Previous Article | Next Article ![]()
Infection and Immunity, December 2003, p. 6933-6942, Vol. 71, No. 12
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.12.6933-6942.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Division of Biological Sciences, The University of Montana, Missoula, Montana 59812-4824
Received 23 May 2003/ Returned for modification 23 July 2003/ Accepted 3 September 2003
|
|
|---|
72 h of exposure and
results in a 6- to 20-fold increase in cell numbers relative to
controls. The mitogen increases bromodeoxyuridine (BrdU) incorporation
into HUVECs by almost twofold relative to controls. The mitogen is
sensitive to heat and trypsin but is not affected by the
lipopolysaccharide inhibitor polymyxin B. The mitogen does not affect
caspase 3 activity in HUVECs undergoing serum starvation-induced
apoptosis. The Bartonella mitogen was found in bacterial
culture supernatants, the soluble cell lysate fraction, and, to a
lesser degree, in insoluble cell fractions of the bacterium. In
contrast, soluble cell lysate fractions from closely related B.
henselae, although possessing significant mitogenicity for HUVECs,
resulted in only about a twofold increase in cell numbers. Biochemical
and immunological analyses identified GroEL as a participant in the
observed HUVEC mitogenicity. A B. bacilliformis strain
containing the intact groES-groEL operon on a multicopy
plasmid was generated and used to demonstrate a correlation between
HUVEC mitogenicity and GroEL levels in the lysate
(r2 = 0.85). Antiserum to GroEL
significantly inhibited mitogenicity of the lysate. Data also show that
GroEL is located in the soluble and insoluble fractions (including
inner and outer membranes) of the cell and is actively secreted by
B. bacilliformis. |
|
|---|
A study with Bartonella henselae showed enhanced proliferation and migration of HUVECs in coculture and identified a trypsin-sensitive proliferative factor detectable in the insoluble (cell wall) fraction of the bacterium (10). Further work with B. henselae demonstrated that the proliferative factor was secreted into the culture medium and, like the B. bacilliformis factor, was specific to endothelial cells (27). More recently, Kirby and Nekorchuk (23) showed that inhibition of apoptosis, and not mitogenicity, is the predominant means by which several B. henselae strains apparently increase the number of HUVECs in coculture. Their data also show that the antiapoptotic factor is released into the bacterial culture medium and, as previously demonstrated, is specific for endothelial cells.
Two additional studies have shown that B. henselae infection induces expression of potentially angiogenic cytokines and growth factors in vitro that may act in a paracrine and/or autocrine fashion to stimulate growth of endothelial cells. Kempf et al. showed that piliated B. henselae cells induce synthesis of vascular endothelial growth factor (VEGF) by EA.hy 926 or HeLa cells, but not HUVECs, in cocultures (22). HUVEC cultures supplemented with conditioned medium from EA.hy 926-B. henselae cocultures showed proliferation rates 30- to 70-fold greater than those in controls. Kempf et al. also showed that EA.hy 926-B. henselae cocultures induced synthesis of interleukin-8 (IL-8), a second angiogenic factor (39). Finally, this study demonstrated that B. henselae growth correlated with host cell growth rates, suggesting that paracrine stimulation might provide additional host cells for colonization. More recently, Resto-Ruiz et al. (29) demonstrated that VEGF and IL-1ß could be detected within 6 to 12 h in medium from THP-1 macrophage cells cocultured with B. henselae. Conditioned medium from these cocultures was mitogenic for human microvascular endothelial cells (HMEC-1). In addition, HMEC-1 cells, but not THP-1 cells, were stimulated to produce IL-8 within 6 h of infection. Taken together, these two studies suggest that proliferation of endothelial cells during Bartonella infection may be enhanced by paracrine stimulation with VEGF, IL-1ß, and IL-8 and a possible IL-8 autocrine loop.
In
this study, we analyzed a B. bacilliformis proliferative
factor to help elucidate its molecular structure and function. Our
results suggest that B. bacilliformis produces a
proteinaceous, soluble factor that is mitogenic for HUVECs and does not
affect apoptosis during a 6-h serum starvation period. Mitogenicity
directly correlates with dosage and occurs maximally at
72 h,
resulting in cell numbers 6- to 20-fold greater than those in controls.
Furthermore, our data indicate that B. henselae lysates are
much less mitogenic than B. bacilliformis lysates, suggesting
these related pathogens use different means of enhancing host cell
proliferation. Our biochemical and immunological analyses show that
GroEL is involved in the observed HUVEC
mitogenicity.
|
|
|---|
Bacterial cell fractionation. B. bacilliformis and B. henselae cell lysates were prepared by harvesting several HIAB plates of bacteria into ice-cold phosphate-buffered saline (PBS; pH 7.4) and disrupting the cells for 3 min by using 0.1-mm-diameter glass beads and a Mini-Beadbeater 8 (BioSpec, Bartlesville, Okla.). Particulates were removed from the mixture by centrifugation at 16,000 x g for 5 min and/or ultracentrifugation at 100,000 x g for 60 min. The resulting lysate was tested for mitogenicity and served as starting material for chromatographic fractionations. Inner and outer membranes were isolated from total membrane preparations of B. bacilliformis using a sucrose step-gradient ultracentrifugation protocol as previously described (8, 9).
B. bacilliformis was exposed to a temperature upshift to determine if mitogenicity of the lysate could be enhanced. Thirty HIAB plates containing B. bacilliformis were divided into two groups, from which half were maintained at 30°C and the others upshifted to 37°C. Following a 6-h incubation, the plates were removed and harvested into PBS (pH 7.4). The resulting cells were washed twice by centrifugation for 5 min at 4,500 x g and resuspension in PBS. A lysate was prepared from each group as described above.
Culture supernatants were prepared by harvesting
Bartonella from HIAB plates (or E. coli DH5
from LB plates), into recovery broth (RB): heart infusion broth
containing 5% (wt/vol) bovine serum albumin and 5%
(vol/vol) sheep erythrocyte lysate
(6). The suspension was
centrifuged for 10 min at 4,500 x g, the supernatant
was discarded, and the resulting pellet was gently resuspended in RB to
an optical density at 600 nm (OD600) of 1.0. The
Bartonella and E. coli suspensions were then
incubated for 16 h at 30 and 37°C, respectively.
Following incubation, the mixtures were centrifuged for 10 min at 4,500
x g, and the resulting supernatants were collected,
filter sterilized (0.22-µm-pore-size filter), and immediately
tested for HUVEC mitogenicity.
Secreted proteins of B. bacilliformis were identified by harvesting B. bacilliformis cultures grown at 25°C into 10 ml of RB at 25°C to an OD600 of 0.6. The suspension was centrifuged for 10 min at 4,500 x g, and the resulting pellet was gently resuspended in 10 ml of RB and centrifuged again. The final pellet was resuspended in 1 ml of RB and equilibrated for 10 min at 25 or 37°C. Three hundred microcuries of Express [35S]methionine-cysteine mix (Perkin-Elmer, Boston, Mass.) was then added, and the mixture was incubated for an additional 30 min with gentle mixing every 10 min. Cells were subsequently removed by centrifugation at 6,000 x g for 5 min, and the supernatants were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by immunoblotting and autoradiography of the blot.
Endothelial cell growth, proliferation, and apoptosis assays. For growth and proliferation experiments, EGM (Clonetics) was replaced with M199 medium (BioWhittaker, Walkersville, Md.) supplemented with penicillin (100 U/ml), streptomycin (0.1 mg/ml), amphotericin B (0.25 µg/ml) (Sigma Chemical, St. Louis, Mo.), and 20% fetal bovine serum (HyClone Laboratories, Logan, Utah). HUVECs were harvested and used to seed 96-well plates with 1,000 cells/well. Each well was brought to a total volume of 100 µl with Bartonella lysate or the fraction to be tested, antiserum, or appropriate controls (e.g., PBS, heated fraction, preimmune serum) plus growth medium. Adherent cell numbers were indirectly determined at 96 h postinoculation by an acid phosphatase assay (11). Strict measurement of cytosolic acid phosphatase was ensured by thoroughly rinsing HUVEC cultures with PBS to remove nonadherent cells and any acid phosphatase released from dead or dying cells. The assay was calibrated with a linear standard curve (Fig. 1A; r2 = 0.99) showing acid phosphatase activity as a function of viable, adherent HUVEC numbers (0 to 36,000 cells by hemocytometer) and encompassed all OD405 values reported in this study (0 to 1.4 OD405 units). A proliferation assay was also performed on 96-h cultures with a bromodeoxyuridine (BrdU) enzyme-linked immunosorbent assay (ELISA) kit per the manufacturer's instructions (Oncogene, La Jolla, Calif.). Mitogenicity of Bartonella lysate on HUVECs was also demonstrated by BrdU incorporation over a 48-h period by ELISA exactly as previously described for B. henselae-HUVEC cocultures (23).
![]() ![]() ![]() View larger version (46K): [in a new window] |
FIG. 1. HUVEC
numbers as a function of increasing doses of B. bacilliformis
lysate in the M199-FCS (20% vol/vol) culture medium.
(A) Linear (r2 = 0.99)
calibration curve showing acid phosphatase activity as a function of
viable, adherent HUVEC numbers determined by a hemocytometer. All
phosphatase values reported in this study fall within the range of this
curve. Dose-response curves were determined by an acid phosphatase
assay (B) or a BrdU proliferation assay kit (Oncogene) (C).
Data were obtained at 96 h and represent the average of three
experiments ± standard error. Raw, raw lysate; heated, lysate
pretreated at 100°C for 7
min.
|
A caspase 3 assay kit (Promega, Madison, Wisc.) was used to determine if B. bacilliformis lysate could inhibit apoptosis in HUVECs. HUVECs were grown to 90% confluency in EGM (Clonetics). Apoptosis was induced by a 6-h serum starvation as previously described (23), in the presence of 50 µM Z-VAD-FMK (a cell-permeable pan-caspase inhibitor) or B. bacilliformis lysate (10 µg of protein/ml). Following incubation, treated HUVECs were harvested, and cell extracts were prepared and analyzed by a CaspACE colorimetric assay, as instructed by the manufacturer (Promega).
Protein assay, SDS-PAGE, and
immunoblot analysis.
Protein concentrations of samples
were determined with a bicinchoninic protein assay kit and a bovine
serum albumin standard (Pierce, Rockford, Ill.). SDS-PAGE was done by
standard methods (3).
Briefly, protein samples were solubilized in an equal volume of Laemmli
sample buffer (LSB), boiled for 10 min, and then separated (
20
µg of protein/lane) on 12.5% (wt/vol) acrylamide
SDS-PAGE gels. Resulting gels were fixed and stained with Coomassie
brilliant blue or AgCl by standard protocols
(3,
38). Immunoblots were
prepared by transferring unfixed or unstained gels to supported
nitrocellulose (0.45-µm pore size; Osmonics, Minnetonka, Minn.)
by the general methods of Towbin et al.
(35). Blots were probed
with a 1:1,000 dilution of rabbit anti-E. coli GroEL
antibodies, rabbit anti-E. coli GroES antibodies (Sigma),
rabbit anti-B. bacilliformis whole-cell antiserum
(32), or rabbit
anti-B. bacilliformis GroEL antiserum prepared as
described below. Horseradish peroxidase-conjugated goat anti-rabbit
immunoglobulin G (IgG) (Sigma) was used at a 1:2,000 dilution to detect
the primary antibody-antigen complexes. Bands were visualized by using
H2O2 and 4-chloronaphthol as previously described
(32). Autoradiographs
were prepared by exposing XAR-5 X-ray film (Kodak, Rochester, N.Y.) to
the immunoblots overnight.
Column chromatography. A Biologic high-resolution chromatography system (Bio-Rad, Hercules, Calif.) was used to identify and purify the mitogenic protein from B. bacilliformis lysates. Briefly, lysates were dialyzed overnight against a mixture of 50 mM Tris (pH 8.0), 0.5 mM EDTA, and 10% glycerol and then loaded onto a 1-ml Econo-Pac High Q cartridge (Bio-Rad). The column was then eluted with a 15-ml linear gradient from 0 to 0.5 M NaCl at 1 ml/min, followed by a 5-ml gradient from 0.5 to 1 M NaCl (in 50 mM Tris [pH 8.0], 0.5 mM EDTA, 10% glycerol) at 1 ml/min. Resulting fractions (1 ml) of this and all other chromatographic preparations were individually tested for mitogenic activity in HUVEC cultures, and their protein profiles were analyzed by SDS-PAGE.
Mitogenic fractions from the High Q purification were pooled and dialyzed overnight against 10 mM sodium phosphate (pH 6.8) and 10% glycerol. The mixture was then loaded onto a 5-ml Econo-Pac CHT-II hydroxyapatite column (Bio-Rad). The column was subsequently eluted with a 50-ml linear gradient of 10 to 450 mM sodium phosphate (pH 6.8) in 10% glycerol, followed by a 10-ml linear gradient of 450 to 900 mM sodium phosphate (pH 6.8) in 10% glycerol at 1 ml/min. The resulting fractions (1 ml) were dialyzed overnight against PBS (pH 7.4) and filter sterilized.
Mitogenic fractions obtained from the High Q purification were also dialyzed against a mixture of 10 mM sodium phosphate (pH 6.8), 0.5 mM EDTA, and 10% glycerol and loaded onto a 1.3-ml UNO S1 column (Bio-Rad). This column was eluted with a 15-ml linear gradient of 0 to 0.5 M NaCl and 0.5 to 5 mM EDTA, followed by a 5-ml linear gradient of 0.5 to 1 M NaCl and 5 to 10 mM EDTA (in 10 mM sodium phosphate [pH 6.8], 10% glycerol) at 1 ml/min. Resulting fractions were dialyzed against PBS (pH 7.4) and filter sterilized.
DNA manipulation, cloning, and expression of groEL and the groES-groEL operon. The B. bacilliformis groEL gene was cloned by a PCR-based strategy. Briefly, PCR primers were designed from a groEL sequence (GenBank accession no. Z15160), including BbGroEL-Fwd (ATGGCTGCTAAAGAAGTAAAATTTG) and BbGroEL-Rev (TTAGAAATCCATTCCGCCCATTC). PCR was done with a GeneAmp PCR reagent kit per the manufacturer's instructions (Applied Biosystems, Branchburg, N.J.) together with 0.1 µg of each primer per 100-µl reaction mixture. Thirty cycles of 1 min at 94°C, 2 min at 55°C, and 2 min at 72°C were done with a GeneAmp 2400 thermal cycler (Perkin-Elmer). The resulting amplicon was purified from an ethidium bromide-stained 1% agarose gel with a GenClean II kit per the manufacturer's instructions (Qbiogene, Carlsbad, Calif.). The purified groEL amplicon was cloned into pCR2.1-TOPO and used to transform E. coli (TOP10) by using a TOPO TA cloning kit per the manufacturer's instructions (Invitrogen, Carlsbad, Calif.). The resulting plasmid, pGROEL-TOPO, was purified to high concentration with a Midi-Prep kit (Qiagen, Valencia, Calif.).
pGROEL-TOPO was digested to completion with
PstI and BamHI to yield a
1,600-bp fragment
of groEL. The fragment was subsequently recloned into
compatible sites of pQE31 (Qiagen) by standard protocol
(3), to generate an
N-terminal six-histidine translational fusion construct, termed
pQE31-GROEL. To induce expression of the groEL fusion,
E. coli M15-(pREP4) harboring pQE31-GROEL was grown
for 1 h at 37°C with shaking (250 rpm).
Isopropyl-ß-D-thiogalactosidase (IPTG) was added to
a final concentration of 1 mM, and the incubation was allowed to
continue for an additional 2.75 h. The bacteria were
subsequently harvested, and recombinant GroEL was batch purified from
the lysates by affinity chromatography with Ni-nitrilotriacetic acid
resin per the manufacturer's instructions (Qiagen). The resulting
recombinant GroEL was dialyzed overnight against PBS (pH 7.4) prior to
use in HUVEC cultures.
A functional groES-groEL operon
of B. bacilliformis was also cloned. The amplicon produced by
the BbGroEL primers described above was used to probe a
ZAP
Express (Stratagene, La Jolla, Calif.) library of B.
bacilliformis. Radiolabeling of the probe and high-stringency DNA
hybridizations were done as described before
(5). In vivo excision of a
clone was done per the manufacturer's instructions,
resulting in pGROESL-CMV. Automated sequence analysis of this plasmid
was done as previously described
(8) with divergent primers
for the 5' and 3' ends of groEL, to verify
that the operon was intact. PCR primers for the entire operon were
designed from the resulting sequence (BbGroESL Operon-Fwd,
TTAAATCGACGTATAAAGAAATTTG; and BbGroESL
Operon-Rev, CTTTTACAATGCAGCTCTTTCAATG). PCR with
these primers was done as described above, and the amplicon was cloned
into pCR2.1-TOPO according to the manufacturer's instructions
(Invitrogen), producing pGROESL-TOPO. The operon was subsequently
recloned by a standard method
(3) into the shuttle
vector pBBR1-MCS2 (24) to
produce pGRO1. The pGRO1 construct was then electroporated into
B. bacilliformis (strain JB584) as previously
described (5), to generate
strain LSS100. A control strain was made by transforming JB584 with
pBBR1-MCS2, to form strain
LSS001.
Antibodies.
Recombinant GroEL was prepared as
described above, solubilized with LSB, and applied to preparative
SDS-PAGE gels (12.5% acrylamide gels without wells). Resulting
gels were rinsed twice for 10 min in distilled water and then stained
with Coomassie brilliant blue (0.05% [wt/vol] in
H2O). Visible GroEL bands were excised from the gels and
used to generate rabbit anti-GroEL antiserum as previously described,
at a dosage of
0.1 mg of GroEL per immunization
(32). Antibodies to the
B. bacilliformis whole-cell and flagellin protein were
previously described and employed in this study
(32). Bacteriophage-like
particles (BLPs) were prepared as described before
(4) and used to generate
anti-BLP antiserum as previously detailed
(32). To examine
antibody-mediated inhibition of mitogenicity, 0.6 µl of lysate
and 12 µl of rabbit anti-B. bacilliformis GroEL
antiserum or preimmune serum as a control were incubated for
2 h at 25°C. The mixture was then brought to 900
µl with M199-FCS (20%) and aliquoted to HUVEC cultures
at 100 µl/well.
Statistical analysis. Statistical significance was determined with Student's t test. A P value of < 0.05 was considered significant for all studies. Experiments were performed a minimum of three times in triplicate. Mean values ± the standard error of the means are reported.
|
|
|---|
B. bacilliformis
lysate contains a dose-dependent mitogen for HUVECs that does not
affect apoptosis.
To identify
an optimal concentration range for the B. bacilliformis
proliferative factor and to determine if the growth response is dose
dependent, various concentrations of soluble cell lysate were added to
HUVEC cultures. Adherent, viable HUVEC numbers were indirectly
determined after a 96-h culture period by using an acid phosphatase
assay calibrated for use with HUVECs according to a linear standard
curve (r2 = 0.99) over the entire range of
acid phosphatase values reported in this study (Fig.
1A). Data show that the
B. bacilliformis lysate is dose dependent and saturating at 5
to 10 µg of lysate protein per ml of culture medium and
significantly enhances cell numbers (
20-fold) relative to
those of controls treated with equal volumes of heated lysate (Fig.
1B). Activity was lost,
regardless of dose, if the lysate was heated (100°C for 7 min)
prior to use. These data are in agreement with those of Garcia et al.
(17), who also found that
the proliferative factor was heat sensitive. Similar dose-response
profiles were obtained if HUVEC numbers were quantified by an
ELISA-based BrdU incorporation assay (Fig.
1C).
Previous work by Garcia et al. (17) determined that the factor was not cytotoxic for HUVECs, implicating a molecule other than LPS. To build upon these observations, we tested the lysate's sensitivity to trypsin and polymyxin B (LPS inhibitor). Our results indicate that the mitogenic activity is significantly reduced by trypsin in a dose-dependent fashion (e.g., a 25% reduction in activity results when trypsin is used at 1.7 µg/ml) but is not affected by treatment with polymyxin B (data not shown). Like Garcia et al. (17), we did not observe any overt morphological differences between HUVECs treated with lysate and controls in this or any other experiment. Taken together, these four lines of evidence indicated that the mitogen was a lysate protein and not bacterial LPS.
Garcia et al. (17) showed a threefold increase in HUVEC proliferation in response to B. bacilliformis; a value that is considerably lower than those observed in this study. We ascribe this discrepancy to differences in protocol. Specifically, Garcia et al. (17) quantified HUVECs by using a Coulter counter, which enumerates both live and dead cells in control and test wells. As such, their proliferation data are very different from those in the acid phosphatase assay, which indirectly quantifies only viable cells. In addition, their working medium and lysate purification and lysate application protocols differed from those in this study.
We observed considerable variation in HUVEC proliferative responses to the Bartonella lysate or its fractions between experiments. We believe this variation is caused by passage number, because increased HUVEC passage consistently resulted in decreased responsiveness. We therefore employed HUVECs from passages 2 to 6 and conducted internal controls on all assays to establish a baseline for that particular experiment. Regardless of the variation seen between individual experiments, the data trends in this study were consistent and reproducible.
The kinetics of the lysate's proliferative activity was examined over a 96-h period. Data show that HUVEC mitogenicity occurs maximally at approximately 72 h in culture, with cell numbers stable for at least an additional 24 h (Fig. 2). To ensure that the increased number of HUVECs was a result of increased proliferation in response to the lysate and not inhibition of apoptosis as previously reported for HUVECs cocultured with B. henselae (23), we examined BrdU incorporation over a 48-h period. BrdU incorporation was significantly increased (82% greater) in HUVEC cultures treated with lysate compared to that in control cultures grown in the presence of heated lysate (Fig. 3). These data suggest that elevated HUVEC numbers in response to B. bacilliformis lysate are a result of increased proliferation rates, suggesting that the factor is a mitogen.
![]() View larger version (22K): [in a new window] |
FIG. 2. Numbers
of HUVECs as a function of incubation time in culture medium containing
B. bacilliformis lysate (10 µg of protein/ml). Data
were obtained at the indicated times with an acid phosphatase assay and
represent the average of three experiments ± standard error.
Control experiments with cells grown in M199-FCS (20% vol/vol)
medium only or medium supplemented with heated lysate (100°C
for 7 min) were also
done.
|
![]() View larger version (21K): [in a new window] |
FIG. 3. Mitogenicity
of the B. bacilliformis lysate for HUVECs, as demonstrated by
BrdU incorporation over a 48-h incubation. Data were obtained with a
BrdU proliferation assay kit (Oncogene) exactly as previously described
for B. henselae
(23) and represent the
average of six experiments ± standard error.
Bartonella lysate was used at 10 µg of protein/ml of
medium. A control experiment with M199-FCS (20% vol/vol) medium
alone was also
done.
|
![]() View larger version (50K): [in a new window] |
FIG. 4. B.
bacilliformis lysate does not inhibit caspase 3 activity in
serum-starved HUVECs. Caspase 3 activity as a function of HUVEC
treatment is shown. Data were obtained by serum starving HUVECs for
6 h in M199 medium containing Z-VAD-FMK (50 µM),
B. bacilliformis lysate (10 µg/ml), or no supplement.
A negative control experiment with cells grown in M199-FCS (10%)
was also done exactly as previously described
(23). Caspase 3 activity
data were obtained with a CaspACE assay kit (Promega) and represent the
average of four independent determinations ± standard
error.
|
2-fold
greater than heated lysate controls) in contrast to the B.
bacilliformis lysate (
12-fold greater than heated lysate
controls) (Fig.
5). Interestingly, although these two bacteria are closely related, the
existing data suggest that they may employ different strategies for
triggering endothelial cell
proliferation.
![]() View larger version (16K): [in a new window] |
FIG. 5. Comparison
of B. bacilliformis and B. henselae lysate
mitogenicities for HUVECs. Data were obtained at 96 h with an
acid phosphatase assay and represent the average of three experiments
± standard error. Bartonella lysates were used at a
final concentration of 10 µg of protein/ml of medium.
Experiments with HUVECs grown in M199-FCS (20% vol/vol) medium
or medium containing heated lysate (100°C for 7 min) were done
as controls. Bh, B. henselae; Bb, B.
bacilliformis.
|
) culture supernatant showed a lower but
significant (
89-fold) increase over HUVEC cultures treated
with bacterial culture medium only. The E. coli mitogen is
heat resistant and thus likely LPS (Fig.
6).
![]() View larger version (15K): [in a new window] |
FIG. 6. Mitogenicity
of the B. bacilliformis culture supernatant. HUVECS grown in
M199-FCS (20% vol/vol) medium containing equal volumes (45
µl) of a filter-sterile supernatant from a B.
bacilliformis or E. coli DH5 culture
(OD600 = 1.0 for both) were assayed for HUVEC
numbers at 96 h by using an acid phophatase assay. HUVECs
grown in M199-FCS (20% vol/vol) medium alone (none), in tissue
culture medium containing 45 µl of sterile bacterial culture
medium (Bact medium), or with heated B. bacilliformis (B.b.)
or E. coli (E.c.) bacterial culture supernatants (Sup;
100°C for 7 min) were also conducted. Data represent the
average of three experiments ± standard
error.
|
![]() View larger version (67K): [in a new window] |
FIG. 7. Immunoblot
showing B. bacilliformis proteins translocated to the growth
medium over a 16-h incubation. Culture supernatants were prepared (see
Materials and Methods), separated by SDS-PAGE (12.5% acylamide),
and blotted to nitrocellulose, and the immunoblot was developed with
anti-B. bacilliformis whole-cell antibody
(32). Lanes: 1, medium
alone; 2, supernatant from the spent growth medium. The positions of
the bacterium-specific proteins, GroEL, flagellin, and the BLPs are
indicated. The identity of the proteins was determined by using
immunoblots developed with monospecific antibodies (not shown).
Molecular mass standards are indicated to the left in
kilodaltons.
|
61 kDa was found to be present in the mitogenic fractions and
was not detected or was barely detectable in fractions that did not
exhibit significant mitogenicity. Given the prominence of this protein
band and its molecular mass, we hypothesized that it was GroEL. This
was verified by using immunoblots developed with commercial anti-E.
coli GroEL IgG (Sigma). An immunoblot comparing GroEL levels in a
poorly mitogenic CHT-II fraction (fraction 7 of Fig.
8A) with a significantly
mitogenic CHT-II fraction (fraction 12 of Fig.
8A) is shown in Fig.
8B (lanes 1 and 2,
respectively).
![]() View larger version (27K): [in a new window] |
FIG. 8. Differential
HUVEC numbers in response to CHT-II fractions of the B.
bacilliformis lysate. (A) HUVEC cultures were grown in
M199-FCS (20% vol/vol) medium containing 40 µl of each
chromatographic fraction (no. 3 to 23) and assayed at 96 h
with an acid phosphatase assay. The data represent the average of three
experiments ± standard error. Control experiments with cells
grown in medium alone (C), medium with lysate (Lys) at 10
µg/ml, or heated samples (100°C for 7 min) were also
done. FT and PW cultures were treated with flowthrough and prewash from
the column, respectively. (B) Immunoblot showing absence of
GroEL in a fraction with insignificant mitogenicity (lane 1, fraction
7) and a prominent GroEL band in a highly mitogenic CHT-II fraction
(lane 2, fraction 12). A correlation between GroEL presence and
mitogenicity was observed in the other fractions as well (not
shown).
|
40% when compared to that in controls treated with an
equal volume of preimmune rabbit serum (Fig.
9). In fact, preimmune serum, containing growth factors and multiple
irrelevant antibody idiotypes, actually enhanced HUVEC growth. Our
inability to completely abrogate mitogenic activity with anti-GroEL
antiserum suggests that other proliferative factors may be present in
the lysate. Substitution with PBS-dialyzed commercial anti-E.
coli GroEL or GroES IgG (Sigma) also yielded significant
reductions (
30 and
39%, respectively) in
mitogenicity of the B. bacilliformis lysate relative to that
of PBS controls (data not shown). That anti-GroES antibodies also
inhibited activity of the lysate is not surprising, because GroEL would
likely be complexed with GroES in the Bartonella cell lysate.
Taken together, these data implicate GroEL and potentially the
GroEL-GroES complex of this bacterium as a participant in the observed
HUVEC mitogenicity.
![]() View larger version (39K): [in a new window] |
FIG. 9. Significant
inhibition of HUVEC mitogenicity by pretreatment of the lysate with
anti-GroEL antiserum. Pretreatment of B. bacilliformis lysate
with rabbit anti-GroEL antiserum for 2 h prior to adding it
to the M199-FCS (20% vol/vol) culture medium (10 µg of
lysate protein/ml) resulted in a significant reduction in mitogenic
activity compared to that of parallel controls treated with equal
volumes of rabbit preimmune serum (Pre). Samples were assayed at
96 h with an acid phosphatase assay. The data represent the
average of six experiments ± standard
error.
|
![]() View larger version (23K): [in a new window] |
FIG. 10. Significant
increase in mitogenic activity of B. bacilliformis lysate in
response to temperature upshift of the source culture. Shown are HUVEC
numbers in response to increasing doses of B. bacilliformis
lysates obtained from a 30°C-grown culture and from a culture
shifted to 37°C for 6 h prior to lysate preparation.
Acid phosphatase assays were done after 96 h of HUVEC growth
in M199-FCS (20% vol/vol) supplemented with lysates from
cultures grown under the two temperature regimens. Data represent the
average of three experiments ± standard
error.
|
![]() View larger version (24K): [in a new window] |
FIG. 11. GroEL
is present in both inner and outer membranes of B.
bacilliformis. Inner and outer membranes (IM and OM, respectively)
of B. bacilliformis were prepared as previously described
(8,
9), separated by SDS-PAGE
(12.5% acrylamide), and then blotted to nitrocellulose. The
resulting immunoblot was developed with an anti-GroEL antiserum. The
positions of GroEL are indicated for outer membranes in lane 1 and
inner membranes in lane 2. Molecular mass standards are given to the
left in
kilodaltons.
|
10 kDa
was also detectable after temperature upshift to 37°C (Fig.
12, lane 2). This small protein may be GroES based upon its conserved
molecular mass among bacteria and the fact that it complexes with
GroEL. As expected, the quantity of secreted GroEL was greater
following a temperature upshift relative to the 25°C sample
(Fig. 12). The mechanism
for secretion of GroEL by Bartonella is unknown, and we are
currently investigating the possible involvement of the
Bartonella VirB/VirD type IV secretion system
(33). Secretion of GroEL
has been previously reported in Helicobacter pylori, where the
protein can be found extracellularly in culture supernatants
(36) and may serve to
protect secreted urease enzyme
(13). In addition, GroEL
secretion has been demonstrated in Legionella pneumophila,
where the protein is mainly associated with the cell envelope of the
bacterium
(18).
![]() View larger version (63K): [in a new window] |
FIG. 12. GroEL
is secreted by B. bacilliformis. B. bacilliformis was
harvested and radiolabeled for 30 min at 25 or 37°C in HIAB
containing 300 µCi of 35S-Express per ml
(NEN-Dupont). Culture supernatants were subsequently isolated,
separated by SDS-PAGE, and blotted to nitrocellulose, and the
immunoblot was developed with anti-GroEL antibody. The blot was then
autoradiographed. The resulting autoradiograph is shown and reveals a
single radiolabeled 61-kDa protein identified as GroEL (arrow) in the
25°C sample (lane 1) and GroEL plus an 10-kDa
radiolabeled protein in the 37°C sample (lane 2, parentheses).
Molecular mass values are given to the left in
kilodaltons.
|
To
overcome these problems, a functional B. bacilliformis
groES-groEL operon was cloned into a multicopy,
broad-host-range shuttle vector to form the plasmid pGRO1. Functional
expression of the operon was verified by complementing a
temperature-sensitive groEL mutant strain of E. coli
(NRK117) (25) with
pGROESL-TOPO according to the general methods of Radulovic et al.
(28; data not shown). A
Bartonella strain transformed with pGRO1 was generated and
designated LSS100. A control strain containing the cloning vector was
also produced and designated LSS001. The relative level of GroEL in
lysates prepared from these strains was quantified by immunoblot
densitometry (not shown) and indicated that levels of GroEL were 70 and
43% greater in LSS100 than in the control strain at treatment
temperatures of 30 and 37°C, respectively (Fig.
13). HUVEC mitogenicity assays with these lysates showed a direct
correlation between GroEL levels and HUVEC mitogenicity
(r2 = 0.85) (Fig.
13). HUVEC numbers
following treatment with the LSS100 lysate (1.0 µg/ml) were
significantly greater than those treated with control LSS001 lysates:
at 30°C, an approximately 4.5-fold increase in HUVEC number was
obtained, and at 37°C, an
2.3-fold increase was
observed (Fig. 13).
Similar profiles were also obtained with lysate supplements of 0.5,
1.5, and 2.0 µg/ml, whereas saturation occurred at
concentrations greater than 5 µg/ml (data not shown). Lack of a
significant difference between LSS100 lysates from the two temperature
treatments suggests that GroEL saturation occurred.
![]() View larger version (31K): [in a new window] |
FIG. 13. HUVEC
numbers correlate with GroEL levels in the Bartonella lysate
treatment. HUVEC numbers in response to treatment with B.
bacilliformis lysates from strains LSS100 (containing pGRO1, a
multicopy plasmid with the groES-groEL operon) and LSS001
(containing the pBBR1-MCS2 vector) cultivated at 30°C or
shifted to 37°C for 6 h prior to lysate preparation.
Acid phosphatase assays were done after 96 h of HUVEC growth
in M199-FCS (20% vol/vol) supplemented with lysates (1.0
µg/ml) from cultures subjected to the two temperature regimens.
GroEL levels in the lysates, relative to those in the 30°C
vector control, were determined by immunoblot densitometry and are
indicated below the corresponding bars of the graph. Data represent the
average of three experiments ± standard
error.
|
The mechanism whereby B. bacilliformis GroEL serves as a proliferative factor is unknown, and its role may be indirect. For example, GroEL from Mycobacterium tuberculosis is a potent stimulator of cytokine synthesis (26). In L. pneumophila, GroEL can induce IL-1ß in macrophages during infection (30) and correlates with virulence (14). B. bacilliformis GroEL could possibly stimulate synthesis of angiogenic cytokines by HUVECs (e.g., IL-6, IL-8, or IL-1ß), which could act in an autocrine fashion to stimulate endothelial cell proliferation in vitro. Given its chaperonin function, GroEL could conceivably protect or even help fold a mitogenic protein, thereby contributing to its activity.
Although we did not observe inhibition of HUVEC apoptosis in cultures treated with B. bacilliformis lysate, inhibition of cell death via an alternative pathway that does not involve caspase 3 is possible. Previous work has shown that bacterial GroEL or GroEL fragments can inhibit apoptosis in a variety of mammalian cells (7, 19). In addition, GroEL is suspected of playing a role in conferring apoptosis resistance to HeLa 229 cells that are persistently infected with Chlamydia trachomatis (12).
In conclusion, the most important findings from this study are (i) the B. bacilliformis proliferative factor is a dose-dependent, proteinaceous mitogen for HUVECS that does not inhibit apoptosis by the capase 3 pathway within a 6-h serum starvation period; (ii) the mitogen is found in bacterial culture supernatants, the soluble cell fraction, and to a lesser degree in insoluble cell fractions of the bacterium; (iii) soluble cell fractions from B. henselae possess significantly less mitogenicity for HUVECs than those from B. bacilliformis; (iv) B. bacilliformis GroEL is a participant in the observed HUVEC mitogenicity; and (v) GroEL is located in the soluble and membrane fractions of the cell and is actively secreted by B. bacilliformis.
We gratefully acknowledge Jean Pfau's helpful discussions. Special thanks to Scott Knight and Corbin Schwanke for assistance with chromatography and Christopher Coker for E. coli NRK117.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»