IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Runyen-Janecky, L. J.
Right arrow Articles by Payne, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Runyen-Janecky, L. J.
Right arrow Articles by Payne, S. M.

 Previous Article  |  Next Article 

Infection and Immunity, April 2003, p. 1919-1928, Vol. 71, No. 4
0019-9567/03/$08.00+0     DOI: 10.1128/IAI.71.4.1919-1928.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Contribution of the Shigella flexneri Sit, Iuc, and Feo Iron Acquisition Systems to Iron Acquisition In Vitro and in Cultured Cells

L. J. Runyen-Janecky,{dagger} S. A. Reeves, E. G. Gonzales, and S. M. Payne*

Section for Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, Texas 78712-0162

Received 9 September 2002/ Returned for modification 24 October 2002/ Accepted 9 January 2003


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Shigella flexneri possesses multiple iron acquisition systems, including proteins involved in the synthesis and uptake of siderophores and the Feo system for ferrous iron utilization. We identified an additional S. flexneri putative iron transport gene, sitA, in a screen for S. flexneri genes that are induced in the eukaryotic intracellular environment. sitA was present in all Shigella species and in most enteroinvasive Escherichia coli strains but not in any other E. coli isolates tested. The sit locus consists of four genes encoding a potential ABC transport system. The deduced amino acid sequence of the S. flexneri sit locus was homologous to the Salmonella enterica serovar Typhimurium Sit and Yersinia pestis Yfe systems, which mediate both manganese and iron transport. The S. flexneri sit promoter was repressed by either iron or manganese, and the iron repression was partially dependent upon Fur. A sitA::cam mutation was constructed in S. flexneri. The sitA mutant showed reduced growth, relative to the wild type, in Luria broth containing an iron chelator but formed wild-type plaques on Henle cell monolayers, indicating that the sitA mutant was able to acquire iron and/or manganese in the host cell. However, mutants defective in two of these iron acquisition systems (sitA iucD, sitA feoB, and feoB iucD) formed slightly smaller plaques on Henle cell monolayers. A strain carrying mutations in sitA, feoB, and iucD did not form plaques on Henle cell monolayers.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Shigella flexneri, a facultative intracellular bacterium that causes bacterial dysentery in humans, requires iron for growth (12, 33, 49). This pathogen encounters a wide range of environmental conditions throughout its life cycle, which includes exposure to the external environment, transit through the human gastrointestinal tract, and growth within colonic epithelial cells. In each of these environments, iron availability is limited and the potential sources of iron vary. In aerobic external environments, iron is present in the ferric (Fe3+) form, mainly as insoluble iron hydroxide complexes. In the human host, extracellular iron is sequestered in high-affinity iron binding proteins such as lactoferrin, while the iron in the intracellular environment is in heme, ferritin, and other iron-containing proteins.

Shigellae possess numerous systems for iron acquisition. They synthesize and secrete low-molecular-weight, high-affinity ferric iron chelators called siderophores that can either solubilize ferric iron from insoluble complexes or remove iron from some binding proteins and deliver the iron to the bacterial cell. Shigella isolates synthesize and use the hydroxamate siderophore aerobactin or the catechol siderophore enterobactin (40, 41). Additionally, shigellae can use the fungal siderophore ferrichrome (40). There are specific receptors in the bacterial outer membrane that bind each ferrisiderophore or other iron complexes with high affinity. In Shigella, these receptors include IutA for aerobactin (28), FepA for enterobactin (41, 50), and the heme receptor ShuA (36). The receptor for ferrichrome is likely to be the Shigella homologue of the Escherichia coli FhuA receptor (5, 47). Transport of these iron-containing ligands through the outer membrane receptors and into the periplasm is an energy-dependent process which requires the TonB-ExbBD system (37).

Periplasmic binding protein-dependent ABC transport systems transport periplasmic iron complexes into the cytoplasm (4). Each system consists of a periplasmic ligand-binding protein, two cytoplasmic membrane permeases, and two subunits of a peripheral cytoplasmic membrane protein with ATP binding motifs. The transported iron ligand binds to the periplasmic binding protein and is transferred to cytoplasmic membrane permeases. Transport through the cytoplasmic membrane requires ATP hydrolysis by the associated ATPase. Unlike the outer membrane receptors, transport through this system is less ligand specific. For example, both ferriferrichrome and ferriaerobactin are transported though the FhuBCD system (25).

Preliminary analysis of the S. flexneri genome shows that, in addition to genes encoding high-affinity ferric transport systems, S. flexneri has feoAB, which are homologous to E. coli feoAB (F. R. Blattner, unpublished observations). E. coli FeoB, a large cytoplasmic membrane protein with homology to ATPases, mediates ferrous iron uptake (19). However, it is not known whether the 9-kDa FeoA protein is expressed or what role it plays in ferrous iron transport. Unlike ferric iron, which is poorly soluble, ferrous iron is relatively soluble but is primarily found under anaerobic conditions or at nonphysiological pH.

We recently identified another putative iron transport gene, sitA, in a screen for S. flexneri genes that are induced in the intracellular environment (47). S. flexneri SitA is homologous to Salmonella enterica serovar Typhimurium SitA, which is encoded in a four-member operon that mediates manganese and iron transport (18, 22, 56). In S. enterica serovar Typhimurium, sitA expression is repressed in the presence of either iron or manganese (56). The iron repression is mediated by the global transcriptional regulator Fur (56). When bound to ferrous iron, Fur binds to Fur boxes in iron-regulated promoters, thereby repressing transcription (9, 51). The S. enterica serovar Typhimurium sitA promoter also has a putative MntR binding site, and thus the manganese repression of sitA has been proposed elsewhere to be mediated by the manganese-binding transcriptional regulator MntR (21, 22). This report describes the characterization of the S. flexneri sit operon and the role of the Sit system and other iron acquisition systems in the ability of S. flexneri to productively infect eukaryotic cells.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial strains, plasmids, and growth conditions. Bacterial strains and plasmids used in this work are listed in Table 1. E. coli strains were routinely grown in Luria broth (L broth) or Luria agar (L agar). Minimal medium was Tris-buffered T medium without added iron (47). S. flexneri strains were grown in L broth or on tryptic soy broth agar plus 0.01% Congo red dye at 37°C. Ethylene diamino-o-dihydroxyphenyl acetic acid (EDDA) was deferrated (45) and added to the medium to chelate available iron. Antibiotics were used at the following concentrations (per milliliter): 125 µg of carbenicillin, 25 µg of kanamycin, 15 µg of chloramphenicol, 25 µg of trimethoprim, and 200 µg of streptomycin.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids

 
Recombinant DNA and PCR methods. Plasmids were isolated with the QIAprep Spin Miniprep kit (Qiagen, Santa Clarita, Calif.). Isolation of DNA fragments from agarose gels was performed with the QIAquick gel extraction kit (Qiagen). Chromosomal DNA was isolated by the method of Marmur (31).

All PCRs were carried out with either Taq (Qiagen) or Pfu (Stratagene Cloning Systems, La Jolla, Calif.) polymerase according to the manufacturer's instructions. Taq was used for all PCRs unless the fragments were to be cloned or sequenced, in which case Pfu was used. Primers for detection of the sitA gene were sit3 (5'ATGCTCTTGGGGTGCTTGGC3') and sit4 (5'TTCCAGATTCATACCATTGGCG3'). Other primers for individual PCRs are listed in the appropriate sections below.

Sequence analysis of the S. flexneri sitA operon. The nucleotide sequence of part of a Shigella dysenteriae O-4576 cosmid that contained the sit locus (pSIT1) had previously been determined (42). Based on this sequence, PCR primers were designed to amplify the sit locus from S. flexneri SA100 in five overlapping fragments. These primers were SA100.1 (CATGAACGACGAACAGATAGC) and SA100.2 (GCTTGGTTATGGATGAGACTT), SA100.3 (TCGCATTTCAGGCAAGTGC) and SA100.4 (ATCTTTCCGCTGGTCAGACG), SA100.5 (TGGTTGGGGTAACGGTTC) and SA100.6 (TAGGACGATGGTCTGAATG), SA100.7 (GGGCTGTTTATGGTGTCATTGAAC) and SA100.8 (AAAGCGTTGTGTCAGGAG), and SA100.9 (CGCTGAAAGCAGTAGGTATC) and SA100.10 (TTTTGACGACAGGGACCAG).

sitA-gfp expression studies. Strains containing gfp were grown in low-salt Luria-Bertani (LB) broth or LB agar, which contains 5 g of NaCl per liter (24). sitA expression was measured by use of the plasmid-borne sitA-gfp fusion pEG2 (47). Bacteria containing pEG2 were grown in LB broth containing 1 to 32 µg of the iron chelator EDDA per ml to late log phase. One milliliter of each culture was pelleted and resuspended in 4% paraformaldehyde for 10 min and then washed twice and resuspended in low-salt phosphate-buffered saline (47). Green fluorescent protein levels were quantified with a FACSCaliber (Becton Dickinson) fluorescence-activated cell sorter with an excitation at 488 nm. FACSCaliber settings were as follows: forward scatter, E01; side scatter, 505; and relative fluorescence between 515 and 545 nm, 798.

Construction of mutations in S. flexneri. The sitA::cam mutant SM166 was constructed by allelic exchange. For construction of the sitA::cam plasmid, the sitA gene was amplified from SA514 chromosomal DNA with primers sitABfor (5'CTCTTGAAGCACTGAAGGAG3') and sitABrev (5'CGCACAAATCCCATAATC3') and was cloned into SmaI-digested pWKS30 (54) to generate pLR61. A 1.6-kb fragment containing a chloramphenicol resistance gene (cam) was isolated from pMA9 (17) by digestion with HincII and inserted into the MscI site in sitA. The gene with the cam resistance cassette was excised as a EcoRV-XbaI fragment and ligated into pHM5 digested with EcoRV-XbaI to generate pLR64. Allelic exchange was done in SM100 as described previously (46).

The feoB::dhfr mutant SA190 was constructed by targeting of a group II intron to the feoB gene as described elsewhere (20, 55). Double and triple mutants (Table 1) were constructed by P1 transduction of mutations into various backgrounds (34).

All mutations were confirmed by PCR analysis.

Screening of chromosomal library for sit operon. A cosmid library of S. flexneri chromosomal DNA (K. Lawlor, unpublished data) in E. coli HB101 (48) was screened by colony hybridization for clones that hybridize to the S. flexneri sitA gene. Probe labeling, hybridization, and detection were performed as described for the Genius II system (Boehringer Mannheim). Cosmids that hybridized with the sitA probe were further screened for downstream sit genes by PCR with primers SA100.9 and SA100.10.

Tissue culture cell invasion and plaque assays. Monolayers of Henle cells (intestine 407 cells; American Type Culture Collection, Manassas, Va.) were used in all experiments and were maintained in Henle medium, which consists of minimum essential medium, 10% Tryptose phosphate broth, 2 mM glutamine, minimum essential medium nonessential amino acid solution (Life Technologies, Grand Island, N.Y.), and 10% fetal bovine serum (Life Technologies) in a 5% CO2 atmosphere at 37°C. Plaque assays were done as described previously (38) with the modifications described in the work of Hong et al. (16), and plaques were scored after 3 to 4 days.

Nucleotide sequence accession number. The nucleotide sequence of each fragment was determined by the Molecular Biology Sequencing Facility at the University of Texas at Austin and was submitted to the GenBank database under the accession number AY126440.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sequencing the sit operon from S. flexneri SA100. The S. flexneri sitA gene was previously identified in a screen for Shigella genes that were induced in the eukaryotic cytoplasm (47). The nucleotide sequence of the S. flexneri SA100 sit operon and flanking regions was determined and was used to search the National Center for Biotechnology Information nonredundant database for similarities. A map of this region is shown in Fig. 1A. The DNA sequence revealed four closely spaced open reading frames (ORFs) that encode proteins homologous to several periplasmic binding protein-dependent ABC transport systems, including the SitABCD system of S. enterica serovar Typhimurium (18, 56) and the YfeABCD system of Yersinia pestis (3) (Table 2). Based on homologies to the S. enterica serovar Typhimurium Sit and Y. pestis Yfe systems, S. flexneri SitA is predicted to be a periplasmic binding protein. The second ORF, SitB, is predicted to be an ATP binding protein and contains the canonical Walker boxes. SitC and SitD are predicted to be inner membrane permeases based on putative membrane-spanning domains and their homologies with the S. enterica serovar Typhimurium SitCD and Y. pestis YfeCD inner membrane permeases (2, 3, 18, 22, 56). All four ORFs are predicted to be in one operon since there is no significant space between the ORFs.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. Map of the S. flexneri sit and feo loci. The ORFs of the sit (A) and feo (B) loci are indicated above the representative arrows. The nucleotide sequence of the putative sitA promoter is shown. The putative Fur and MntR binding sites are boxed and underlined, respectively, and the SitA start codon is in boldface.

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Selected homologies of S. flexneri SitABCD to other proteins

 
The S. enterica serovar Typhimurium sit genes are located within the SPI1 pathogenicity island (18, 56). The S. flexneri genes also appear to be in a pathogenicity island, but the S. flexneri island has no homology with the Salmonella island other than sit genes. We determined the DNA sequence of the regions flanking the sit genes in S. flexneri and found that a region upstream of sit is 97% identical to the 3' end of an integrase gene (intR) from a cryptic RAC prophage. This prophage is located at 31 min on the E. coli K-12 chromosome (Fig. 1A). Analysis of the sequence of the S. flexneri chromosome shows that the RAC prophage is deleted in the S. flexneri chromosome and that the sit genes are not located in the region where the prophage is found in E. coli (Blattner, unpublished). The nucleotide sequence downstream of the S. flexneri sit operon is 85% identical to the 3' end of P27 phage (Fig. 1A).

The sit genes and downstream P27-like phage genes were also found in S. dysenteriae (42). The 300-bp region immediately 5' to the sit genes is almost identical in S. flexneri and S. dysenteriae but shows no homology with any other nucleotide sequences in the nonredundant database (data not shown). However, the nucleotide sequences further upstream of the sit genes in these Shigella species differ: the S. flexneri sequence is homologous to the intR integrase in the E. coli K-12 chromosome, while the S. dysenteriae sequence is homologous to a region containing ompN and ynaF in the E. coli K-12 chromosome. The presence of phage-like elements near the sit genes and the difference in the sequences flanking the sit genes in S. flexneri and S. dysenteriae are consistent with the Shigella sit genes being present on a pathogenicity island-like element and with the S. flexneri and S. dysenteriae sit genes having been acquired independently.

Presence of the sit locus in other Shigella and E. coli isolates. To determine the phylogenetic distribution of the sit locus among other Shigella and pathogenic E. coli isolates, we did PCR analysis with primers within the sitA gene (Table 3). sitA was present in all of the tested isolates of Shigella, which represented all the Shigella species. Because the E. coli and S. flexneri chromosomes are highly similar, numerous E. coli isolates were also tested for the presence of the sitA gene. Six of seven enteroinvasive isolates tested contained the sitA gene (Table 3). However, none of the enteropathogenic, enterohemorrhagic, uropathogenic, or meningitis-causing E. coli isolates tested had sitA, nor did E. coli W3110 or DH5{alpha}, two nonpathogenic E. coli K-12 strains (Table 3). The presence of the sitA gene in enteroinvasive enteric pathogens, but not in other pathogenic and nonpathogenic E. coli strains, suggests that SitA may contribute to growth in the intracellular environment.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Distribution of sitA in Shigella spp. and pathogenic E. coli strains

 
The sit genes promote growth of an iron transport mutant. To determine whether the sit genes could promote growth of an iron transport mutant, the sit loci from S. dysenteriae and S. flexneri were transferred into E. coli 1017, an ent mutant defective in the synthesis of enterobactin. This strain grows at the same rate as the wild type in media containing high levels of iron, but its growth is inhibited in the presence of the iron chelator EDDA. E. coli 1017 strains carrying the S. flexneri sit genes (pEG1), the S. dysenteriae sit genes (pSIT1), or the cloning vector alone (pLAFR1) were compared for growth in L broth containing increasing amounts of EDDA. E. coli 1017/pLAFR1 was inhibited by relatively low amounts of the chelator (MIC, 6.25 µg of EDDA/ml). The inhibition was reversed by addition of equimolar amounts of iron (data not shown). The presence of either sit clone allowed the ent mutant to grow at much higher concentrations of the chelator; the MIC of EDDA for either 1017/pEG1 or 1017/pSIT1 was 200 µg/ml. The ability of the sit genes to promote the growth of an iron transport mutant in low-iron medium suggests that sit genes encode a functional iron uptake system.

The sit genes were also tested for growth promotion of 1017 in Tris-buffered minimal medium without added iron. The ent mutant failed to grow in this medium, and the presence of the sit genes had no effect. The addition of small amounts of iron (0.5 to 1 µM) allowed growth of all three strains (data not shown). It is likely that low-affinity iron transport systems present in 1017 are as efficient as the sit genes in promoting growth in medium with minimal iron levels, but the sit genes provide an advantage in iron acquisition in the presence of an exogenous iron chelator.

Effect of sitA, iucD, and feoB mutations on growth of S. flexneri in media containing EDDA. To further determine whether SitA enhanced growth in iron-depleted media, we constructed a sitA mutant, SM166, in which the wild-type sitA allele was disrupted with the cam gene. Growth of the sitA mutant in L broth containing >125 µg of EDDA/ml was decreased relative to the wild type after 8 h (Fig. 2A). There was no difference in optical density between the wild type and the sitA mutant after 24 h of growth or in cultures grown with EDDA concentrations of <125 µg/ml (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 2. The S. flexneri sitA mutants have slightly reduced growth in L broth plus EDDA. Overnight cultures of each strain were subcultured 1:1,000 into L broth containing 250 µg of EDDA/ml (A) or without EDDA (B) and grown at 37°C. The optical densities of the cultures were measured after 8 h. The data presented are the means of three experiments, and the standard deviations of the means are indicated. The presence of mutations in sitA, iucD, and feoB or the wild-type allele is indicated by - or +, respectively.

 
We also examined the growth defect conferred by the sitA::cam mutation in S. flexneri strains containing mutations in other iron transport systems. S. flexneri expresses the aerobactin siderophore synthesis and uptake system (IucABCD and IutA) (28). We also identified the feoAB genes, which encode a ferrous iron transport system homologous to the E. coli Feo system, in isolates from all four Shigella species (data not shown and Fig. 1B). S. flexneri mutants defective in either FeoB or IucD grew less well than the parent, but better than the sitA mutant, after 8 h of growth in L broth containing >125 µg of EDDA/ml (Fig. 2A). Double mutants that had the sitA mutation in combination with another iron acquisition mutation grew similarly to the single sitA mutant, probably because the growth rate was already very low in the sitA background (Fig. 2A). With the exception of the strains containing both feoB and iucD mutations, all strains grew to similar optical densities in L broth not containing EDDA (Fig. 2B). The reason for the poor growth in vitro of the feoB iucD double mutant is not known. The addition of relatively high levels of exogenous iron (40 µM FeSO4) partially restored growth, but growth at wild-type levels was observed only when aerobactin was added to the medium (data not shown). Since aerobactin is not known to transport anything other than iron, there is no obvious reason for the failure of added iron to compensate for the mutations.

Because the S. enterica serovar Typhimurium Sit and the Y. pestis Yfe systems transport both iron and manganese, the S. flexneri sit mutant could have reduced capacity to acquire manganese as well as iron. EDDA has a much higher affinity for iron than for manganese (29), but it is possible that manganese was also chelated at the EDDA concentrations used in the growth experiments. To determine whether the decreased growth of the sitA mutant in the presence of EDDA was due to depletion of iron or manganese, each of the metals was added to the broth cultures containing EDDA (Fig. 3). Addition of FeCl3 to the cultures stimulated the growth of the sitA mutant to wild-type levels, and growth of both the wild-type and mutant strains was comparable to that in cultures without EDDA (Fig. 3). Addition of manganese also abolished the difference in growth between the wild type and the mutant, although growth was not restored to the levels without EDDA (Fig. 3). This suggests that both the parent and the mutant are iron starved. Further, the sitA mutant may also be slightly starved for manganese, since the addition of manganese restores the sitA mutant's growth to the level of the parent.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. Addition of either iron or manganese restores sitA mutant growth to parental levels in L broth containing EDDA. Overnight cultures of each strain were subcultured 1:1,000 (approximately 106 bacteria/ml) into L broth, L broth containing 125 µg of EDDA/ml (350 µM), L broth containing 125 µg of EDDA/ml and 350 µM ferric chloride (Fe), or L broth containing 125 µg of EDDA/ml and 350 µM manganese chloride (Mn). After 8 h of growth at 37°C, the number of bacteria per milliliter of cultures was determined by viable plate counts. The data presented are the means of three experiments, and the standard deviations of the means are indicated.

 
Effect of iron transport mutations on plaque formation in Henle cells. Expression of S. flexneri sitA was induced in the eukaryotic intracellular environment (47), suggesting that SitA may be required for survival or growth in this environment. Therefore, we tested the S. flexneri sitA mutant for growth in the Henle cell intracellular environment by examining its ability to form plaques on a Henle cell monolayer. The sitA mutant SM166 formed plaques of the same number and size as those of the parental strain SM100 (Fig. 4), indicating that either SitA function is not required for growth in the eukaryotic cell or another system, e.g., the aerobactin (Iuc) or ferrous (Feo) iron transport system, can compensate for the lack of SitA. Like the sitA mutant, the single mutants with mutations in iucD (SA240) and feoB (SA190) formed plaques of the same number and size as those of the wild-type strain SM100 (Fig. 4). To determine whether the presence of one or more of these iron transport systems compensates for the loss of a single system, we assessed the ability of double mutants to form plaques on Henle cell monolayers. The double mutants with mutations in iucD sitA (SA167), sitA feoB (SM191), and feoB iucD (SA192) formed plaques that were slightly smaller than those of the wild type (Fig. 4), suggesting that the lack of any two of these three iron acquisition systems reduces the efficiency of iron transport into the cell when S. flexneri is in the eukaryotic cytoplasm (Fig. 4).



View larger version (70K):
[in this window]
[in a new window]
 
FIG. 4. S. flexneri iron acquisition mutants in Henle cell plaque assays. Confluent Henle cell monolayers were infected with 104 bacteria per 35-mm-diameter plate, and the plaques were photographed after 3 days. pEG1 and pKLS971 carry the S. flexneri sit and iuc operons, respectively.

 
Because the double mutants had smaller plaques than did the parental strains, the extent of the plaque formation defect in the triple mutant (sitA feoB iucD) was determined. The triple mutant (SM193) was constructed by transducing the iucD mutation into the sitA feoB mutant SM191. The triple mutant grew poorly on solid media, even when supplemented with 40 µM ferrous sulfate. Growth of the triple mutant, like that of the feoB iucD double mutant, was enhanced by addition of aerobactin to the plates, as the iucD mutation affects synthesis of aerobactin but not uptake. The triple mutant SM193 did not form plaques on Henle cell monolayers (Fig. 4), suggesting that the lack of these three iron acquisition systems eliminates the ability of Shigella to acquire iron and grow in the Henle cell. Addition of cosmids encoding either the sit (pEG1) or the iuc (pKLS971) operon to the triple mutant restored the small plaque phenotype formation on Henle cell monolayers that was observed for the double mutants (Fig. 4).

Regulation of the sit operon. Because the S. flexneri sitA gene is induced in the eukaryotic intracellular environment and functions with the Iuc and Feo systems to allow intracellular growth, it was of interest to determine the environmental stimuli that activate sit expression. To approach this issue, we examined the regulation of the S. flexneri sit operon in vitro using the sitA-gfp transcriptional fusion on pEG2. Since SitABCD have homology to iron transport proteins that are repressed in iron-replete conditions, we measured regulation of S. flexneri sitA by iron. S. flexneri containing pEG2 was grown in L broth containing increasing levels of the iron chelator EDDA. gfp expression controlled by the sitA promoter increased as the concentration of the iron chelator increased (Fig. 5). At the concentrations used in this experiment, EDDA should specifically chelate ferric iron (29). The addition of FeCl3 to L broth containing EDDA repressed expression of sitA-gfp in S. flexneri to levels similar to those in L broth cultures without EDDA (Fig. 6), confirming that EDDA was reducing iron availability. These data are consistent with iron-mediated repression of the S. flexneri sitA promoter.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 5. Induction of the sitA promoter in LB broth containing EDDA. SM100 carrying pEG2 (sitA-gfp) was grown in LB broth containing EDDA as indicated, and the fluorescence was quantitated by fluorescence-activated cell sorting after 6 h. Ten thousand bacterial cells were assayed for each experimental condition. The data presented are the means of three experiments, and the standard deviations of the means are indicated.

 


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 6. Induction of the sitA promoter. SA211 (fur::Tn5) or the parent strain SA101 (fur+) carrying pEG2 (sitA-gfp) was grown in LB broth with or without 16 µg of EDDA/ml (45 µM), and the fluorescence was quantitated by fluorescence-activated cell sorting after 5 h. Where indicated, 500 µM ferric chloride (Fe) or 100 µM manganese chloride (Mn) was added to EDDA cultures. Ten thousand bacterial cells were assayed for each experimental condition. The data presented are the means of three experiments, and the standard deviations of the means are indicated.

 
Because the sitA promoter contains a putative binding site for the iron-responsive transcriptional repressor Fur (Fig. 1A), we determined the expression of the sitA-gfp fusion in an S. flexneri Fur mutant (SA211). In iron-replete media, expression of the sitA-gfp fusion was greater in the fur mutant SA211 than in the parent strain SA101 (Fig. 6), suggesting that iron repression of sitA expression is mediated by Fur. However, sitA-gfp expression in the Fur mutant SA211 increased twofold in the presence of the iron chelator EDDA, relative to expression in the strain grown without EDDA (Fig. 6). This is not due to residual Fur activity in the mutant, as this mutation has previously been shown to eliminate iron regulation of a known, Fur-regulated S. flexneri gene (entB) (51). This suggested that there was an additional, unidentified, Fur-independent component of iron regulation of sitA expression. This twofold increase in the presence of EDDA was eliminated by addition of excess FeCl3 to the EDDA-containing cultures, confirming that the regulation was indeed iron mediated.

The S. enterica serovar Typhimurium sit genes are repressed by manganese, and the sit promoter has a putative binding site for the manganese-responsive MntR repressor (21). The Y. pestis yfe operon, which is homologous to the sit operon, also has been shown elsewhere to be repressed by Mn2+ (3). Because the S. flexneri sit promoter contains a putative MntR binding site (Fig. 1A), we tested whether MnCl2 would repress expression of the S. flexneri sit operon in the Fur deletion mutant. This genetic background was chosen to eliminate possible repression due to Mn2+ binding to Fur, which may allow Fur-dependent repression (13). gfp expression driven by the sitA promoter decreased to basal levels in the fur mutant, as well as in the parent strain, when MnCl2 was added to the cultures (Fig. 6), consistent with Fur-independent manganese repression.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Shigella species express numerous iron acquisition systems, reflecting the importance of obtaining iron. The presence of systems for acquisition of different iron sources may also reflect the multiple environments in which Shigella lives. In the work described here, we have identified another probable iron acquisition system (SitABCD), which has homology to periplasmic binding protein-dependent ABC transport systems. The highest homology was to the S. enterica serovar Typhimurium SitABCD system. The Salmonella system can transport both ferrous iron and manganese, although the relevance of iron transport is uncertain, since the concentration of iron required for transport by the Salmonella system is significantly greater than physiological concentrations (22). Y. pestis also encodes Sit homologues (YfeABCD), and as in Salmonella, this system has been shown to transport both iron and manganese; however, unlike Salmonella, the iron species transported by Y. pestis Yfe was ferric iron (2). It is possible that differences in amino acid sequence among the S. enterica serovar Typhimurium Sit, Y. pestis Yfe, and S. flexneri Sit systems result in altered affinities for each of the cations, such that the physiological role of each system may be unique. The Salmonella Sit system may transport primarily manganese, while S. flexneri SitA may transport both manganese and iron. We found that, while manganese did not restore growth to the same level as did iron, addition of manganese did abolish the small growth defect of the S. flexneri SitA mutant relative to the wild type in L broth with EDDA. This indicates that the S. flexneri Sit system contributes to manganese, as well as iron, acquisition. Manganese requirements and uptake systems have not been characterized for S. flexneri, but the amount of manganese needed is apparently small, as it is not necessary to add manganese to defined media for maximal growth of S. flexneri (data not shown). If the S. flexneri Sit system does transport manganese, it is unlikely to be the only manganese transporter present in these bacteria, since S. flexneri has an mntH gene encoding a protein homologous to the E. coli and S. enterica serovar Typhimurium NRAMP homologue MntH (23, 30; Blattner, unpublished). Thus, it is likely that there is functional redundancy in manganese, as well as iron, transport.

Several lines of evidence suggest that the Shigella Sit system mediates iron acquisition. First, although the sitA mutation alone showed no defect in plaque formation, a sitA mutation in combination with other iron acquisition mutations showed additive effects in plaque assays. Second, addition of iron to L broth containing EDDA eliminated growth differences between the sit mutant and the parent strain in L broth containing EDDA. Finally, both the S. flexneri and the S. dysenteriae sitABCD genes (42) restored growth to an E. coli enterobactin synthesis mutant in iron-restricted media. Likewise, both the S. enterica serovar Typhimurium sit and Y. pestis yfe operons complemented growth defects of enterobactin-deficient E. coli in iron-restricted media (3, 56).

The importance of iron transport when S. flexneri is in the eukaryotic cytoplasm is supported by the study by Reeves et al. (43) that showed that an S. dysenteriae tonB mutant, which eliminates all high-affinity iron transport, was defective in intracellular growth in Henle cells. The S. flexneri triple mutant SM193 was unable to form plaques on Henle cells and is defective in iron acquisition via the aerobactin, Feo, and Sit systems. The aerobactin system is TonB dependent (37), but the FeoB system is TonB independent (19). The TonB dependency of the Sit system is unclear, since the mechanism for entry of its ligands into the periplasm in S. flexneri has not been identified.

In the eukaryotic cell, free iron is not abundant, since iron, unless tightly complexed, can catalyze formation of toxic hydroxyl radicals. Thus, iron is bound in ferritin, heme proteins, and other proteins. The iron sources used by some intracellular pathogens have been identified. Based on the observation that apolactoferrin and lactoferrin saturated with either manganese or zinc inhibit growth of Legionella pneumophila, this bacterium is predicted to use lactoferrin as an intracellular iron source while in the phagosome (11). The Feo system is also important for L. pneumophila intracellular growth, since a feoB mutant shows decreased replication in amoebae and human U937 cell macrophages (44). Additionally, a mutation in an L. pneumophila gene with homology to the aerobactin synthetase genes iucA and iucC impairs intracellular growth (15), suggesting that siderophore is important. Likewise, the Brucella abortus siderophore dihydroxybenzoic acid enhances intracellular survival of the bacteria in murine macrophages (39). Transferrin may be a source of iron for the obligate intracellular pathogens Chlamydia pneumoniae (1) and Mycobacterium tuberculosis (8). Finally, intracellular replication of Neisseria meningitidis requires TonB-dependent acquisition of an unidentified iron source, which was shown previously not to be transferrin, lactoferrin, or hemoglobin (26).

It has been difficult to assess the intracellular iron sources for Shigella species since they have numerous iron acquisition systems for multiple iron sources, and single mutations in genes encoding these systems have had no effect on intracellular growth (27, 36, 43). Elimination of one Shigella iron acquisition system may be compensated for by increased uptake of iron through another system. However, mutations in more than one iron acquisition system decreased the ability of S. flexneri to form plaques on Henle cell monolayers (Fig. 4). This may indicate that more than one iron transport system can access the same intracellular iron source, or there may be several iron sources in the Henle cell cytosol available to Shigella. The fact that the S. flexneri iucD feoB double mutant forms smaller plaques than do the parental strains suggests that both ferric and ferrous iron sources are available in the cell. It is not known whether the iron ligand for S. flexneri SitA is ferric or ferrous iron.

Although all of the S. flexneri strains carrying mutations in more than one iron transport system formed smaller plaques on Henle cell monolayers, there are examples in other Shigella spp. where elimination of two iron acquisition systems does not affect plaque formation. For example, an S. dysenteriae mutant defective in both heme and siderophore iron uptake formed wild-type plaques (43). In the case of the heme receptor, it is possible that, although there is heme in the eukaryotic cell, it may not be accessible to the pathogen. This is true for Neisseria gonorrhoeae heme synthesis mutants, which are defective in intracellular growth (53).

Expression of the S. flexneri sit operon is regulated in response to multiple signals. Expression of sit is repressed by manganese (Fig. 6), likely via the manganese-responsive repressor MntR. The sit promoter has a region homologous to the MntR binding site (21). As expected for an iron acquisition system, the sit genes are repressed in iron-replete media. A significant portion of this regulation can be attributed to Fur, since the repression is abolished in a Fur mutant (Fig. 6). The regulation of sit expression also has a Fur-independent component, since sit expression increases in a Fur mutant upon iron depletion of the culture. This would not be expected if Fur were the sole effector of iron-mediated repression. The Fur-independent effects may result from iron binding to MntR, albeit with lower affinity than manganese, and thus causing iron-mediated repression in the absence of Fur. Kehres et al. (21) suggested this type of regulation for the mntH promoter, which is repressed primarily by iron via Fur and by manganese via MntR. Alternatively, an unidentified regulator may mediate Fur-independent iron regulation.

sit expression increases in the eukaryotic intracellular environment (47). This induction may simply be a reflection of a possible low iron and manganese concentration in the eukaryotic cytoplasm. Other S. flexneri Fur-regulated, iron-repressed genes show increased expression in Henle cells, including fhuA and sufA (47). However, since the S. dysenteriae shuA and the S. flexneri iuc promoters, which are also Fur regulated, were not induced when the bacteria were in Henle cells (14, 43), it is possible that repression of different promoters may be sensitive to different levels of iron. Alternatively, increased expression of S. flexneri sitA in the eukaryotic cytoplasm may be in response to additional unknown signals. Another signal that we have examined for potentially regulating sitA expression is oxidative stress, but we found that sitA expression is not significantly affected by hydrogen peroxide (data not shown). Like the S. flexneri sitA gene, the Salmonella sitA gene is also expressed in eukaryotic cells (murine hepatocytes) (18). However, while S. flexneri multiplies in the cytoplasm, Salmonella resides in the vacuole of the eukaryotic cell, and so the signals may be slightly different.

The S. enterica serovar Typhimurium sit genes are on the SPI1 pathogenicity island (18, 56). Pathogenicity islands are characterized by features including: presence in pathogenic but not nonpathogenic isolates; presence of mobile elements, integrases, insertion sequence elements, and phage genes; association with a tRNA gene; and acquisition via horizontal transfer. Among strains of the related genera Escherichia and Shigella, the sit operon was found exclusively in enteroinvasive strains, which replicate inside host cells. The S. flexneri sit operon is flanked by phage genes: part of a RAC prophage integrase gene is located upstream of the sit operon. Two ORFs with homology to P27 phage genes are located downstream of the sit operon. Furthermore, the regions upstream of sit operons are different in S. flexneri and S. dysenteriae, suggesting a difference in composition or location of the islands. Thus, in Shigella, the sit genes also appear to be in pathogenicity islands. The acquisition and maintenance of the sit genes by pathogens that invade eukaryotic cells suggest a possible role for the sit genes in growth in the intracellular environment. Salmonella sit mutants are slightly attenuated for virulence (18), and in Y. pestis yfe mutants are significantly attenuated for intravenous infection (2). Although the S. flexneri sitA mutant was defective in plaque formation only when other iron transport systems were eliminated, it is possible that the Sit system may be important in other stages of the natural infection process.


    ACKNOWLEDGMENTS
 
We gratefully thank Elizabeth Wyckoff and Alexandra Mey for their critical reading of the manuscript and Jin Zhong and Jiri Perutka for help with intron mutagenesis.

This work was supported by Public Health Service grant AI16935 awarded to S. M. Payne and grant AI09918 awarded to L. Runyen-Janecky.


    FOOTNOTES
 
* Corresponding author. Mailing address: Section for Molecular Genetics and Microbiology and Institute for Cellular and Molecular Biology, University of Texas at Austin, Austin, TX 78712-0162. Phone: (512) 471-9258. Fax: (512) 471-7088. E-mail: payne{at}mail.utexas.edu. Back

Editor: J. T. Barbieri

{dagger} Present address: Department of Biology, University of Richmond, Richmond, VA 23173. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Al-Younes, H. M., T. Rudel, V. Brinkmann, A. J. Szczepek, and T. F. Meyer. 2001. Low iron availability modulates the course of Chlamydia pneumoniae infection. Cell. Microbiol. 3:427-437.[CrossRef][Medline]
2. Bearden, S. W., and R. D. Perry. 1999. The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague. Mol. Microbiol. 32:403-414.[CrossRef][Medline]
3. Bearden, S. W., T. M. Staggs, and R. D. Perry. 1998. An ABC transporter system of Yersinia pestis allows utilization of chelated iron by Escherichia coli SAB11. J. Bacteriol. 180:1135-1147.[Abstract/Free Full Text]
4. Clarke, T. E., L. W. Tari, and H. J. Vogel. 2001. Structural biology of bacterial iron uptake systems. Curr. Top. Med. Chem. 1:7-30.[CrossRef][Medline]
5. Coulton, J. W., P. Mason, and M. S. DuBow. 1983. Molecular cloning of the ferrichrome-iron receptor of Escherichia coli K-12. J. Bacteriol. 156:1315-1321.[Abstract/Free Full Text]
6. Daskaleros, P. A., and S. M. Payne. 1987. Congo red binding phenotype is associated with hemin binding and increased infectivity of Shigella flexneri in the HeLa cell model. Infect. Immun. 55:1393-1398.[Abstract/Free Full Text]
7. Daskaleros, P. A., J. A. Stoebner, and S. M. Payne. 1991. Iron uptake in Plesiomonas shigelloides: cloning of the genes involved in the heme-iron uptake system. Infect. Immun. 59:2706-2711.[Abstract/Free Full Text]
8. Douvas, G. S., M. H. May, and A. J. Crowle. 1993. Transferrin, iron, and serum lipids enhance or inhibit Mycobacterium avium replication in human macrophages. J. Infect. Dis. 167:857-864.[Medline]
9. Escolar, L., J. Perez-Martin, and V. de Lorenzo. 1999. Opening the iron box: transcriptional metalloregulation by the Fur protein. J. Bacteriol. 181:6223-6229.[Free Full Text]
10. Friedman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and F. Ausubel. 1982. Construction of a broad host range cosmid cloning vector and its uses in the genetic analysis of Rhizobium meliloti. Gene 18:289-296.[CrossRef][Medline]
11. Goldoni, P., L. Sinibaldi, P. Valenti, and N. Orsi. 2000. Metal complexes of lactoferrin and their effect on the intracellular multiplication of Legionella pneumophila. Biometals 13:15-22.[CrossRef][Medline]
12. Hale, T. L. 1991. Genetic basis of virulence in Shigella species. Microbiol. Rev. 55:206-224.[Abstract/Free Full Text]
13. Hamed, M. Y. 1993. Binding of the ferric uptake regulation repressor protein (Fur) to Mn(II), Fe(II), Co(II), and Cu(II) ions as co-repressors: electronic absorption, equilibrium, and 57Fe Mossbauer studies. J. Inorg. Biochem. 50:193-210.[CrossRef][Medline]
14. Headley, V., M. Hong, M. Galko, and S. M. Payne. 1997. Expression of aerobactin genes by Shigella flexneri during extracellular and intracellular growth. Infect. Immun. 65:818-821.[Abstract]
15. Hickey, E. K., and N. P. Cianciotto. 1997. An iron- and Fur-repressed Legionella pneumophila gene that promotes intracellular infection and encodes a protein with similarity to the Escherichia coli aerobactin synthetases. Infect. Immun. 65:133-143.[Abstract]
16. Hong, M., Y. Gleason, E. E. Wyckoff, and S. M. Payne. 1998. Identification of two Shigella flexneri chromosomal loci involved in intercellular spreading. Infect. Immun. 66:4700-4710.[Abstract/Free Full Text]
17. Hong, M., and S. M. Payne. 1997. Effect of mutations in Shigella flexneri chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and serum resistance. Mol. Microbiol. 24:779-791.[CrossRef][Medline]
18. Janakiraman, A., and J. M. Slauch. 2000. The putative iron transport system SitABCD encoded on SPI1 is required for full virulence of Salmonella typhimurium. Mol. Microbiol. 35:1146-1155.[CrossRef][Medline]
19. Kammler, M., C. Schon, and K. Hantke. 1993. Characterization of the ferrous iron uptake system of Escherichia coli. J. Bacteriol. 175:6212-6219.[Abstract/Free Full Text]
20. Karberg, M., H. Guo, J. Zhong, R. Coon, J. Perutka, and A. M. Lambowitz. 2001. Group II introns as controllable gene targeting vectors for genetic manipulation of bacteria. Nat. Biotechnol. 19:1162-1167.[CrossRef][Medline]
21. Kehres, D. G., A. Janakiraman, J. M. Slauch, and M. E. Maguire. 2002. Regulation of Salmonella enterica serovar Typhimurium mntH transcription by H2O2, Fe2+, and Mn2+. J. Bacteriol. 184:3151-3158.[Abstract/Free Full Text]
22. Kehres, D. G., A. Janakiraman, J. M. Slauch, and M. E. Maguire. 2002. SitABCD is the alkaline Mn2+ transporter of Salmonella enterica serovar Typhimurium. J. Bacteriol. 184:3159-3166.[Abstract/Free Full Text]
23. Kehres, D. G., M. L. Zaharik, B. B. Finlay, and M. E. Maguire. 2000. The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol. Microbiol. 36:1085-1100.[CrossRef][Medline]
24. Kennedy, C. 1971. Induction of colicin production by high temperature or inhibition of protein synthesis. J. Bacteriol. 108:10-19.[Abstract/Free Full Text]
25. Koster, W., and V. Braun. 1990. Iron (III) hydroxamate transport into Escherichia coli. Substrate binding to the periplasmic FhuD protein. J. Biol. Chem. 265:21407-21410.[Abstract/Free Full Text]
26. Larson, J. A., D. L. Higashi, I. Stojiljkovic, and M. So. 2002. Replication of Neisseria meningitidis within epithelial cells requires TonB-dependent acquisition of host cell iron. Infect. Immun. 70:1461-1467.[Abstract/Free Full Text]
27. Lawlor, K. M., P. A. Daskaleros, R. E. Robinson, and S. M. Payne. 1987. Virulence of iron transport mutants of Shigella flexneri and utilization of host iron compounds. Infect. Immun. 55:594-599.[Abstract/Free Full Text]
28. Lawlor, K. M., and S. M. Payne. 1984. Aerobactin genes in Shigella spp. J. Bacteriol. 160:266-272.[Abstract/Free Full Text]
29. L'Eplattenier, F. L., I. Murase, and A. E. Martell. 1967. New multidentate ligands: VI. Chelating tendencies of N,N'-di(2-hydroxybenzyl) ethylene-N,N'-diacetic acid. J. Am. Chem. Soc. 89:837-843.[CrossRef]
30. Makui, H., E. Roig, S. T. Cole, J. D. Helmann, P. Gros, and M. F. Cellier. 2000. Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol. Microbiol. 35:1065-1078.[CrossRef][Medline]
31. Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3:208-218.
32. Marolda, C. L., M. A. Valvano, K. M. Lawlor, S. M. Payne, and J. H. Crosa. 1987. Flanking and internal regions of chromosomal genes mediating aerobactin iron uptake systems in enteroinvasive Escherichia coli and Shigella flexneri. J. Gen. Microbiol. 133:2269-2278.[Medline]
33. Menard, R., C. Dehio, and P. J. Sansonetti. 1996. Bacterial entry into epithelial cells: the paradigm of Shigella. Trends Microbiol. 4:220-226.[CrossRef][Medline]
34. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
35. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575-2583.[Abstract/Free Full Text]
36. Mills, M., and S. M. Payne. 1997. Identification of shuA, the gene encoding the heme receptor of Shigella dysenteriae, and analysis of invasion and intracellular multiplication of a shuA mutant. Infect. Immun. 65:5358-5363.[Abstract]
37. Moeck, G. S., and J. W. Coulton. 1998. TonB-dependent iron acquisition: mechanisms of siderophore-mediated active transport. Mol. Microbiol. 28:675-681.[CrossRef][Medline]
38. Oaks, E. V., M. E. Wingfield, and S. B. Formal. 1985. Plaque formation by virulent Shigella flexneri. Infect. Immun. 48:124-129.[Abstract/Free Full Text]
39. Parent, M. A., B. H. Bellaire, E. A. Murphy, R. M. Roop II, P. H. Elzer, and C. L. Baldwin. 2002. Brucella abortus siderophore 2,3-dihydroxybenzoic acid (DHBA) facilitates intracellular survival of the bacteria. Microb. Pathog. 32:239-248.[CrossRef][Medline]
40. Payne, S. M. 1980. Synthesis and utilization of siderophores by Shigella flexneri. J. Bacteriol. 143:1420-1424.[Abstract/Free Full Text]
41. Payne, S. M., D. W. Niesel, S. S. Peixotto, and K. M. Lawlor. 1983. Expression of hydroxamate and phenolate siderophores by Shigella flexneri. J. Bacteriol. 155:949-955.[Abstract/Free Full Text]
42. Reeves, S. A. 2001. Iron acquisition in the intracellular environment of the host: multiple iron transport systems in Shigella dysenteriae. Ph.D. dissertation. University of Texas, Austin.
43. Reeves, S. A., A. G. Torres, and S. M. Payne. 2000. TonB is required for intracellular growth and virulence of Shigella dysenteriae. Infect. Immun. 68:6329-6336.[Abstract/Free Full Text]
44. Robey, M., and N. P. Cianciotto. 2002. Legionella pneumophila feoAB promotes ferrous iron uptake and intracellular infection. Infect. Immun. 70:5659-5669.[Abstract/Free Full Text]
45. Rogers, H. J. 1973. Iron-binding catechols and virulence in Escherichia coli. Infect. Immun. 7:438-444.[Abstract/Free Full Text]
46. Runyen-Janecky, L. J., M. Hong, and S. M. Payne. 1999. The virulence plasmid-encoded impCAB operon enhances survival and induced mutagenesis in Shigella flexneri after exposure to UV radiation. Infect. Immun. 67:1415-1423.[Abstract/Free Full Text]
47. Runyen-Janecky, L. J., and S. M. Payne. 2002. Identification of chromosomal Shigella flexneri genes induced by the eukaryotic intracellular environment. Infect. Immun. 70:4379-4388.[Abstract/Free Full Text]
48. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
49. Sansonetti, P. J. 1992. Molecular and cellular biology of Shigella flexneri invasiveness: from cell assay systems to shigellosis. Curr. Top. Microbiol. Immunol. 180:1-19.[Medline]
50. Schmitt, M. P., and S. M. Payne. 1991. Genetic analysis of the enterobactin gene cluster in Shigella flexneri. J. Bacteriol. 173:816-825.[Abstract/Free Full Text]
51. Schmitt, M. P., and S. M. Payne. 1988. Genetics and regulation of enterobactin genes in Shigella flexneri. J. Bacteriol. 170:5579-5587.[Abstract/Free Full Text]
52. Taylor, R. K., C. Manoil, and J. J. Mekalanos. 1989. Broad-host-range vectors for delivery of TnphoA: use in genetic analysis of secreted virulence determinants of Vibrio cholerae. J. Bacteriol. 171:1870-1878.[Abstract/Free Full Text]
53. Turner, P. C., C. E. Thomas, C. Elkins, S. Clary, and P. F. Sparling. 1998. Neisseria gonorrhoeae heme biosynthetic mutants utilize heme and hemoglobin as a heme source but fail to grow within epithelial cells. Infect. Immun. 66:5215-5223.[Abstract/Free Full Text]
54. Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199.[CrossRef][Medline]
55. Zhong, J., M. Karberg, and A. M. Lambowitz. Targeted and random bacterial gene disruption using a group III intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucl. Acids Res., in press.
56. Zhou, D., W. D. Hardt, and J. E. Galan. 1999. Salmonella typhimurium encodes a putative iron transport system within the centisome 63 pathogenicity island. Infect. Immun. 67:1974-1981.[Abstract/Free Full Text]


Infection and Immunity, April 2003, p. 1919-1928, Vol. 71, No. 4
0019-9567/03/$08.00+0     DOI: 10.1128/IAI.71.4.1919-1928.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted