6, 10, 14, 21, and 28 after the vaccination. The serum titers for the anti-CT antibody and vibriocidal antibody were measured as described above.

Rabbit ileal loop assay and protection model. To evaluate the protection efficacy in vivo, the immunized rabbits were challenged with pure CT and four virulent V. cholerae strains (395, 119, Wujiang-2, and Bin-43) of different serotypes and biotypes (Table 1) 28 days after the single-dose immunization. Rabbits were anesthetized and their abdomens were opened as described above. Their intestines were tied into 4- to 5-cm-long loops, and then 105 to 108 CFU of challenge strains or 1, 2, 3, or 4 µg of pure CT was injected into each loop. Normal saline was used as negative control. At 16 to 18 h postchallenge, the rabbits were sacrificed and the accumulated fluid from each loop was collected and measured. The ratio of the volume of accumulated fluid (milliliters) to the length of the loop (centimeters) was calculated for each loop in the challenged rabbits.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction of IEM108 based on the thyA plasmid-chromosome lethal balanced system. In our previous work, we destroyed the thyA gene of IEM101 by deleting the central one-third of the gene, thus obtaining the thymidine-auxotrophic V. cholerae strain, IEM101-T. That study (30) showed that E. coli-derived thyA can complement the thyA function of V. cholerae and that plasmid pXXB106 containing E. coli-derived thyA can stably be maintained in a spontaneous V. cholerae {Delta}thyA mutant. When transformed with the plasmid pXXB106, IEM101-T grew well in LB medium. Therefore, we cloned the ctxB gene into pXXB106. To test if this cloned ctxB affects the expression of thyA because of its highly efficient promoter, plasmids pUTBL1-5 and pUTBL1-6, which have different insertion directions of ctxB, were electroporated into IEM101-T. We then assessed V. cholerae growth on LB media without thymidine. Comparisons of in vitro growth kinetics of IEM101 and IEM101-T (containing pUTBL1-5 and pUTBL1-6, respectively) showed a significantly reduced growth rate and an extended log phase for IEM101-T containing pUTBL1-6, whereas IEM101-T containing pUTBL1-5 and IEM101 had similar growth rates (Fig. 2). This observation may indicate that the reverse insertion of ctxB in pUTBL1-6 influenced the expression of thyA and therefore was responsible for the reduced levels of growth. Based on the different growth rates, we chose pUTBL1-5 for the cloning of rstR.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Comparison of the growth curves of IEM101, IEM101-T containing pUTBL1-5, and IEM101-T containing pUTBL1-6. Single clones of IEM101, IEM101-T containing pUTBL1-5, or pUTBL1-6 were grown in LB broth at 37°C to exponential phase, and the optical density at 600 nm (OD600) of each culture was adjusted to 0.3. Then 300 µl of each was inoculated into 30 ml of fresh LB broth in 100-ml flasks and grown aerobically at 37°C. The OD600 of each culture was detected at different times during growth.

 
The fragment containing the rstR gene and its upstream sequence of the El Tor strain Bin-43 was amplified and cloned into the EcoRI site of pUTBL1-5 to generate pUTBL2. Thus, the cloned rstR gene is derived from the El Tor-derived CTXET{Phi} genome. In accordance with the proviso that an antibiotic resistance gene cannot appear in a recombinant plasmid which is introduced into the vaccine candidate, the bla in pUTBL2 was deactivated by deleting a 0.8-kb PvuI fragment to generate pUTBL3. Therefore, pUTBL3 contains ctxB, rstR, E. coli-derived thyA, and the truncated bla gene. pUTBL3 was electroporated into IEM101-T to construct IEM108. pUTBL3 was maintained in IEM108 grown on LB agar plates without the need for antibiotic selection pressure.

The immunity of IEM108 against phage CTXET{Phi} infection and the ability to regain toxicity. Our previous studies have shown that the recombinant suicide plasmid containing RS2 could integrate into the chromosome of IEM101. In addition, this recombinant plasmid could replicate in its plasmid form (10). To test the ability of IEM108 to resist CTX{Phi} infection from both classical and El Tor sources and to test the cross-immunity induced by rstR against CTX{Phi} derived from different biotypes, the two SM10 donor strains, one containing pKRSn and one containing pKRSe, were used as a conjugation model. pKRSn contains the classical biotype-derived RS2 region, while pKRSe contains the El Tor-derived RS2 region. The average conjugation frequencies between recipient strains and donor strains are shown in Table 3. There was a 100-fold reduction in frequency of conjugation to the El Tor-derived RS2 region in IEM108 compared with the corresponding frequency for IEM101. However, when IEM101 and IEM108 mated with donor strain SM10 (containing pKRSn), the reduction of conjugation frequency for IEM108 was about ninefold less than that for IEM101 (Table 3).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Conjugation of pKRSn and pKRSe from E. coli into V. cholerae IEM101 and IEM108a

 
The immunogenicity of IEM108 in (immunized) rabbits. Antibody analysis results for immunized rabbits showed that none of the rabbits produced anti-CTB antibodies and vibriocidal antibodies in their preimmune serum. After immunization, specific anti-CTB antibodies were detected in rabbit sera immunized with IEM108. They became detectable on day 10 after vaccination, and peak titer (1:4,155, on average) and plateau were reached on day 21 (Fig. 3). No anti-CTB antibody was detected in IEM101-immunized-rabbit sera. The vibriocidal antibody responses in sera from rabbits immunized with IEM101 and IEM108 were found to be very similar (Fig. 4). They became detectable on day 6 postimmunization and reached their peak on day 14. However, we found that the antibody titer for the IEM108 group is not only much higher than that for the IEM101 group but also decreases more slowly and thus lasts a longer time.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 3. Average titers of serum anti-CTB IgG antibodies after immunization with IEM101 and IEM108.

 


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 4. Average titers of serum vibriocidal antibodies after immunization with IEM101 and IEM108.

 
Protection against the challenges of toxigenic V. cholerae in vaccinated rabbits. Fluid accumulations of different rabbit groups are shown in Fig. 5 and 6. In the naive-animal group, all the loops had significant amounts of fluid accumulation after being challenged with either CT or bacteria. Furthermore, the higher the challenge dose, the more fluid was accumulated. In the group of IEM101-vaccinated animals, no significant fluid accumulation was detected in the loops subjected to a lower dose (105 to 107 CFU) of the bacterial challenge. However, when the challenge dose increased to 108 CFU, the loops in rabbits challenged with the classical strain 1119 and the El Tor strain Wujiang-2 had average levels of fluid accumulation of 0.35 and 0.86 ml/cm of loop, respectively. All loops challenged with different doses of CT had very significant amounts of fluid accumulation: about 0.32, 0.53, 0.87, and 0.84 ml per cm of intestinal loop for 1, 2, 3, and 4 µg of CT, respectively. We detected no fluid accumulation in the group of IEM108-immunized rabbits after the challenge with either CT or bacteria, which indicates that IEM108 elicits more-effective antibacterial immunity than IEM101 and furthermore induces an antitoxic response.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 5. Average fluid accumulations in the rabbit ileal loops after challenge with pure CT.

 


View larger version (47K):
[in this window]
[in a new window]
 
FIG. 6. Average fluid accumulations in the rabbit ileal loops after challenge with the strains O395, 1119, Wujiang-2, and Bin-43. Different animal groups are indicated as follows: naive, gray bars; IEM101, white bars; IEM108, black bars.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Some live oral attenuated vaccines have been developed from strains of the O1, E1 Tor and classical biotypes, or O139 serogroup. Most candidates are derived from wild toxigenic strains and were constructed by deleting the CT gene besides other potential virulence genes, such as the hemolysin gene and the hemagglutinin/protease gene, and adding the ctxB gene to depress the reactogenicity and to elicit antibacterial and antitoxic immune responses (3, 9, 11, 13, 19, 20, 27). In our previous study, IEM101 (16, 17) was selected as a vaccine prototype from naturally nontoxigenic El Tor strains. Experiments with animal models and human volunteers showed that IEM101 is able to colonize the intestinal mucosa; induce strong immune responses in terms of specific IgA, IgG, IgM, and vibriocidal antibodies; and produce protective immunity. So we developed a candidate from the natural strains. However, the live attenuated vaccine strains have the potential of reacquiring the ctxAB gene by CTX{Phi} transfection from toxigenic strains in the environment or host intestine, thus reverting to toxigenicity (12, 29). For these reasons, we decided to develop a safer vaccine that elicits both antitoxic and antibacterial immunity and also is immune to CTX{Phi} infection.

Three forms of CTX{Phi} have been identified, CTXclass{Phi}, CTXET{Phi}, and CTXcalc{Phi}. They were derived from O1 classical, O1 El Tor, and O139 Calcutta strains, respectively (5, 12). Up to now, only the CTXET{Phi} and CTXcalc{Phi} prophage can give rise to infectious phage particles and therefore transmit the ctxAB gene to nontoxigenic strains (5, 6). Molecular epidemiology surveys showed that the prophages contained in many toxigenic O139 strains are still CTXET{Phi} except for those in the Calcutta strains, which were CTXcalc{Phi} lysogens (2, 5, 24). Furthermore, the comparison of the rstR-intergenic region 2 sequences in El Tor clinical isolates from different continents over the past 25 years and the O139 strain showed that they were identical (12, 15).

Given that El Tor is the predominant biotype of the current seventh pandemic (27) and that CTXET{Phi} is the predominant infectious CTX{Phi} (the other infectious CTX{Phi}, CTXcalc{Phi}, is restricted to a few areas [5]), the rstR of an El Tor strain Bin-43 was introduced into IEM101 to protect the vaccine from CTXET{Phi} infection. The safety of IEM108 was evaluated indirectly by using a simplified model, the mating experiment, rather than a live test of CTX{Phi} infection. The effect of rstR inhibition of CTX{Phi} infection can be evaluated by using the transfer efficiency of the recombinant suicide plasmid containing the RS2 region of CTXET{Phi}. The indication of repression is active expression of the El Tor-derived rstR gene in IEM108. If it is actively expressed, RstR should biotype specifically repress the expression of rstA in El Tor-derived RS2 cloned in pKRSe, thus apparently reducing the frequency of conjugation of pKRSe from SM10 to IEM108. In addition, it should not repress sufficiently the rstA of classical biotype-derived RS2 in pKRSn. Since there is no rstR in IEM101, the rates of conjugation of pKRSe and pKRSn to it were similar, and both were higher than that of pKRSe to IEM108.

Our results demonstrated that the El Tor-derived rstR gene cloned into IEM108 was expressed actively and could produce immunity against CTXET{Phi} infection. Because rstR is biotype specific, IEM108 acquired much stronger immunity to CTXET{Phi} than to CTXclass{Phi}. We also found a poor cross-immunity between the El Tor-derived rstR and the classical biotype-derived rstA due to a ninefold reduction of transfer frequency of pKRSn into IEM108 compared to that into IEM101. The acquired immunity against CTX{Phi} in IEM108 could reduce the possibility that the vaccine strain would regain toxicity and thus enhance its safety.

It has been clear from animal studies that the presence of serum antibodies against the toxins offers protection against toxin-induced disease (1). Thus, besides the rstR gene, ctxB was also introduced simultaneously to elicit antitoxin immunological responses. Both of them were cloned into the balance plasmid containing E. coli-derived thyA to construct the improved vaccine candidate, IEM108. Though the E. coli-derived thyA gene can complement functionally the thyA chromosomal deletion of V. cholerae, the genes have no homology, which greatly diminishes the possibility of thyA gene recombination events, thus making the lethal balanced system more stable. It has been reported that the induced immune responses to antigens expressed from multicopy plasmids are more prominent than those to antigens expressed from single-copy genes on the chromosome (21). In our study, the thyA balanced system insured a higher-level expression of CTB and RstR than a single-copy gene on the chromosome. The magnitude of immune responses induced against antigens expressed by attenuated vaccine strains of V. cholerae is directly related to the quantity of antigen produced. So we believe that IEM108 will induce a high immune response against CT and CTX{Phi} infection.

Animal tests showed that IEM108 induced high anti-CTB and vibriocidal antibody responses and conferred full protection against challenge with at least 4 µg of CT and four strains of wild-type V. cholerae. It was found that immunity to cholera involves an antibacterial response rather than an antitoxin response, but the latter can heighten the former synergistically (14). In our study the levels of vibriocidal antibodies elicited by IEM108 were also higher than those elicited by IEM101. Moreover, the peak titer had a long duration and a slow decrease. This suggests that there is a synergistic effect between the antibacterial and antitoxin immunity produced by IEM108. Vibriocidal antibodies are a measure of immune responses against the V. cholerae organisms and reflect the ability of V. cholerae strains to colonize the intestine (23). Though the main protective antibacterial immunity is local in the intestine, high levels of vibriocidal antibodies are correlated with protection from cholera. It is normally found that the higher the vibriocidal antibody response induced, the stronger the mucosal protective immunity elicited (13). The higher vibriocidal antibody titers induced by IEM108 indicate that it is a more effective candidate than its parent strain, IEM101.

Based on our results, we can conclude that IEM108 is both immunogenic and protective. It has many properties that recommend it as a promising safe live attenuated oral vaccine candidate. These properties include the introduction of rstR, which efficiently renders the strain immune to CTXET{Phi} infection, thus providing a higher level of safety against possible reversion to enterotoxicity by reacquisition of the ctxAB gene; the capacity to colonize the small intestine; the high expression of the protective antigen (CTB) from a multicopy plasmid, which is stably maintained in the balanced system; and the facility with which it can be further modified, such as by introducing the rstR of the O139 Calcutta strain to protect against CTXcalc{Phi} infection and by introducing major protective antigen genes of O139 or other enteropathogen protective antigen genes to construct a bivalent or multivalent vaccine. Thus, it may be of interest to further evaluate IEM108 in volunteer and field testing for its efficiency and safety and the property of CTX{Phi} phage immunity.


    ACKNOWLEDGMENTS
 
We thank Jie Li and Yanping Li for their help in the animal tests.

This work was supported by the Chinese grants of the High Tech Research and Development Programme to B.K. (2001AA215191) and the National Basic Research Priorities Programme to B.K. (G1999054102).


    FOOTNOTES
 
* Corresponding author. Mailing address: The Priority Laboratory of Medical Molecular Bacteriology of the Ministry of Health, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, P.O. Box 5, Changping, Beijing 102206, People's Republic of China. Phone: (8610) 61739458. Fax: (8610) 61730233. E-mail: kanb{at}btamail.net.cn. Back

Editor: D. L. Burns

{dagger} Present address: Division of Infectious Diseases and Immunology, Department of Medicine, University of Massachusetts Medical School, Worcester, MA 01655. Back

{ddagger} Present address: National University Medical Institute, National University of Singapore, Clinical Research Center, 117597 Singapore, Singapore. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Acheson, D. W. K., M. M. Levine, J. B. Kaper, and G. T. Keusch. 1996. Protective immunity to Shiga-like toxin I following oral immunization with Shiga-like toxin I B-subunit-producing Vibrio cholerae CVD103-HgR. 1996. Infect. Immun. 64:355-357.[Abstract]
2. Basu, A., A. K. Mukhopadhyay, C. Sharma, J. Jyot, N. Gupta, A. Ghosh, S. K. Bhattacharya, Y. Takeda, A. S. Faruque, M. J. Albert, and G. B. Nair. 1998. Heterogeneity in the organization of the CTX genetic element in strains of Vibrio cholerae O139 Bengal isolated from Calcutta, India and Dhaka, Bangladesh and its possible link to the dissimilar incidence of O139 cholera in two locales. Microb. Pathog. 24:175-183.[CrossRef][Medline]
3. Benítez, J. A., L. García, A. Silva, H. García, R. Fando, B. Cedré, A. Pérez, J. Campos, B. L. Rodríguez, J. L. Pérez, T. Valmaseda, O. Pérez, A. Pérez, M. Ramírez, T. Ledón, M. Díaz Jidy, M. Lastre, L. Bravo, and G. Sierra. 1999. Preliminary assessment of the safety and immunogenicity of a new CTX{Phi}-negative, hemagglutinin/protease-defective El Tor strain as a cholera vaccine candidate. Infect. Immun. 67:539-545.[Abstract/Free Full Text]
4. Butterton, J. R., S. A. Boyko, and S. B. Calderwood. 1993. Use of the Vibrio cholerae irgA gene as a locus for insertion and expression of heterologous antigens in cholera vaccine strains. Vaccine 11:1327-1335.[CrossRef][Medline]
5. Davis, B. M., H. H. Kimsey, W. Chang, and M. K. Waldor. 1999. The Vibrio cholerae O139 Calcutta bacteriophage CTX{Phi} is infectious and encodes a novel repressor. J. Bacteriol. 181:6779-6787.[Abstract/Free Full Text]
6. Davis, B. M., K. E. Moyer, E. F. Boyd, and M. K. Waldor. 2000. CTX prophages in classical biotype Vibrio cholerae: functional phage genes but dysfunctional phage genomes. J. Bacteriol. 182:6992-6998.[Abstract/Free Full Text]
7. Faruque, S. H., M. J. Albert, and J. J. Mekalanons. 1998. Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae. Microbiol. Mol. Biol. Rev. 62:1301-1314.[Abstract/Free Full Text]
8. Gennaro, M. L., P. J. Greenaway, and D. A. Broadbent. 1982. The expression of biologically active cholera toxin in Escherichia coli. Nucleic Acids Res. 10:4883-4890.[Abstract/Free Full Text]
9. Gotuzz, E., B. Butron, C. Seas, M. Penny, R. Ruiz, G. Losonsky, C. F. Lanata, S. S. Wasserman, E. Salazar, J. B. Kaper, S. Cryz, and M. M. Levine. 1993. Safety, immunogenicity and excretion pattern of single-dose live oral cholera vaccine CVD 103-HgR in Peruvian adults of high and low socioeconomic levels. Infect. Immun. 61:3994-3997.[Abstract/Free Full Text]
10. Kan, B., G. M. Qi, and Y. Q. Liu. 2002. Replicative and integrative functions in RS in lysogenic bacteriophage nct-CTX{Phi} genome without ctxAB in Vibrio cholerae. Chin. J. Microbiol. Immunol. (Beijing) 22:435-438.
11. Kenner, J. R., T. S. Coster, D. N. Taylor, A. F. Trofa, M. Barreraoro, T. Hyman, J. M. Adams, D. T. Beattie, K. P. Killeen, and J. C. Sadoff. 1995. Peru-15, an improved live attenuated oral vaccine candidate for Vibrio cholerae O1. J. Infect. Dis. 172:1126-1129.[Medline]
12. Kimsey, H. H., and M. K. Waldor. 1998. CTX{Phi} immunity: application in the development of cholera vaccines. Proc. Natl. Acad. Sci. USA 95:7035-7039.[Abstract/Free Full Text]
13. Levine, M. M., and J. B. Kaper. 1995. Live oral vaccine: from principle to product. Bull. Inst. Pasteur 93:243-245.[CrossRef]
14. Levine, M. M., and N. F. Pierce. 1992. Immunity and vaccine development, p. 285-327. In D. Barua and W. B. Greenough III (ed.), Cholera. Plenum Medical Book Company, New York, N.Y.
15. Liang, W. L., B. Kan, G. M. Qi, Y. Q. Liu, and S. Y. Gao. 2003. Study of induction of the lysogenic bacteriophage CTX{Phi} in V. cholerae O139 strain and its transduction. Chin. J. Microbiol. Immunol. (Beijing) 23:53-56.
16. Liu, Y. Q., G. M. Qi, S. X. Wang, Y. M. Yu, G. C. Duan, L. J. Zhang, and S. Y. Gao. 1995. A natural vaccine candidate strain against cholera. Biomed. Environ. Sci. 8:350-358.[Medline]
17. Maria, R. F., M. Elisabetta, Y. Q. Liu, G. M. Qi, G. C. Duan, R. Rappuoli, and M. Pizza. 2001. IEM101, a naturally attenuated Vibrio cholerae strain, as carrier for genetically detoxified derivatives of cholera toxin. Vaccine 19:75-85.
18. Parsot, C., and J. J. Mekalanos. 1990. Expression of ToxR, the transcriptional activator of the virulence factors in Vibrio cholerae, is modulated by the heat shock response. Proc. Natl. Acad. Sci. USA 87:9898-9902.[Abstract/Free Full Text]
19. Rijpkema, S. G. T., E. M. Bik, W. H. Jansen, J. H. Gielen, L. F. Versluis, A. H. Stouthamer, P. A. M. Guinee, and F. R. Mooi. 1992. Construction and analysis of a Vibrio cholerae {delta}-aminolevulinic acid auxotroph which confers protective immunity in a rabbit model. Infect. Immun. 60:2188-2193.[Abstract/Free Full Text]
20. Robert, A., A. Silva, J. A. Benitez, B. L. Rodriguez, R. Fando, J. Campos, D. K. Sengupta, M. Boesman-Finkelstein, and R. A. Finkelstein. 1996. Tagging a Vibrio cholerae El Tor candidate vaccine strain by disruption of its hemagglutinin/protease gene using a novel reporter enzyme: Clostridium thermocellum endoglucanase A. Vaccine 14:1517-1522.[CrossRef][Medline]
21. Ryan, E. T., J. R. Butterton, T. Zhang, M. A. Baker, S. L. J. Stanley, and S. B. Calderwood. 1997. Oral immunization with attenuated vaccine strains of Vibrio cholerae expressing a dodecapeptide repeat of the serine-rich Entamoeba histolytica protein fused to the cholera toxin B subunit induces systemic and mucosal antiamebic and anti-V. cholerae antibody responses in mice. Infect. Immun. 65:3118-3125.[Abstract]
22. Ryan, E. T., and S. B. Calderwood. 2000. Cholera vaccines. Clin. Infect. Dis. 31:561-565.[CrossRef][Medline]
23. Ryan, E. T., T. I. Crean, S. K. Kochi, M. John, A. A. Luciano, K. P. Killeen, K. E Klose, and S. B. Calderwood. 2000. Development of a {Delta}glnA balanced lethal plasmid system for expression of heterologous antigens by attenuated vaccine vector strains of Vibrio cholerae. Infect. Immun. 68:221-226.[Abstract/Free Full Text]
24. Sharma, C., A. K. Maiti, A. K. Mukhopadhyay, A. Basu, I. Basu, G. B. Nair, R. Mukhopadhyaya, B. Das, S. Kar, R. K. Ghosh, and A. Ghosh. 1997. Unique organization of the CTX genetic element in Vibrio cholerae O139 strains which reemerged in Calcutta, India, in September 1996. J. Clin. Microbiol. 35:3348-3350.[Abstract]
25. Simon, R. U., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology. 1:784-791.[CrossRef]
26. Svennerholm, A. M., D. A. Sack, J. Holmgren, and P. K. Bardhan. 1982. Intestinal antibody responses after immunization with cholera B subunit. Lancet i:305-308.
27. Taylor, D. N., K. P. Killeen, D. C. Hack, J. R. Kenner, T. S. Coster, D. T. Beattic, J. Ezzell, T. Hyman, A. Trofa, M. H. Sjogren, A. Friedlander, J. J. Mekalanos, and J. C. Sadoff. 1994. Development of a live, oral, attenuated vaccine against El Tor cholera. J. Infect. Dis. 170:1518-1523.[Medline]
28. Waldor, M. K., E. J. Rubin, G. D. N. Pearson, H. Kimsey, and J. J. Mekalanos. 1997. Regulation, replication, and integration functions of the Vibrio cholerae CTX{Phi} are encoded by region RS2. Mol. Microbiol. 24:917-926.[CrossRef][Medline]
29. Waldor, M. K., and J. J. Mekalanos. 1996. Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 272:1910-1914.[Abstract]
30. Xia, X. B., G. M. Qi, and Y. Q. Liu. 2000. Development of a chromosome-plasmid balanced lethal gene expression of Vibrio cholerae based on thyA locus. Chin. J. Microbiol. Immunol. (Beijing) 20:223-227.


Infection and Immunity, October 2003, p. 5498-5504, Vol. 71, No. 10
0019-9567/03/$08.00+0     DOI: 10.1128/IAI.71.10.5498-5504.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, W.
Right arrow Articles by Kan, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, W.
Right arrow Articles by Kan, B.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals