Previous Article | Next Article ![]()
Infection and Immunity, April 2003, p. 1656-1661, Vol. 71, No. 4
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.4.1656-1661.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Research Unit of Infection and Immunity, West China Medical Center, Sichuan University, Chengdu, Sichuan 610041, People's Republic of China
Received 16 September 2002/ Returned for modification 31 October 2002/ Accepted 3 January 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Mycobacterium bovis bacillus Calmette-Guérin (BCG), a live, attenuated strain of M. bovis, is currently the only available vaccine for prevention of TB. BCG has exhibited protection against severe and fatal TB in children. However, BCG has shown itself to be of varying efficacy (ranging from 0 to 80%) in protecting adults from pulmonary TB, depending on the population tested (8, 12, 30). Thus, an improved vaccine is urgently needed to replace BCG and to prevent TB effectively. Several new types of TB vaccine preparations, including subunit vaccines, live attenuated vaccines, recombinant BCG (rBCG), and DNA vaccines, are currently investigated in experiments.
ESAT-6 (1), a secretory protein from M. tuberculosis, is a dominant target for cell-mediated immunity in the early phase of TB in TB patients as well as in various animal models, causing T-cell proliferation and gamma interferon (IFN-
) production (5, 16, 23). ESAT-6 has been considered to be a protective antigen that can be used for future vaccine development, while BCG, which lacks 15 to 16 regions of the M. tuberculosis genome, is not able to express ESAT-6 as a result of deletion of esat-6 gene (3, 15).
In the present study, we have constructed two rBCG strains expressing ESAT-6 and evaluated the virulence and the humoral, cell-mediated, and protective immune responses of them. There was no evidence for increased virulence of the two rBCG strains when we compared them with the BCG strain, and one rBCG strain that expresses ESAT-6 fused to HSP60 could elicit stronger specific immune response. This is encouraging for the future vaccine development; however, despite the enhanced in vitro immunological responses, the recombinant vaccines expressing ESAT-6 afford no greater protection against M. tuberculosis infection.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and cultures.
Escherichia coli DH5
was grown in Luria-Bertani medium and used for cloning. M. bovis BCG (obtained from Chengdu Biological Products Institute), rBCG, and M. tuberculosis strain H37Rv were cultivated in Sauton medium (0.25 g of MgSO4 · 7H2O, 0.25 g of K2HPO4, 1 g of citric acid, 4 g of sodium glutamate, 30 ml of glycerol, 5 mg of ZnSO4, and 25 mg of ferrum-ammonium citrate in 500 ml) or on Sauton agar (1% starch and 1.5% agar in Sauton medium).
Construction of rBCG.
Genomic DNA from M. tuberculosis or M. bovis was isolated by protease K digestion and phenol-chloroform extraction. The oligonucleotide primers for the esat-6 gene were 5' ATATGGCCAAGGGATCCACAGAGCAGCAGTGGAA 3' (primer 1) (underlined sequences indicate BalI and BamHI sites) and 5' CGGAATTCCTATGCGAACATCCCAG 3' (primer 2) (underlined sequence indicates an EcoRI site). The primers for the
-antigen signal sequence of BCG were 5' CATGGCCACAGACGTGAGCCGAAAGA 3' (primer 3) (underlined sequence indicates a BalI site) and 5' ATATAAGGATCCCGCGCCCGCGGTTGCCG 3' (primer 4) (underlined sequence indicates a BamHI site). esat-6 and
-antigen signal sequences were amplified from genomic DNA of M. tuberculosis and M. bovis BCG, respectively, after an initial denaturation at 94°C for 3 min, by 30 cycles at 94°C for 45 s, 60°C for 60 s, and 72°C for 60 s. We constructed two recombinant shuttle vectors. Plasmid pME-1 was constructed by placing the BalI-EcoRI-digested esat-6 PCR product into the similarly digested parental plasmid pMV261. Plasmid pSME was obtained by first inserting the BamHI-EcoRI-digested esat-6 into pMV261 to construct plasmid pME-2 and then cloning
-antigen signal sequence into the BalI-BamHI site of pME-2. All DNA manipulations followed previously described procedures (25). The recombinant shuttle plasmids pME-1 and pSME were identified by DNA sequencing and then transformed into BCG by electroporation as described previously (28). The transformed BCG cells were plated on Sauton agar supplemented with 20 µg of kanamycin per ml. After 3 to 4 weeks growth at 37°C, individual colonies were picked and grown in Sauton medium containing 20 µg/ml of kanamycin. To identify the rBCG strains, their genomic DNA were isolated and spotted onto a nylon membrane for dot blotting, using esat-6 PCR product as a probe.
Tricine-SDS-PAGE and immunoblotting. The rBCG strains were grown in Sauton medium for 2 weeks, and protein expression was induced by heating at 45°C for 30 min. The bacterial cells were centrifuged at 3,220 x g for 20 min. The supernatant was filtered through a 0.22-µm-pore-size membrane, concentrated by vacuum-lyophilization, and then dialyzed in distilled water for 72 h. The dialyzed culture filtrate was again vacuum lyophilized to powder and dissolved in phosphate-buffered saline (PBS) (pH 7.4). Sonicated cell lysates and culture filtrate proteins were analyzed by Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-SDS-PAGE) (26), using a 12.87% polyacrylamide separation gel and 4% stacking gel. After a semidry transfer with 25 mM Tris-HCl buffer (pH 8.5) containing 200 mM glycine and 20% methanol onto nitrocellulose, immunoblotting was performed with a 1:25 dilution of the monoclonal antibody (MAb) HYB76-8 (generously donated by Ida Rosenkrands, Statens Seruminstitut, Copenhagen, Denmark) (this MAb was isolated from purified protein derivative-immunized mice, with which ESAT-6 was biochemically purified, characterized and the encoding gene was cloned in 1995) (1) and horseradish peroxidase-labeled goat anti-mouse immunoglobulin G (IgG) antibodies (Zhongshan Biotech, Ltd., Beijing, China). The color was developed with diaminobenzidine as substrate.
Evaluation of virulence of rBCG. BALB/c mice were infected subcutaneously with approximately 106 CFU of BCG, rBCG or M. tuberculosis H37Rv suspended in normal saline in a volume of 0.1 ml. Groups of mice (three mice per group) were sacrificed after 2, 4, 8, 16, and 26 weeks. The spleen, liver, and right lung of each animal were removed aseptically and then homogenized in 5 ml of Tween 80-PBS. Numbers of bacteria in these organs were determined by plating the diluted homogenates on Sauton agar. Organs from the rBCG-inoculated mice were grown on plates supplemented with kanamycin (15 µg/ml). Colonies were counted after 3 to 4 weeks of incubation at 37°C. Data are expressed as mean log10 values per experimental group. The left lung was fixed in 10% phosphate-buffered formalin, embedded in paraffin, sectioned, and stained with hematoxylin and eosin.
Immunization of mice. BALB/c mice were immunized subcutaneously on the back with 100 µl of normal saline, 106 CFU of BCG or rBCG. They were sacrificed (three mice per group) after 4, 8, 12, and 16 weeks to prepare serum and splenocytes.
Evaluation of antigen-specific antibody levels by ELISA. Enzyme-linked immunosorbent assay (ELISA) plates were coated with 0.1 ml of culture filtrate proteins of M. tuberculosis H37Rv (5 µg/ml) overnight at 4°C. Nonspecific binding sites were blocked by 1% bovine serum albumin-PBS. Individual serum samples from three mice per group were analyzed in twofold dilutions. Horseradish peroxidase-conjugated goat anti-mouse IgG (Zhongshan Biotech, Ltd., Beijing, China) were diluted 1/1,000. Antibody titers are expressed as reciprocal end point titers.
Lymphocyte cultures.
Lymphocytes from spleens were obtained as described previously (2). The cells were washed and resuspended in complete RPMI 1640 medium supplemented with 10% fetal calf serum, 1% L-glutamine, 50 µM 2-mercaptoethanol, and 1% penicillin-streptomycin. Cells were added to 96-well plates (7x105 cells per well) in triplicate for culture with culture filtrate proteins (25 µg/ml) of M. tuberculosis H37Rv. Supernatants were harvested from cultures after 72 h of incubation for the investigation of IFN-
.
IFN-
ELISA.
IFN-
production by spleen cells was measured by sandwich ELISA using paired MAbs (Jingmei Biotech, Ltd., Shenzhen, China) according to the manufacturer's instructions.
Percentages of splenocytes subsets by flow cytometry. Splenocytes from mice 8 and 12 weeks postimmunization were prepared and cultured as above. Cells of three mice per group were pooled and centrifuged, and this was followed by incubation with rabbit anti-mouse CD4 and CD8 MAbs. After the cells were washed with PBS, goat anti-rabbit IgG-fluorescein isothiocyanate was added for incubation. The proportions of CD4+ and CD8+ cells were determined by flow cytometry.
Challenge infection. Eight weeks after immunization, twelve mice in each group were challenged intraperitoneally by 105 CFU of virulent M. tuberculosis H37Rv. Three mice per group were sacrificed 4 and 8 weeks postchallenge. The spleen and right lung were removed aseptically and cultured for CFU of M. tuberculosis. Sauton agar contained thiophene carboxylic acid hydrazide (2 µg/ml) to selectively inhibit the growth of the residual BCG bacteria in the test organs. The left lung was fixed in 10% phosphate-buffered formalin, embedded in paraffin, sectioned, and stained with hematoxylin and eosin. The challenge experiments were performed twice.
Statistical analysis. Student's t test was used to determine the statistical significance of differences between groups. A value of P < 0.05 was considered to be significant.
| RESULTS |
|---|
|
|
|---|
|
|
|
production of splenocytes.
The results of IFN-
ELISA showed that splenocytes from rBCG-1-immunized mice could produce significantly higher IFN-
levels than those from BCG group (P < 0.05) in weeks 8 and 12, while there were no significant differences between mice vaccinated with rBCG-2 and BCG (Fig. 3).
|
Protective efficacy against M. tuberculosis challenge. BCG and rBCG-immunized mice were challenged with M. tuberculosis H37Rv intraperitoneally. Lungs and spleens were removed 4 and 8 weeks after challenge. On visual inspection of the lung surfaces, we found that mice immunized with BCG, rBCG-1 and rBCG-2 had fewer and smaller tubercles than control group injected with normal saline only. Infection with M. tuberculosis caused an enlargement of the lungs, which was more pronounced in control group. As expected, control mice had the highest bacterial loads in both lung and spleen. Immunization with BCG, rBCG-1, or rBCG-2 could remarkably reduce CFU counts in organs, but there were no significant differences among these three groups (Fig. 4). The extent of cellular infiltration in the lungs of rBCG-1 and rBCG-2 groups was less expansive than that of control group, also the granulomas were fewer and smaller. However, it was difficult to differentiate these histopathological findings from those of BCG group.
|
| DISCUSSION |
|---|
|
|
|---|
production, although their protective efficacies were not significantly higher than that of the parental BCG.
The low mass secreted ESAT-6 protein has been demonstrated to be a key molecule recognized by memory effector T lymphocytes in the long-lived immunity to TB (1). It is strongly recognized in M. tuberculosis-infected mice (7), guinea pigs (16), and in the early stage of infection with virulent M. bovis in cattle (23), and it stimulates the early release of IFN-
. Moreover, ESAT-6 stimulates CD4+ T cells in human peripheral blood mononuclear cells from TB patients and induces IFN-
production (24, 29). Recently, new vaccines comprising ESAT-6, including subunit vaccines, DNA vaccines, and recombinant attenuated Salmonella enterica serovar Typhimurium, have proven of use for providing some degree of protection (6, 17, 18, 19, 21). They are capable of inducing a substantial IFN-
response in the spleen and stimulating a significant reduction in the level of M. tuberculosis infection in the lungs of mice. In addition, ESAT-6 is highly expressed in all virulent strains of M. tuberculosis and M. bovis; however, the gene is lacking in all the strains of BCG tested (15, 20). It is assumed that ESAT-6 is a protective antigen missing from virulent M. bovis during the long course of in vitro cultivation which led to the generation of attenuated BCG strain. Our research is aimed to investigate whether reintroduction of ESAT-6 gene into BCG could improve the efficacy of the vaccine.
Since a conventional lead sequence is absent from the gene encoding ESAT-6 (27), in this study we cloned the signal sequence of BCG
-antigen into the E. coli-BCG shuttle plasmid pMV261, and placed it in the 5' end of esat-6 gene to facilitate the secretion of ESAT-6. The transformed BCG strain rBCG-2 could express ESAT-6 secretively, which is confirmed by Tricine-SDS-PAGE and immunoblotting. The other rBCG strain rBCG-1, with no signal sequence, expressed ESAT-6 fused to the first several amino acids of BCG HSP60.
Though no evidence has yet shown that ESAT-6 is definitely a virulence factor, ESAT-6 is thought to be relevant to virulence for its presence in virulent M. bovis and M. tuberculosis. In order to prevent the possibility that reversion to a virulent strain may occur with the reintroduction of esat-6 gene, we examined the manifestations of virulence of rBCG strains in mice. The CFU counts and lung histopathology suggested that like BCG, rBCG-1 and rBCG-2 were not able to multiply in organs, nor did they cause progressive pathology in the lungs. The virulence of the BCG recombinants was probably not elevated with the expression of ESAT-6; however, this needs to be substantiated by further researches in immunodeficient mice model.
Recent researches have found that ESAT-6 is one part of a complex including CFP-10. esat-6 and the neighboring lhp gene (encoding CFP-10) form an operon structure and the two genes are transcribed together in M. tuberculosis (4). Thirteen genes related to the lhp/esat-6 operon which constitute a novel gene family were identified via computer searches in the M. tuberculosis genome. This might explain the apparent lack of increased virulence in rBCG.
Since IFN-
is a critical cytokine associated with the induction of an antimycobacterial protective response (10, 13, 22), we initially focused on this cytokine response in the vaccinated animals. rBCG-1 immunization could elicit higher IFN-
levels as well as specific antibody titers in mice. Percentages of CD8+ subset were also increased, which may contribute to better protection because of the important role of CD8T cells in the clearance of mycobacterial infection (14). To our surprise, although the immunogenicity of rBCG-1 was greater than that of BCG, rBCG-2 expressing ESAT-6 secretively was immunogenically similar to BCG, and neither recombinant strain conferred greater protective efficacy against M. tuberculosis infection. The results highlight the discrepancy between immunological responses to antigens in vitro and protective immunity in vivo. The reasons are to be explored.
The difference in immunogenicity between the two recombinants is probably related to the quantity and stability of the expressed ESAT-6. ESAT-6 fused with HSP60 tends to be less readily degraded by hydrolytic enzymes and remains stable in phagosomes. More ESAT-6 are therefore processed and presented, leading to stronger immune responses. Obviously, a comparative quantitative analysis of ESAT-6 expression in these two recombinant strains is necessary to explain why the immunogenicity of rBCG-1 was greater than that of rBCG-2.
Genetic comparison of M. tuberculosis H37Rv and BCG revealed that 15 to 16 regions (encompassing 129 open reading frames) are deleted in the genome of BCG (3). Many immunodominant antigens including ESAT-6 and the probable transcriptional regulators predicted in sequencing of M. tuberculosis H37Rv genome (9) are within these deletion regions. The failure of rBCG strains supplemented with ESAT-6 to give more effective protection against M. tuberculosis suggests that the imperfect efficacy of BCG as a vaccine may at least not be attributable to the absence of the ESAT-6 gene alone. We hypothesize that the lack of regulating proteins encoded by missing genes might have a great influence on the normal expression of the downstream genes. It is more likely that the deletions of a cluster(s) of genes, not just one or two genes are involved in the unsatisfactory protection of BCG. Further investigation should be encouraged.
Some scholars have previously proposed that genetic engineering BCG is a candidate vaccine against TB. Despite the unsatisfactory protective efficacy yielded in our research, the increased immunogenicity compared with BCG and the potential advantages over other types of new vaccines make rBCG attractive in TB vaccine development. It contains many more antigens, many of which are protective; it is able to multiply in the host macrophages, releasing various antigens consistently; it is a strong adjuvant and live vector itself; it needs no repeated vaccination; and it also shares several important advantages of conventional BCG (e.g., it is safe to use, stable to store, available for immunization at birth, and cost-effective).
Several approaches may be considered for further enhancement of the immunogenicity and protective efficacy of rBCG vaccine: (i) using shuttle vectors with high-efficiency promoters to increase expression of antigens; (ii) adding more kinds of protective antigens, such as Ag85A, Ag85B, CFP10, and MPT64 (18, 31); (iii) coexpressing genes of cytokines, such as IL-2, IFN-
, and IL-12; and (iv) utilizing other methods of administration, such as intranasal vaccination.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
| 1. | Andersen, P., A. B. Andersen, A. L. Sorensen, and S. Nagai. 1995. Recall of long-lived immunity to Mycobacterium tuberculosis infection in mice. J. Immunol. 154:3359-3372.[Abstract] |
| 2. | Andersen, P., D. Askgaard, L. Ljungqvist, M. W. Bentzon, and I. Heron. 1991. T cell proliferative response to antigens secreted by Mycobacterium tuberculosis. Infect. Immun. 59:1558-1563. |
| 3. | Behr, M. A., M. A. Wilson, W. P. Gill, H. Salamon, G. K. Schoolnik, S. Rane, and P. M. Small. 1999. Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 284:1520-1523. |
| 4. | Berthet, F. X., P. B. Rasmussen, I. Rosenkrands, P. Andersen, and B. Gicquel. 1998. A Mycobacterium tuberculosis operon encoding ESAT-6 and a novel low-molecular-mass culture filtrate protein (CFP-10). Microbiology 144:3195-3203.[Abstract] |
| 5. | Boesen, H., B. N. Jensen, T. Wilcke, and P. Andersen. 1995. Human T-cell responses to secreted antigen fractions of Mycobacterium tuberculosis. Infect. Immun. 63:1491-1497.[Abstract] |
| 6. | Brandt, L., M. Elhay, I. Rosenkrands, E. B. Lindblad, and P. Andersen. 2000. ESAT-6 subunit vaccination against Mycobacterium tuberculosis. Infect. Immun. 68:791-795. |
| 7. | Brandt, L., T. Oettinger, A. Holm, A. B. Andersen, and P. Andersen. 1996. Key epitopes on the ESAT-6 antigen recognized in mice during the recall of protective immunity to Mycobacterium tuberculosis. J. Immunol. 157:3527-3533.[Abstract] |
| 8. | Colditz, G. A., T. F. Brewer, C. S. Berkey, M. E. Wilson, E. Burdick, H. V. Fineberg, and F. Mosteller. 1994. Efficacy of BCG vaccine in the prevention of tuberculosis. Meta-analysis of the published literature. JAMA 271:698-702.[Abstract] |
| 9. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. 3rd Barry, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B. G. Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544.[CrossRef][Medline] |
| 10. | Cooper, A. M., D. K. Dalton, T. A. Stewart, J. P. Griffin, D. G. Russell, and I. M. Orme. 1993. Disseminated tuberculosis in interferon gamma gene-disrupted mice. J. Exp. Med. 178:2243-2247. |
| 11. | Dolin, P. J., M. C. Raviglione, and A. Kochi. Global tuberculosis incidence and mortality during 1990-2000. Bull. W. H. O. 72:213-220. |
| 12. | Fine, P. E. 1995. Variation in protection by BCG: implications of and for heterologous immunity. Lancet 346:1339-1345.[CrossRef][Medline] |
| 13. | Flynn, J. L., J. Chan, K. J. Triebold, D. K. Dalton, T. A. Stewart, and B. R. Bloom. 1993. An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249-2254. |
| 14. | Flynn, J. L., M. M. Goldstein, K. J. Triebold, B. Koller, and B. R. Bloom. 1992. Major histocompatibility complex class I restricted T cells are required for resistance to Mycobacterium tuberculosis infection. Proc. Natl. Acad. Sci. USA 89:12013-12017. |
| 15. | Harboe, M., T. Oettinger, H. G. Wiker, I. Rosenkrands, and P. Andersen. 1996. Evidence for occurrence of the ESAT-6 protein in Mycobacterium tuberculosis and virulent Mycobacterium bovis and for its absence in Mycobacterium bovis BCG. Infect. Immun. 64:16-22.[Abstract] |
| 16. | Haslov, K., A. Andersen, S. Nagai, A. Gottschau, T. Sorensen, and P. Andersen. 1995. Guinea pig cellular immune responses to proteins secreted by Mycobacterium tuberculosis. Infect. Immun. 63:804-810.[Abstract] |
| 17. | Kamath, A. T., C. G. Feng, and M. Macdonald. 1999. Differential protective efficacy of DNA vaccines expressing secreted proteins of Mycobacterium tuberculosis. Infect. Immun. 67:1702-1707. |
| 18. | Li, Z., A. Howard, C. Kelley, G. Delogu, F. Collins, and S. Morris. 1999. Immunogenicity of DNA vaccines expressing tuberculosis proteins fused to tissue plasminogen activator signal sequences. Infect. Immun. 67:4780-4786. |
| 19. | Lindblad, E. B., M. J. Elhay, R. Silva, R. Appelberg, and P. Andersen. 1997. Adjuvant modulation of immune responses to tuberculosis subunit vaccines. Infect. Immun. 65:623-629.[Abstract] |
| 20. | Mahairas, G. G., P. J. Sabo, M. J. Hickey, D. C. Singh, and C. K. Stover. 1996. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. J. Bacteriol. 178:1274-1282. |
| 21. | Mollenkopf, H. J., D. Groine-Triebkorn, P. Andersen, J. Hess, and S. H. Kaufmann. 2001. Protective efficacy against tuberculosis of ESAT-6 secreted by a live Salmonella typhimurium vaccine carrier strain and expressed by naked DNA. Vaccine 19:4028-4035.[CrossRef][Medline] |
| 22. | Newport, M. J., C. M. Huxley, S. Huston, C. M. Hawrylowicz, B. A. Oostra, R. Williamson, and M. Levin. 1996. A mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infection. N. Engl. J. Med. 335:1941-1949. |
| 23. | Pollock, J. M., and P. Andersen. 1997. Predominant recognition of the ESAT-6 protein in the first phase of interferon with Mycobacterium bovis in cattle. Infect. Immun. 65:2587-2592.[Abstract] |
| 24. | Ravn, P., A. Demissie, T. Eguale, H. Wondwosson, D. Lein, H. A. Amoudy, A. S. Mustafa, A. K. Jensen, A. Holm, I. Rosenkrands, F. Oftung, J. Olobo, F. von Reyn, and P. Andersen. 1999. Human T cell responses to the ESAT-6 antigen from Mycobacterium tuberculosis. J. Infect. Dis. 179:637-645.[CrossRef][Medline] |
| 25. | Sambrook, J., E. F. Fritisch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 26. | Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379.[CrossRef][Medline] |
| 27. | Sorensen, A. L., S. Nagai, G. Houen, P. Andersen, and A. B. Andersen. 1995. Purification and characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium tuberculosis. Infect. Immun. 63:1710-1717.[Abstract] |
| 28. | Stover, C. K., G. P. Bansal, M. S. Hanson, J. E. Burlein, S. R. Palaszynski, J. F. Young, S. Koenig, D. B. Young, A. Sadziene, and A. G. Barbour. 1993. Protective immunity elicited by recombinant Bacille Calmette-Guerin (BCG) expressing outer surface protein A (OspA) lipoprotein: a candidate Lyme disease vaccine. J. Exp. Med. 178:197-209. |
| 29. | Ulrichs, T., M. E. Munk, H. Mollenkopf, S. Behr-Perst, R. Colangeli, M. L. Gennaro, and S. H. Kaufmann. 1998. Differential T cell responses to Mycobacterium tuberculosis ESAT6 in tuberculosis patients and healthy donors. Eur. J. Immunol. 28:3949-3958.[CrossRef][Medline] |
| 30. | World Health Organization. 1979. Trial of BCG vaccines in south India for tuberculosis prevention: first reportTuberculosis Prevention Trial. Bull. W. H. O. 57:819-827.[Medline] |
| 31. | Zhu, X., N. Venkataprasad, H. S. Thangaraj, M. Hill, M. Singh, J. Ivanyi, and H. M. Vordermeier. 1997. Functions and specificity of T cells following nucleic acid vaccination of mice against Mycobacterium tuberculosis infection. J. Immunol. 158:5921-5926.[Abstract] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|