![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Infection and Immunity, April 2003, p. 1919-1928, Vol. 71, No. 4
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.4.1919-1928.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
S. A. Reeves, E. G. Gonzales, and S. M. Payne*
Section for Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, Texas 78712-0162
Received 9 September 2002/ Returned for modification 24 October 2002/ Accepted 9 January 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Shigellae possess numerous systems for iron acquisition. They synthesize and secrete low-molecular-weight, high-affinity ferric iron chelators called siderophores that can either solubilize ferric iron from insoluble complexes or remove iron from some binding proteins and deliver the iron to the bacterial cell. Shigella isolates synthesize and use the hydroxamate siderophore aerobactin or the catechol siderophore enterobactin (40, 41). Additionally, shigellae can use the fungal siderophore ferrichrome (40). There are specific receptors in the bacterial outer membrane that bind each ferrisiderophore or other iron complexes with high affinity. In Shigella, these receptors include IutA for aerobactin (28), FepA for enterobactin (41, 50), and the heme receptor ShuA (36). The receptor for ferrichrome is likely to be the Shigella homologue of the Escherichia coli FhuA receptor (5, 47). Transport of these iron-containing ligands through the outer membrane receptors and into the periplasm is an energy-dependent process which requires the TonB-ExbBD system (37).
Periplasmic binding protein-dependent ABC transport systems transport periplasmic iron complexes into the cytoplasm (4). Each system consists of a periplasmic ligand-binding protein, two cytoplasmic membrane permeases, and two subunits of a peripheral cytoplasmic membrane protein with ATP binding motifs. The transported iron ligand binds to the periplasmic binding protein and is transferred to cytoplasmic membrane permeases. Transport through the cytoplasmic membrane requires ATP hydrolysis by the associated ATPase. Unlike the outer membrane receptors, transport through this system is less ligand specific. For example, both ferriferrichrome and ferriaerobactin are transported though the FhuBCD system (25).
Preliminary analysis of the S. flexneri genome shows that, in addition to genes encoding high-affinity ferric transport systems, S. flexneri has feoAB, which are homologous to E. coli feoAB (F. R. Blattner, unpublished observations). E. coli FeoB, a large cytoplasmic membrane protein with homology to ATPases, mediates ferrous iron uptake (19). However, it is not known whether the 9-kDa FeoA protein is expressed or what role it plays in ferrous iron transport. Unlike ferric iron, which is poorly soluble, ferrous iron is relatively soluble but is primarily found under anaerobic conditions or at nonphysiological pH.
We recently identified another putative iron transport gene, sitA, in a screen for S. flexneri genes that are induced in the intracellular environment (47). S. flexneri SitA is homologous to Salmonella enterica serovar Typhimurium SitA, which is encoded in a four-member operon that mediates manganese and iron transport (18, 22, 56). In S. enterica serovar Typhimurium, sitA expression is repressed in the presence of either iron or manganese (56). The iron repression is mediated by the global transcriptional regulator Fur (56). When bound to ferrous iron, Fur binds to Fur boxes in iron-regulated promoters, thereby repressing transcription (9, 51). The S. enterica serovar Typhimurium sitA promoter also has a putative MntR binding site, and thus the manganese repression of sitA has been proposed elsewhere to be mediated by the manganese-binding transcriptional regulator MntR (21, 22). This report describes the characterization of the S. flexneri sit operon and the role of the Sit system and other iron acquisition systems in the ability of S. flexneri to productively infect eukaryotic cells.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
All PCRs were carried out with either Taq (Qiagen) or Pfu (Stratagene Cloning Systems, La Jolla, Calif.) polymerase according to the manufacturer's instructions. Taq was used for all PCRs unless the fragments were to be cloned or sequenced, in which case Pfu was used. Primers for detection of the sitA gene were sit3 (5'ATGCTCTTGGGGTGCTTGGC3') and sit4 (5'TTCCAGATTCATACCATTGGCG3'). Other primers for individual PCRs are listed in the appropriate sections below.
Sequence analysis of the S. flexneri sitA operon. The nucleotide sequence of part of a Shigella dysenteriae O-4576 cosmid that contained the sit locus (pSIT1) had previously been determined (42). Based on this sequence, PCR primers were designed to amplify the sit locus from S. flexneri SA100 in five overlapping fragments. These primers were SA100.1 (CATGAACGACGAACAGATAGC) and SA100.2 (GCTTGGTTATGGATGAGACTT), SA100.3 (TCGCATTTCAGGCAAGTGC) and SA100.4 (ATCTTTCCGCTGGTCAGACG), SA100.5 (TGGTTGGGGTAACGGTTC) and SA100.6 (TAGGACGATGGTCTGAATG), SA100.7 (GGGCTGTTTATGGTGTCATTGAAC) and SA100.8 (AAAGCGTTGTGTCAGGAG), and SA100.9 (CGCTGAAAGCAGTAGGTATC) and SA100.10 (TTTTGACGACAGGGACCAG).
sitA-gfp expression studies. Strains containing gfp were grown in low-salt Luria-Bertani (LB) broth or LB agar, which contains 5 g of NaCl per liter (24). sitA expression was measured by use of the plasmid-borne sitA-gfp fusion pEG2 (47). Bacteria containing pEG2 were grown in LB broth containing 1 to 32 µg of the iron chelator EDDA per ml to late log phase. One milliliter of each culture was pelleted and resuspended in 4% paraformaldehyde for 10 min and then washed twice and resuspended in low-salt phosphate-buffered saline (47). Green fluorescent protein levels were quantified with a FACSCaliber (Becton Dickinson) fluorescence-activated cell sorter with an excitation at 488 nm. FACSCaliber settings were as follows: forward scatter, E01; side scatter, 505; and relative fluorescence between 515 and 545 nm, 798.
Construction of mutations in S. flexneri. The sitA::cam mutant SM166 was constructed by allelic exchange. For construction of the sitA::cam plasmid, the sitA gene was amplified from SA514 chromosomal DNA with primers sitABfor (5'CTCTTGAAGCACTGAAGGAG3') and sitABrev (5'CGCACAAATCCCATAATC3') and was cloned into SmaI-digested pWKS30 (54) to generate pLR61. A 1.6-kb fragment containing a chloramphenicol resistance gene (cam) was isolated from pMA9 (17) by digestion with HincII and inserted into the MscI site in sitA. The gene with the cam resistance cassette was excised as a EcoRV-XbaI fragment and ligated into pHM5 digested with EcoRV-XbaI to generate pLR64. Allelic exchange was done in SM100 as described previously (46).
The feoB::dhfr mutant SA190 was constructed by targeting of a group II intron to the feoB gene as described elsewhere (20, 55). Double and triple mutants (Table 1) were constructed by P1 transduction of mutations into various backgrounds (34).
All mutations were confirmed by PCR analysis.
Screening of chromosomal library for sit operon. A cosmid library of S. flexneri chromosomal DNA (K. Lawlor, unpublished data) in E. coli HB101 (48) was screened by colony hybridization for clones that hybridize to the S. flexneri sitA gene. Probe labeling, hybridization, and detection were performed as described for the Genius II system (Boehringer Mannheim). Cosmids that hybridized with the sitA probe were further screened for downstream sit genes by PCR with primers SA100.9 and SA100.10.
Tissue culture cell invasion and plaque assays. Monolayers of Henle cells (intestine 407 cells; American Type Culture Collection, Manassas, Va.) were used in all experiments and were maintained in Henle medium, which consists of minimum essential medium, 10% Tryptose phosphate broth, 2 mM glutamine, minimum essential medium nonessential amino acid solution (Life Technologies, Grand Island, N.Y.), and 10% fetal bovine serum (Life Technologies) in a 5% CO2 atmosphere at 37°C. Plaque assays were done as described previously (38) with the modifications described in the work of Hong et al. (16), and plaques were scored after 3 to 4 days.
Nucleotide sequence accession number. The nucleotide sequence of each fragment was determined by the Molecular Biology Sequencing Facility at the University of Texas at Austin and was submitted to the GenBank database under the accession number AY126440.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
The sit genes and downstream P27-like phage genes were also found in S. dysenteriae (42). The 300-bp region immediately 5' to the sit genes is almost identical in S. flexneri and S. dysenteriae but shows no homology with any other nucleotide sequences in the nonredundant database (data not shown). However, the nucleotide sequences further upstream of the sit genes in these Shigella species differ: the S. flexneri sequence is homologous to the intR integrase in the E. coli K-12 chromosome, while the S. dysenteriae sequence is homologous to a region containing ompN and ynaF in the E. coli K-12 chromosome. The presence of phage-like elements near the sit genes and the difference in the sequences flanking the sit genes in S. flexneri and S. dysenteriae are consistent with the Shigella sit genes being present on a pathogenicity island-like element and with the S. flexneri and S. dysenteriae sit genes having been acquired independently.
Presence of the sit locus in other Shigella and E. coli isolates.
To determine the phylogenetic distribution of the sit locus among other Shigella and pathogenic E. coli isolates, we did PCR analysis with primers within the sitA gene (Table 3). sitA was present in all of the tested isolates of Shigella, which represented all the Shigella species. Because the E. coli and S. flexneri chromosomes are highly similar, numerous E. coli isolates were also tested for the presence of the sitA gene. Six of seven enteroinvasive isolates tested contained the sitA gene (Table 3). However, none of the enteropathogenic, enterohemorrhagic, uropathogenic, or meningitis-causing E. coli isolates tested had sitA, nor did E. coli W3110 or DH5
, two nonpathogenic E. coli K-12 strains (Table 3). The presence of the sitA gene in enteroinvasive enteric pathogens, but not in other pathogenic and nonpathogenic E. coli strains, suggests that SitA may contribute to growth in the intracellular environment.
|
The sit genes were also tested for growth promotion of 1017 in Tris-buffered minimal medium without added iron. The ent mutant failed to grow in this medium, and the presence of the sit genes had no effect. The addition of small amounts of iron (0.5 to 1 µM) allowed growth of all three strains (data not shown). It is likely that low-affinity iron transport systems present in 1017 are as efficient as the sit genes in promoting growth in medium with minimal iron levels, but the sit genes provide an advantage in iron acquisition in the presence of an exogenous iron chelator.
Effect of sitA, iucD, and feoB mutations on growth of S. flexneri in media containing EDDA. To further determine whether SitA enhanced growth in iron-depleted media, we constructed a sitA mutant, SM166, in which the wild-type sitA allele was disrupted with the cam gene. Growth of the sitA mutant in L broth containing >125 µg of EDDA/ml was decreased relative to the wild type after 8 h (Fig. 2A). There was no difference in optical density between the wild type and the sitA mutant after 24 h of growth or in cultures grown with EDDA concentrations of <125 µg/ml (data not shown).
|
Because the S. enterica serovar Typhimurium Sit and the Y. pestis Yfe systems transport both iron and manganese, the S. flexneri sit mutant could have reduced capacity to acquire manganese as well as iron. EDDA has a much higher affinity for iron than for manganese (29), but it is possible that manganese was also chelated at the EDDA concentrations used in the growth experiments. To determine whether the decreased growth of the sitA mutant in the presence of EDDA was due to depletion of iron or manganese, each of the metals was added to the broth cultures containing EDDA (Fig. 3). Addition of FeCl3 to the cultures stimulated the growth of the sitA mutant to wild-type levels, and growth of both the wild-type and mutant strains was comparable to that in cultures without EDDA (Fig. 3). Addition of manganese also abolished the difference in growth between the wild type and the mutant, although growth was not restored to the levels without EDDA (Fig. 3). This suggests that both the parent and the mutant are iron starved. Further, the sitA mutant may also be slightly starved for manganese, since the addition of manganese restores the sitA mutant's growth to the level of the parent.
|
|
Regulation of the sit operon. Because the S. flexneri sitA gene is induced in the eukaryotic intracellular environment and functions with the Iuc and Feo systems to allow intracellular growth, it was of interest to determine the environmental stimuli that activate sit expression. To approach this issue, we examined the regulation of the S. flexneri sit operon in vitro using the sitA-gfp transcriptional fusion on pEG2. Since SitABCD have homology to iron transport proteins that are repressed in iron-replete conditions, we measured regulation of S. flexneri sitA by iron. S. flexneri containing pEG2 was grown in L broth containing increasing levels of the iron chelator EDDA. gfp expression controlled by the sitA promoter increased as the concentration of the iron chelator increased (Fig. 5). At the concentrations used in this experiment, EDDA should specifically chelate ferric iron (29). The addition of FeCl3 to L broth containing EDDA repressed expression of sitA-gfp in S. flexneri to levels similar to those in L broth cultures without EDDA (Fig. 6), confirming that EDDA was reducing iron availability. These data are consistent with iron-mediated repression of the S. flexneri sitA promoter.
|
|
The S. enterica serovar Typhimurium sit genes are repressed by manganese, and the sit promoter has a putative binding site for the manganese-responsive MntR repressor (21). The Y. pestis yfe operon, which is homologous to the sit operon, also has been shown elsewhere to be repressed by Mn2+ (3). Because the S. flexneri sit promoter contains a putative MntR binding site (Fig. 1A), we tested whether MnCl2 would repress expression of the S. flexneri sit operon in the Fur deletion mutant. This genetic background was chosen to eliminate possible repression due to Mn2+ binding to Fur, which may allow Fur-dependent repression (13). gfp expression driven by the sitA promoter decreased to basal levels in the fur mutant, as well as in the parent strain, when MnCl2 was added to the cultures (Fig. 6), consistent with Fur-independent manganese repression.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Several lines of evidence suggest that the Shigella Sit system mediates iron acquisition. First, although the sitA mutation alone showed no defect in plaque formation, a sitA mutation in combination with other iron acquisition mutations showed additive effects in plaque assays. Second, addition of iron to L broth containing EDDA eliminated growth differences between the sit mutant and the parent strain in L broth containing EDDA. Finally, both the S. flexneri and the S. dysenteriae sitABCD genes (42) restored growth to an E. coli enterobactin synthesis mutant in iron-restricted media. Likewise, both the S. enterica serovar Typhimurium sit and Y. pestis yfe operons complemented growth defects of enterobactin-deficient E. coli in iron-restricted media (3, 56).
The importance of iron transport when S. flexneri is in the eukaryotic cytoplasm is supported by the study by Reeves et al. (43) that showed that an S. dysenteriae tonB mutant, which eliminates all high-affinity iron transport, was defective in intracellular growth in Henle cells. The S. flexneri triple mutant SM193 was unable to form plaques on Henle cells and is defective in iron acquisition via the aerobactin, Feo, and Sit systems. The aerobactin system is TonB dependent (37), but the FeoB system is TonB independent (19). The TonB dependency of the Sit system is unclear, since the mechanism for entry of its ligands into the periplasm in S. flexneri has not been identified.
In the eukaryotic cell, free iron is not abundant, since iron, unless tightly complexed, can catalyze formation of toxic hydroxyl radicals. Thus, iron is bound in ferritin, heme proteins, and other proteins. The iron sources used by some intracellular pathogens have been identified. Based on the observation that apolactoferrin and lactoferrin saturated with either manganese or zinc inhibit growth of Legionella pneumophila, this bacterium is predicted to use lactoferrin as an intracellular iron source while in the phagosome (11). The Feo system is also important for L. pneumophila intracellular growth, since a feoB mutant shows decreased replication in amoebae and human U937 cell macrophages (44). Additionally, a mutation in an L. pneumophila gene with homology to the aerobactin synthetase genes iucA and iucC impairs intracellular growth (15), suggesting that siderophore is important. Likewise, the Brucella abortus siderophore dihydroxybenzoic acid enhances intracellular survival of the bacteria in murine macrophages (39). Transferrin may be a source of iron for the obligate intracellular pathogens Chlamydia pneumoniae (1) and Mycobacterium tuberculosis (8). Finally, intracellular replication of Neisseria meningitidis requires TonB-dependent acquisition of an unidentified iron source, which was shown previously not to be transferrin, lactoferrin, or hemoglobin (26).
It has been difficult to assess the intracellular iron sources for Shigella species since they have numerous iron acquisition systems for multiple iron sources, and single mutations in genes encoding these systems have had no effect on intracellular growth (27, 36, 43). Elimination of one Shigella iron acquisition system may be compensated for by increased uptake of iron through another system. However, mutations in more than one iron acquisition system decreased the ability of S. flexneri to form plaques on Henle cell monolayers (Fig. 4). This may indicate that more than one iron transport system can access the same intracellular iron source, or there may be several iron sources in the Henle cell cytosol available to Shigella. The fact that the S. flexneri iucD feoB double mutant forms smaller plaques than do the parental strains suggests that both ferric and ferrous iron sources are available in the cell. It is not known whether the iron ligand for S. flexneri SitA is ferric or ferrous iron.
Although all of the S. flexneri strains carrying mutations in more than one iron transport system formed smaller plaques on Henle cell monolayers, there are examples in other Shigella spp. where elimination of two iron acquisition systems does not affect plaque formation. For example, an S. dysenteriae mutant defective in both heme and siderophore iron uptake formed wild-type plaques (43). In the case of the heme receptor, it is possible that, although there is heme in the eukaryotic cell, it may not be accessible to the pathogen. This is true for Neisseria gonorrhoeae heme synthesis mutants, which are defective in intracellular growth (53).
Expression of the S. flexneri sit operon is regulated in response to multiple signals. Expression of sit is repressed by manganese (Fig. 6), likely via the manganese-responsive repressor MntR. The sit promoter has a region homologous to the MntR binding site (21). As expected for an iron acquisition system, the sit genes are repressed in iron-replete media. A significant portion of this regulation can be attributed to Fur, since the repression is abolished in a Fur mutant (Fig. 6). The regulation of sit expression also has a Fur-independent component, since sit expression increases in a Fur mutant upon iron depletion of the culture. This would not be expected if Fur were the sole effector of iron-mediated repression. The Fur-independent effects may result from iron binding to MntR, albeit with lower affinity than manganese, and thus causing iron-mediated repression in the absence of Fur. Kehres et al. (21) suggested this type of regulation for the mntH promoter, which is repressed primarily by iron via Fur and by manganese via MntR. Alternatively, an unidentified regulator may mediate Fur-independent iron regulation.
sit expression increases in the eukaryotic intracellular environment (47). This induction may simply be a reflection of a possible low iron and manganese concentration in the eukaryotic cytoplasm. Other S. flexneri Fur-regulated, iron-repressed genes show increased expression in Henle cells, including fhuA and sufA (47). However, since the S. dysenteriae shuA and the S. flexneri iuc promoters, which are also Fur regulated, were not induced when the bacteria were in Henle cells (14, 43), it is possible that repression of different promoters may be sensitive to different levels of iron. Alternatively, increased expression of S. flexneri sitA in the eukaryotic cytoplasm may be in response to additional unknown signals. Another signal that we have examined for potentially regulating sitA expression is oxidative stress, but we found that sitA expression is not significantly affected by hydrogen peroxide (data not shown). Like the S. flexneri sitA gene, the Salmonella sitA gene is also expressed in eukaryotic cells (murine hepatocytes) (18). However, while S. flexneri multiplies in the cytoplasm, Salmonella resides in the vacuole of the eukaryotic cell, and so the signals may be slightly different.
The S. enterica serovar Typhimurium sit genes are on the SPI1 pathogenicity island (18, 56). Pathogenicity islands are characterized by features including: presence in pathogenic but not nonpathogenic isolates; presence of mobile elements, integrases, insertion sequence elements, and phage genes; association with a tRNA gene; and acquisition via horizontal transfer. Among strains of the related genera Escherichia and Shigella, the sit operon was found exclusively in enteroinvasive strains, which replicate inside host cells. The S. flexneri sit operon is flanked by phage genes: part of a RAC prophage integrase gene is located upstream of the sit operon. Two ORFs with homology to P27 phage genes are located downstream of the sit operon. Furthermore, the regions upstream of sit operons are different in S. flexneri and S. dysenteriae, suggesting a difference in composition or location of the islands. Thus, in Shigella, the sit genes also appear to be in pathogenicity islands. The acquisition and maintenance of the sit genes by pathogens that invade eukaryotic cells suggest a possible role for the sit genes in growth in the intracellular environment. Salmonella sit mutants are slightly attenuated for virulence (18), and in Y. pestis yfe mutants are significantly attenuated for intravenous infection (2). Although the S. flexneri sitA mutant was defective in plaque formation only when other iron transport systems were eliminated, it is possible that the Sit system may be important in other stages of the natural infection process.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant AI16935 awarded to S. M. Payne and grant AI09918 awarded to L. Runyen-Janecky.
|
FOOTNOTES |
|---|
Present address: Department of Biology, University of Richmond, Richmond, VA 23173.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
| 1. | Al-Younes, H. M., T. Rudel, V. Brinkmann, A. J. Szczepek, and T. F. Meyer. 2001. Low iron availability modulates the course of Chlamydia pneumoniae infection. Cell. Microbiol. 3:427-437.[CrossRef][Medline] |
| 2. | Bearden, S. W., and R. D. Perry. 1999. The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague. Mol. Microbiol. 32:403-414.[CrossRef][Medline] |
| 3. | Bearden, S. W., T. M. Staggs, and R. D. Perry. 1998. An ABC transporter system of Yersinia pestis allows utilization of chelated iron by Escherichia coli SAB11. J. Bacteriol. 180:1135-1147. |
| 4. | Clarke, T. E., L. W. Tari, and H. J. Vogel. 2001. Structural biology of bacterial iron uptake systems. Curr. Top. Med. Chem. 1:7-30.[CrossRef][Medline] |
| 5. | Coulton, J. W., P. Mason, and M. S. DuBow. 1983. Molecular cloning of the ferrichrome-iron receptor of Escherichia coli K-12. J. Bacteriol. 156:1315-1321. |
| 6. | Daskaleros, P. A., and S. M. Payne. 1987. Congo red binding phenotype is associated with hemin binding and increased infectivity of Shigella flexneri in the HeLa cell model. Infect. Immun. 55:1393-1398. |
| 7. | Daskaleros, P. A., J. A. Stoebner, and S. M. Payne. 1991. Iron uptake in Plesiomonas shigelloides: cloning of the genes involved in the heme-iron uptake system. Infect. Immun. 59:2706-2711. |
| 8. | Douvas, G. S., M. H. May, and A. J. Crowle. 1993. Transferrin, iron, and serum lipids enhance or inhibit Mycobacterium avium replication in human macrophages. J. Infect. Dis. 167:857-864.[Medline] |
| 9. | Escolar, L., J. Perez-Martin, and V. de Lorenzo. 1999. Opening the iron box: transcriptional metalloregulation by the Fur protein. J. Bacteriol. 181:6223-6229. |
| 10. | Friedman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and F. Ausubel. 1982. Construction of a broad host range cosmid cloning vector and its uses in the genetic analysis of Rhizobium meliloti. Gene 18:289-296.[CrossRef][Medline] |
| 11. | Goldoni, P., L. Sinibaldi, P. Valenti, and N. Orsi. 2000. Metal complexes of lactoferrin and their effect on the intracellular multiplication of Legionella pneumophila. Biometals 13:15-22.[CrossRef][Medline] |
| 12. | Hale, T. L. 1991. Genetic basis of virulence in Shigella species. Microbiol. Rev. 55:206-224. |
| 13. | Hamed, M. Y. 1993. Binding of the ferric uptake regulation repressor protein (Fur) to Mn(II), Fe(II), Co(II), and Cu(II) ions as co-repressors: electronic absorption, equilibrium, and 57Fe Mossbauer studies. J. Inorg. Biochem. 50:193-210.[CrossRef][Medline] |
| 14. | Headley, V., M. Hong, M. Galko, and S. M. Payne. 1997. Expression of aerobactin genes by Shigella flexneri during extracellular and intracellular growth. Infect. Immun. 65:818-821.[Abstract] |
| 15. | Hickey, E. K., and N. P. Cianciotto. 1997. An iron- and Fur-repressed Legionella pneumophila gene that promotes intracellular infection and encodes a protein with similarity to the Escherichia coli aerobactin synthetases. Infect. Immun. 65:133-143.[Abstract] |
| 16. | Hong, M., Y. Gleason, E. E. Wyckoff, and S. M. Payne. 1998. Identification of two Shigella flexneri chromosomal loci involved in intercellular spreading. Infect. Immun. 66:4700-4710. |
| 17. | Hong, M., and S. M. Payne. 1997. Effect of mutations in Shigella flexneri chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and serum resistance. Mol. Microbiol. 24:779-791.[CrossRef][Medline] |
| 18. | Janakiraman, A., and J. M. Slauch. 2000. The putative iron transport system SitABCD encoded on SPI1 is required for full virulence of Salmonella typhimurium. Mol. Microbiol. 35:1146-1155.[CrossRef][Medline] |
| 19. | Kammler, M., C. Schon, and K. Hantke. 1993. Characterization of the ferrous iron uptake system of Escherichia coli. J. Bacteriol. 175:6212-6219. |
| 20. | Karberg, M., H. Guo, J. Zhong, R. Coon, J. Perutka, and A. M. Lambowitz. 2001. Group II introns as controllable gene targeting vectors for genetic manipulation of bacteria. Nat. Biotechnol. 19:1162-1167.[CrossRef][Medline] |
| 21. | Kehres, D. G., A. Janakiraman, J. M. Slauch, and M. E. Maguire. 2002. Regulation of Salmonella enterica serovar Typhimurium mntH transcription by H2O2, Fe2+, and Mn2+. J. Bacteriol. 184:3151-3158. |
| 22. | Kehres, D. G., A. Janakiraman, J. M. Slauch, and M. E. Maguire. 2002. SitABCD is the alkaline Mn2+ transporter of Salmonella enterica serovar Typhimurium. J. Bacteriol. 184:3159-3166. |
| 23. | Kehres, D. G., M. L. Zaharik, B. B. Finlay, and M. E. Maguire. 2000. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol. Microbiol. 36:1085-1100.[CrossRef][Medline] |
| 24. | Kennedy, C. 1971. Induction of colicin production by high temperature or inhibition of protein synthesis. J. Bacteriol. 108:10-19. |
| 25. | Koster, W., and V. Braun. 1990. Iron (III) hydroxamate transport into Escherichia coli. Substrate binding to the periplasmic FhuD protein. J. Biol. Chem. 265:21407-21410. |
| 26. | Larson, J. A., D. L. Higashi, I. Stojiljkovic, and M. So. 2002. Replication of Neisseria meningitidis within epithelial cells requires TonB-dependent acquisition of host cell iron. Infect. Immun. 70:1461-1467. |
| 27. | Lawlor, K. M., P. A. Daskaleros, R. E. Robinson, and S. M. Payne. 1987. Virulence of iron transport mutants of Shigella flexneri and utilization of host iron compounds. Infect. Immun. 55:594-599. |
| 28. | Lawlor, K. M., and S. M. Payne. 1984. Aerobactin genes in Shigella spp. J. Bacteriol. 160:266-272. |
| 29. | L'Eplattenier, F. L., I. Murase, and A. E. Martell. 1967. New multidentate ligands: VI. Chelating tendencies of N,N'-di(2-hydroxybenzyl) ethylene-N,N'-diacetic acid. J. Am. Chem. Soc. 89:837-843.[CrossRef] |
| 30. | Makui, H., E. Roig, S. T. Cole, J. D. Helmann, P. Gros, and M. F. Cellier. 2000. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol. Microbiol. 35:1065-1078.[CrossRef][Medline] |
| 31. | Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3:208-218. |
| 32. | Marolda, C. L., M. A. Valvano, K. M. Lawlor, S. M. Payne, and J. H. Crosa. 1987. Flanking and internal regions of chromosomal genes mediating aerobactin iron uptake systems in enteroinvasive Escherichia coli and Shigella flexneri. J. Gen. Microbiol. 133:2269-2278.[Medline] |
| 33. | Menard, R., C. Dehio, and P. J. Sansonetti. 1996. Bacterial entry into epithelial cells: the paradigm of Shigella. Trends Microbiol. 4:220-226.[CrossRef][Medline] |
| 34. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 35. | Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583. |
| 36. | Mills, M., and S. M. Payne. 1997. Identification of shuA, the gene encoding the heme receptor of Shigella dysenteriae, and analysis of invasion and intracellular multiplication of a shuA mutant. Infect. Immun. 65:5358-5363.[Abstract] |
| 37. | Moeck, G. S., and J. W. Coulton. 1998. TonB-dependent iron acquisition: mechanisms of siderophore-mediated active transport. Mol. Microbiol. 28:675-681.[CrossRef][Medline] |
| 38. | Oaks, E. V., M. E. Wingfield, and S. B. Formal. 1985. Plaque formation by virulent Shigella flexneri. Infect. Immun. 48:124-129. |
| 39. | Parent, M. A., B. H. Bellaire, E. A. Murphy, R. M. Roop II, P. H. Elzer, and C. L. Baldwin. 2002. Brucella abortus siderophore 2,3-dihydroxybenzoic acid (DHBA) facilitates intracellular survival of the bacteria. Microb. Pathog. 32:239-248.[CrossRef][Medline] |
| 40. | Payne, S. M. 1980. Synthesis and utilization of siderophores by Shigella flexneri. J. Bacteriol. 143:1420-1424. |
| 41. | Payne, S. M., D. W. Niesel, S. S. Peixotto, and K. M. Lawlor. 1983. Expression of hydroxamate and phenolate siderophores by Shigella flexneri. J. Bacteriol. 155:949-955. |
| 42. | Reeves, S. A. 2001. Iron acquisition in the intracellular environment of the host: multiple iron transport systems in Shigella dysenteriae. Ph.D. dissertation. University of Texas, Austin. |
| 43. | Reeves, S. A., A. G. Torres, and S. M. Payne. 2000. TonB is required for intracellular growth and virulence of Shigella dysenteriae. Infect. Immun. 68:6329-6336. |
| 44. | Robey, M., and N. P. Cianciotto. 2002. Legionella pneumophila feoAB promotes ferrous iron uptake and intracellular infection. Infect. Immun. 70:5659-5669. |
| 45. | Rogers, H. J. 1973. Iron-binding catechols and virulence in Escherichia coli. Infect. Immun. 7:438-444. |
| 46. | Runyen-Janecky, L. J., M. Hong, and S. M. Payne. 1999. The virulence plasmid-encoded impCAB operon enhances survival and induced mutagenesis in Shigella flexneri after exposure to UV radiation. Infect. Immun. 67:1415-1423. |
| 47. | Runyen-Janecky, L. J., and S. M. Payne. 2002. Identification of chromosomal Shigella flexneri genes induced by the eukaryotic intracellular environment. Infect. Immun. 70:4379-4388. |
| 48. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 49. | Sansonetti, P. J. 1992. Molecular and cellular biology of Shigella flexneri invasiveness: from cell assay systems to shigellosis. Curr. Top. Microbiol. Immunol. 180:1-19.[Medline] |
| 50. | Schmitt, M. P., and S. M. Payne. 1991. Genetic analysis of the enterobactin gene cluster in Shigella flexneri. J. Bacteriol. 173:816-825. |
| 51. | Schmitt, M. P., and S. M. Payne. 1988. Genetics and regulation of enterobactin genes in Shigella flexneri. J. Bacteriol. 170:5579-5587. |
| 52. | Taylor, R. K., C. Manoil, and J. J. Mekalanos. 1989. Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of Vibrio cholerae. J. Bacteriol. 171:1870-1878. |
| 53. | Turner, P. C., C. E. Thomas, C. Elkins, S. Clary, and P. F. Sparling. 1998. Neisseria gonorrhoeae heme biosynthetic mutants utilize heme and hemoglobin as a heme source but fail to grow within epithelial cells. Infect. Immun. 66:5215-5223. |
| 54. | Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199.[CrossRef][Medline] |
| 55. | Zhong, J., M. Karberg, and A. M. Lambowitz. Targeted and random bacterial gene disruption using a group III intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucl. Acids Res., in press. |
| 56. | Zhou, D., W. D. Hardt, and J. E. Galan. 1999. Salmonella typhimurium encodes a putative iron transport system within the centisome 63 pathogenicity island. Infect. Immun. 67:1974-1981. |
This article has been cited by other articles:
| ||||||||||||||
