Previous Article | Next Article 
Infection and Immunity, April 2003, p. 2262-2265, Vol. 71, No. 4
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.4.2262-2265.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Polymorphisms within EspA Filaments of Enteropathogenic and Enterohemorrhagic Escherichia coli
Bianca C. Neves,1 Robert K. Shaw,2 Gad Frankel,1 and Stuart Knutton2*
Centre for Molecular Microbiology and Infection, Department of Biological Sciences, Imperial College London, London SW7 2AZ,1
Institute of Child Health, University of Birmingham, Birmingham B4 6NH, United Kingdom2
Received 16 September 2002/
Returned for modification 25 November 2002/
Accepted 18 December 2002

ABSTRACT
Enteropathogenic
Escherichia coli (EPEC) and enterohemorrhagic
E.
coli (EHEC) possess a filamentous type III secretion system
(TTSS) employed to deliver effector proteins into host cells.
EspA is a type III secreted protein which forms the filamentous
extension to the TTSS and which interacts with host cells during
early stages of attaching and effacing (A/E) lesion formation.
By immunofluorescence, a polyclonal antibody previously raised
to EspA from EPEC strain E2348/69 (O127:H6) stained

12-nm-diameter
EspA filaments produced by this strain but did not stain similar
filaments produced by EHEC serotype O157:H7. Similarly, an antibody
that we subsequently raised to EHEC strain 85-170 (O157:H7)
EspA stained

12-nm-diameter EspA filaments produced by strain
85-170 but did not stain E2348/69 EspA filaments. Given such
heterogeneity between EPEC and EHEC EspA filaments, we examined
polymorphisms of functional EspA filaments among different EPEC
and EHEC serotypes. With use of the EPEC EspA antiserum, EspA
filaments were observed only with EPEC serotypes O127:H6 and
O55:H6, serotypes which encode an identical EspA protein. When
stained with the EHEC EspA antiserum, EspA filaments were detected
only on EHEC strains belonging to serotype O157:H7; the EHEC
antiserum did, however, stain EspA filaments produced by the
closely related EPEC serotype O55:H7 but not filaments of any
other EPEC serotype tested. Such polymorphisms among functional
EspA filaments of EPEC and EHEC would be expected to have important
implications for the development of broad-range EspA-based vaccines.

TEXT
Enteropathogenic
Escherichia coli (EPEC) and enterohemorrhagic
E.
coli (EHEC) are two classes of extracellular diarrheagenic
E.
coli that communicate with the eukaryotic cytoskeleton while
adhering intimately to the outer surface of the intestinal epithelial
cell plasma membrane (
7,
22). Intimate bacterial attachment
is mediated through tight interaction between the outer bacterial
membrane adhesion molecule, intimin (
8,
10), and Tir (
12), a
receptor for intimin that is delivered to the host cell membrane
via a type III secretion system (TTSS) (
12). The TTSS, Tir,
and intimin are all expressed from a pathogenicity island known
as the locus of enterocyte effacement (LEE) (
6,
19).
Following infection and assembly of the TTSS, EPEC and EHEC translocate a range of effector proteins to the eukaryotic cell (7). The injected proteins target different cellular compartments; EspF (20) and EspG (5) are believed to remain cytosolic, and Map targets the mitochondria (13), while Tir is delivered and inserted into the host cell plasma membrane such that its amino and carboxy termini are intracellular and its central domain is exposed on the outer cell surface and serves as a receptor for intimin (9, 11). Binding of intimin to Tir triggers dramatic intracellular changes including reorganization of cytoskeletal proteins, actin polymerization at the site of intimate bacterial contact (15), and formation of a characteristic attaching and effacing (A/E) lesion (16, 21). Recently, based on sequence variation at the receptor binding carboxy-terminal 280 amino acids of intimin, it was reported that intimin could be classified into several distinct intimin types (1).
EspA, a protein also expressed from the LEE pathogenicity island and essential for A/E lesion formation (14), is one of the TTSS translocator proteins and a major if not the only component of a filamentous structure which extends from the basic needle complex of the secretion apparatus and connects the pathogen to the plasma membrane of the host cell (4, 17). EspB and EspD are additional translocator proteins believed to form a translocation pore in the host cell membrane at the distal end of the EspA filament (26, 29). Under growth conditions that induce LEE gene expression, antibodies made against a recombinant EspA from EPEC strain E2348/69 stained the
12-nm-diameter EspA filaments (17) with, on average, each bacterium producing 12 EspA filaments (3). Although by scanning electron microscopy EHEC O157 was reported elsewhere to produce filaments resembling EspA filaments of EPEC (24), no positive identification of EHEC EspA filaments has yet been made. The aim of this study was to confirm and positively identify expression of EspA filaments by EHEC and to examine polymorphisms of functional EspA filaments between different EPEC and EHEC strains.
EspA filaments can readily be detected by immunofluorescence during early stages of A/E lesion formation (17). Accordingly, we infected HEp-2 cells with EHEC strain 85-170 (a Shiga toxin-negative O157:H7 strain) (25) and with EPEC strain E2348/69 (O127:H6) (18) as a control for 3 h, fixed the cells in formalin, and performed indirect immunofluorescence with a rabbit EspAE2348/69 polyclonal antiserum (17) and a goat anti-rabbit Alexa 488 fluorescence conjugate (Molecular Probes). This revealed positive staining of the EPEC E2348/69 EspA filaments but no staining of corresponding structures produced by EHEC 85-170 (Fig. 1). At later stages of infection bacteria induced actin accretion that could readily be detected by fluorescent actin staining (FAS) with fluorescein-conjugated phalloidin (15). Indeed, a positive FAS reaction was observed following infection with both EPEC E2348/69 and EHEC 85-170 (Fig. 1). It is well documented that a positive FAS reaction, a correlate of A/E lesion formation, is dependent on formation of EspA filaments (14, 17). Accordingly, we hypothesized that our inability to detect the EHEC 85-170 EspA filaments using the EPEC antisera was due to EspA polymorphisms between the two strains.
In order to investigate possible polymorphisms, EHEC
EspA was
cloned, following PCR amplification with Deep Vent DNA polymerase
(New England Biolabs), the primer pair espA-F (5' TATCATATGGATACATCAAATGCAACATCCGTT
3') and espA-R (5' TATGGATCCTTATTTACCAAGGGATATTGCTGAAATAG 3'),
and EHEC genomic DNA from the prototype strain 85-170 (O157:H7)
as DNA template, into
NdeI/
BamHI-digested pET28-a, generating
plasmid pICC207 for expression as a His-tagged protein.
His6-EspA fusions were expressed in BL21(DE3)pLysS(pICC207). An overnight culture was diluted 1:100 in 100 ml of LB (30 µg of kanamycin/ml, 30 µg of chloramphenicol/ml, and 0.2% glucose), grown to an optical density at 600 nm of 0.4 to 0.8 at 37°C with shaking, and induced with the addition of 1.0 mM IPTG (isopropyl-ß-D-thiogalactopyranoside). Following a further 4-h (30°C) incubation, bacterial cells were pelleted, resuspended in cold binding buffer (5 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9), and sonicated. Following removal of cell debris by centrifugation (45,000 x g for 30 min), the cell extracts were filtered through a 0.45-µm-pore-size filter device and His6-EspA was purified on a 2.5-ml nickel-charged column as recommended by the manufacturer (Novagen) and described before (17). An 80- to 100-µg quantity of the recombinant His6-EspA was used to immunize, subcutaneously in complete Freund's adjuvant, female Sandy half-lop rabbits. The animals were boosted twice with the same antigen in incomplete Freund's adjuvant at 3-week intervals before exsanguinations.
Employing this EHEC 85-170 EspA antiserum on infected epithelial cells revealed staining of EspA filaments specifically in association with EHEC 85-170 bacteria, whereas no staining of the EspA filaments was seen in association with EPEC E2348/69 (Fig. 1). This observation not only provided the first positive identification of EspA filaments on EHEC O157:H7 but supported the possible existence of polymorphisms between different EspA filaments.
The fact that no cross-reactivity was seen between the EPEC E2348/69 and EHEC 85-170 EspA antisera prompted us to determine their reactivities with different EPEC and EHEC clinical isolates from our strain collection (Table 1). Significantly, the EspA85-170 antiserum stained EspA filaments expressed by all three EHEC O157:H7 strains tested but did not stain EspA filaments produced by other EHEC strains, e.g., EHEC O26:H11 (Table 1). In addition, when tested against different EPEC serotypes, the EspA85-170 antiserum stained only EspA filaments of the atypical EPEC serotype O55:H7 (Table 1; Fig. 1). Of note is the fact that O55:H7 EPEC is believed to be the ancestral serotype from which EHEC O157:H7 emerged (27, 28). This observation is intriguing as the level of identity between the amino acid sequences of O55:H7 and O157:H7 EspA polypeptides (80%) is not significantly greater than the identity between E2348/69 and EHEC EspA proteins (79%). The
20% variant amino acids are dispersed throughout the protein (23), and the structure of the EspA protein has not been determined. Hence, it is unclear if a particular surface-exposed epitope is responsible for these observed differences in cross-reactivity.
View this table:
[in this window]
[in a new window]
|
TABLE 1. EPEC and EHEC strains examined by FAS and for EspA filaments by using the EPEC EspAE2348/69 and EHEC EspA85-170 antisera following a 3-h infection of HEp-2 cells
|
In contrast to the EspA
85-170 antiserum, the EspA
E2348/69 antiserum
specifically stained EspA filaments of EPEC serotypes O127:H6
and O55:H6. The antiserum did not react with EspA filaments
expressed by any of the other EPEC and EHEC strains tested (Table
1; Fig.
1). The cross-reactivity of the E2348/69 antiserum with
O55:H6 strains was not unexpected, however, as the amino acid
sequence of the EspA protein is identical between the two serotypes
(
23).
Our group recently demonstrated EspA filament-mediated attachment of EPEC to red blood cell (RBC) membranes (24) and by scanning electron microscopy demonstrated filaments resembling EspA filaments mediating attachment of EHEC O157 to RBCs (24), filaments which we have now confirmed as EspA filaments by immunofluorescence. Although we were unable to demonstrate EspA filaments produced by most EPEC and EHEC serotypes by immunofluorescence (Table 1), scanning electron microscopy of RBCs infected with EPEC and EHEC strains which did not react with either EspAE2348/69 or EspA85-170 antiserum did reveal filaments which mediated bacterial attachment to the RBC membrane and which resembled filaments confirmed as EspA by immunogold labeling with 10-nm gold particles detected with a backscattered electron detector (Fig. 2).
In this report we have demonstrated polymorphisms between EspA
filaments expressed by different EPEC and EHEC isolates. Considering
the high level of amino acid sequence identity between different
EPEC and EHEC EspA proteins and despite the fact that EspA proteins
cross-react in Western blots (
23; data not shown) and that EspA
genes could be grouped by PCR (
2), the lack of cross-reactivity
with EspA filaments was unexpected. However, this observation
is significant as EspA is considered to be an important component
of a veterinary EHEC vaccine. Our results imply that immunization
with EHEC O157 EspA would potentially reduce carriage of EHEC
O157 but would not protect livestock animals from other EHEC
serotypes (i.e., EHEC O26:H11, EHEC O103:H2, and EHEC O111)
which, in some countries, are more prevalent than O157 EHEC.
Indeed, using the
Citrobacter rodentium mouse model of infection,
we recently showed that immunization with EspA
E2348/69 did not
prevent colonization of the mouse gut following oral challenge
with
C.
rodentium (unpublished data). Taken together, the results
presented in this report imply that, for a broad-range EspA-based
vaccine, a combination of recombinant or secreted EspA preparations
would be required.

ACKNOWLEDGMENTS
This work was supported by the Wellcome Trust and the CNPq agency,
Brazil (BCN).
Bianca Neves and Robert Shaw contributed equally to the study.

FOOTNOTES
* Corresponding author. Mailing address: Institute of Child Health, Whittall St., Birmingham B4 6NH, United Kingdom. Phone: 44 121 333 8746. Fax: 44 121 333 8701. E-mail:
s.knutton{at}bham.ac.uk.

Editor: A. D. O'Brien

REFERENCES
1 - Adu-Bobie, J., G. Frankel, C. Bain, A. G. Goncaleves, L. R. Trabulsi, G. Douce, S. Knutton, and G. Dougan. 1998. Detection of intimin
, ß,
, and
, four intimin derivatives expressed by attaching and effacing microbial pathogens. J. Clin. Microbiol. 36:662-668.[Abstract/Free Full Text]
2 - China, B., F. Goffaux, V. Pirson, and J. Mainil. 1999. Comparison of eae, tir, espA and espB genes of bovine and human attaching and effacing Escherichia coli by multiplex polymerase chain reaction. FEMS Microbiol. Lett. 178:177-182.[CrossRef][Medline]
3 - Daniell, S. J., N. Takahashi, R. Wilson, D. Friedberg, I. Rosenshine, F. P. Booy, R. K. Shaw, S. Knutton, G. Frankel, and S. Aizawa. 2001. The filamentous type III secretion translocon of enteropathogenic Escherichia coli. Cell. Microbiol. 3:865-871.[CrossRef][Medline]
4 - Ebel, F., T. Podzadel, M. Rohde, A. U. Kresse, S. Kramer, C. Deibel, C. A. Guzman, and T. Chakraborty. 1998. Initial binding of Shiga toxin-producing Escherichia coli to host cells and subsequent induction of actin rearrangements depend on filamentous EspA-containing surface appendages. Mol. Microbiol. 30:147-161.[CrossRef][Medline]
5 - Elliott, S. J., E. O. Krejany, J. L. Mellies, R. M. Robins-Browne, C. Sasakawa, and J. B. Kaper. 2001. EspG, a novel type III system-secreted protein from enteropathogenic Escherichia coli with similarities to VirA of Shigella flexneri. Infect. Immun. 69:4027-4033.[Abstract/Free Full Text]
6 - Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. K. Deng, L. C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28:1-4.[CrossRef][Medline]
7 - Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S. Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol. Microbiol. 30:911-921.[CrossRef][Medline]
8 - Frankel, G., A. D. Phillips, L. R. Trabulsi, S. Knutton, G. Dougan, and S. E. Matthews. 2001. Intimin and the host cellis it bound to end in Tir(s)? Trends Microbiol. 9:214-218.[CrossRef][Medline]
9 - Hartland, E. L., M. Batchelor, R. M. Delahay, C. Hale, S. Matthews, G. Dougan, S. Knutton, I. Connerton, and G. Frankel. 1999. Binding of intimin from enteropathogenic Escherichia coli to Tir and to host cells. Mol. Microbiol. 32:151-158.[CrossRef][Medline]
10 - Jerse, A. E., J. Yu, B. D. Tall, and J. B. Kaper. 1990. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. USA 87:7839-7843.[Abstract/Free Full Text]
11 - Kenny, B. 1999. Phosphorylation of tyrosine 474 of the enteropathogenic Escherichia coli (EPEC) Tir receptor molecule is essential for actin nucleating activity and is preceded by additional host modifications. Mol. Microbiol. 31:1229-1241.[CrossRef][Medline]
12 - Kenny, B., R. DeVinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B. Finlay. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91:511-520.[CrossRef][Medline]
13 - Kenny, B., and M. Jepson. 2000. Targeting of an enteropathogenic Escherichia coli (EPEC) effector protein to host mitochondria. Cell. Microbiol. 2:579-590.[CrossRef][Medline]
14 - Kenny, B., L. C. Lai, B. B. Finlay, and M. S. Donnenberg. 1996. EspA, a protein secreted by enteropathogenic Escherichia coli, is required to induce signals in epithelial cells. Mol. Microbiol. 20:313-323.[CrossRef][Medline]
15 - Knutton, S., T. Baldwin, P. H. Williams, and A. S. McNeish. 1989. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect. Immun. 57:1290-1298.[Abstract/Free Full Text]
16 - Knutton, S., D. R. Lloyd, and A. S. McNeish. 1987. Adhesion of enteropathogenic Escherichia coli to human intestinal enterocytes and cultured human intestinal mucosa. Infect. Immun. 55:69-77.[Abstract/Free Full Text]
17 - Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C. Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J. 17:2166-2176.[CrossRef][Medline]
18 - Levine, M. M., E. J. Berquist, D. R. Nalin, D. H. Waterman, R. B. Hornick, C. R. Young, S. Stoman, and B. Rowe. 1978. Escherichia coli that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet i:119-122.
19 - McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668.[Abstract/Free Full Text]
20 - McNamara, B. P., and M. S. Donnenberg. 1998. A novel proline-rich protein, EspF, is secreted from enteropathogenic Escherichia coli via the type III export pathway. FEMS Microbiol. Lett. 166:71-78.[CrossRef][Medline]
21 - Moon, H. W., S. C. Whipp, R. A. Argenzio, M. M. Levine, and R. A. Giannella. 1983. Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect. Immun. 41:1340-1351.[Abstract/Free Full Text]
22 - Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201.[Abstract/Free Full Text]
23 - Neves, B. C., S. Knutton, L. R. Trabulsi, V. Sperandio, J. B. Kaper, G. Dougan, and G. Frankel. 1998. Molecular and ultrastructural characterisation of EspA from different enteropathogenic Escherichia coli serotypes. FEMS Microbiol. Lett. 169:73-80.[CrossRef][Medline]
24 - Shaw, R. K., S. Daniell, F. Ebel, G. Frankel, and S. Knutton. 2001. EspA filament-mediated protein translocation into red blood cells. Cell. Microbiol. 3:213-222.[CrossRef][Medline]
25 - Tzipori, S., H. Karch, K. I. Wachsmuth, R. M. Robins-Browne, A. D. O'Brien, H. Lior, M. L. Cohen, J. Smithers, and M. M. Levine. 1987. Role of a 60-megadalton plasmid and Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O157:H7 in gnotobiotic piglets. Infect. Immun. 55:3117-3125.[Abstract/Free Full Text]
26 - Wachter, C., C. Beinke, M. Mattes, and M. A. Schmidt. 1999. Insertion of EspD into epithelial target cell membranes by infecting enteropathogenic Escherichia coli. Mol. Microbiol. 31:1695-1707.[CrossRef][Medline]
27 - Whittam, T. S., and E. A. McGraw. 1996. Clonal analysis of EPEC serogroups. Rev. Microbiol. Sao Paulo 27(Suppl. 1):7-16.
28 - Whittam, T. S., M. L. Wolfe, I. K. Wachsmuth, F. Orskov, I. Orskov, and R. A. Wilson. 1993. Clonal relationships among Escherichia coli strains that cause hemorrhagic colitis and infantile diarrhea. Infect. Immun. 61:1619-1629.[Abstract/Free Full Text]
29 - Wolff, C., I. Nisan, E. Hanski, G. Frankel, and I. Rosenshine. 1998. Protein translocation into HeLa cells by infecting enteropathogenic Escherichia coli. Mol. Microbiol. 28:143-155.[CrossRef][Medline]
Infection and Immunity, April 2003, p. 2262-2265, Vol. 71, No. 4
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.4.2262-2265.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Moura, R. A., Sircili, M. P., Leomil, L., Matte, M. H., Trabulsi, L. R., Elias, W. P., Irino, K., Pestana de Castro, A. F.
(2009). Clonal Relationship among Atypical Enteropathogenic Escherichia coli Strains Isolated from Different Animal Species and Humans. Appl. Environ. Microbiol.
75: 7399-7408
[Abstract]
[Full Text]
-
Girard, F., Crepin, V. F., Frankel, G.
(2009). Modelling of Infection by Enteropathogenic Escherichia coli Strains in Lineages 2 and 4 Ex Vivo and In Vivo by Using Citrobacter rodentium Expressing TccP. Infect. Immun.
77: 1304-1314
[Abstract]
[Full Text]
-
Vilte, D. A., Larzabal, M., Cataldi, A. A., Mercado, E. C.
(2008). Bovine Colostrum Contains Immunoglobulin G Antibodies against Intimin, EspA, and EspB and Inhibits Hemolytic Activity Mediated by the Type Three Secretion System of Attaching and Effacing Escherichia coli. CVI
15: 1208-1213
[Abstract]
[Full Text]
-
Shaw, R. K., Berger, C. N., Feys, B., Knutton, S., Pallen, M. J., Frankel, G.
(2008). Enterohemorrhagic Escherichia coli Exploits EspA Filaments for Attachment to Salad Leaves. Appl. Environ. Microbiol.
74: 2908-2914
[Abstract]
[Full Text]
-
Crepin, V. F., Shaw, R., Abe, C. M., Knutton, S., Frankel, G.
(2005). Polarity of Enteropathogenic Escherichia coli EspA Filament Assembly and Protein Secretion. J. Bacteriol.
187: 2881-2889
[Abstract]
[Full Text]
-
Grys, T. E., Siegel, M. B., Lathem, W. W., Welch, R. A.
(2005). The StcE Protease Contributes to Intimate Adherence of Enterohemorrhagic Escherichia coli O157:H7 to Host Cells. Infect. Immun.
73: 1295-1303
[Abstract]
[Full Text]
-
Dahan, S., Knutton, S., Shaw, R. K., Crepin, V. F., Dougan, G., Frankel, G.
(2004). Transcriptome of Enterohemorrhagic Escherichia coli O157 Adhering to Eukaryotic Plasma Membranes. Infect. Immun.
72: 5452-5459
[Abstract]
[Full Text]
-
Kuhne, S. A., Hawes, W. S., La Ragione, R. M., Woodward, M. J., Whitelam, G. C., Gough, K. C.
(2004). Isolation of Recombinant Antibodies against EspA and Intimin of Escherichia coli O157:H7. J. Clin. Microbiol.
42: 2966-2976
[Abstract]
[Full Text]