Previous Article | Next Article ![]()
Infection and Immunity, April 2003, p. 2272-2275, Vol. 71, No. 4
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.4.2272-2275.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Department of Applied Oral Sciences, Faculty of Dentistry,1 Department of Microbiology & Immunology, Dalhousie University,2 Department of Pediatrics, IWK Health Centre, Halifax, Nova Scotia, Canada B3H 3J53
Received 6 November 2002/ Returned for modification 22 November 2002/ Accepted 13 December 2002
|
|
|---|
|
|
|---|
Cholera toxin (Ctx) is also an AB toxin in which the toxic A1 moiety (22 kDa) is linked to the pentameric B subunit (CtxB) (11 kDa) by an A2 fragment (5 kDa) which is derived from the proteolytic cleavage of the C terminus of the A subunit (5, 14). CtxB binds to the GM1 ganglioside and can serve as a mucosal adjuvant (6, 12). Hajishengalis et al. (6) previously have shown that the A1 moiety can be replaced by a saliva-binding region (SBR) of the Streptococcus mutans antigen I/II, and the chimera induced an excellent immune response to SBR when given orally to mice.
A mucosal pertussis vaccine offers a number of potential advantages over the conventional parenteral vaccines, such as the ease in administration and the generation of mucosal antibodies that can prevent colonization by B. pertussis. However, induction of a protective antibody immune response at mucosal surfaces is not readily achieved by parenteral or mucosal immunization with soluble antigens. Since CtxB is an excellent mucosal adjuvant, we exploited this property to deliver the PT S1 fragment to the mucosal immune system.
Construction of the MBPS1S1CtxA2B chimera. Two copies of the DNA coding for the N-terminal 179-amino-acid sequence of the PT S1 subunit were cloned in tandem into the middle portion of spaP by ligating a 1.4-kb SmaI-KpnI fragment from pPTS1 into the NruI-KpnI sites of pRJMI (11). The DNA coding for the CtxA2 motif and CtxB was then cloned downstream to the SpaPS1S1 construct using the NruI-KpnI sites. The CtxA2B DNA was amplified from pRIT10814 (13) using Taq DNA polymerase and the primers SL155 (ATGATATCGCTTGGAGGGAAGAG; EcoRV site underlined) and SL156 (ACGGTACCATAATACGCACTAAGG; KpnI site underlined) under conditions described previously (8). The cloning placed the CtxA2 sequence in-frame to the S1 sequence, creating the DNA coding for the SpaPS1S1CtxA2 fusion as one gene and ctxB as a second gene with its authentic ribosomal binding site and leader sequence. The S1S1CtxA2B DNA was further subcloned into pMalp (New England Biolabs, Mississauga, Ontario, Canada), creating an in-frame fusion between the S1S1CtxA2 protein and the maltose binding protein. The S1S1CtxA2B fusion carried on a 1.9-kb HindIII-KpnI fragment was blunted with Klenow and subcloned into the blunted EcoRI site of pMalp. The resulting plasmid was named pMalpS1S1CtxA2B.
Purification and characterization of the MBPS1S1CtxA2B chimera. Initial expression studies with Escherichia coli (pMalpS1S1CtxA2B) showed that large quantities of the MBPS1S1CtxA2 fusion protein and CtxB were produced as insoluble aggregates following induction with 0.3 mM isopropyl-ß-D-thiogalactoside. Solubilization of the aggregates with 6 M urea followed by dialysis resulted in a very low yield of the active MBPS1S1CtxA2B chimera, as indicated by GM1-binding enzyme-linked immunosorbent assay (ELISA) using anti-PT as the detecting antibody. The highest yield of the active form of the chimera was from noninduced cultures at 37°C. Therefore, batches of noninduced cultures (2 liters) were used as the source (clarified sonicate) for the isolation of the chimera by affinity chromatography using an amylose column (20 ml; New England Biolabs) followed with a D-galactose column (15 ml; Pierce, Rockford, Ill.) according to the manufacturer's suggestions. The yield of the chimera was ca. 50 µg per liter of culture.
The protein composition was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 12% gel and Western immunoblotting. An unheated sample of the affinity-isolated chimera showed a single band with a mass of ca. 105 kDa on the SDS-PAGE gel, suggesting purity. The boiled sample showed the disappearance of the 105-kDa band and appearance of two bands of 76 and 11 kDa. Western immunoblots showed that the 105- and 76-kDa bands were recognized by the monoclonal anti-S1 antibody (7). The 105-kDa band and eight other bands from the unheated sample were recognized by the anti-CtxB antibody (1/2,000; List Biological Laboratories, Campbell, Calif.). The multiple banding pattern is likely due to the different aggregated forms of the chimera. In the heated sample, only the 11-kDa band was recognized by the anti-CtxB antibody.
The molecular mass of the native chimeric protein was estimated by gel permeation chromatography on a Sephacryl S-200HR column (2.5 by 96 cm). The eluted protein was assayed by GM1-binding ELISA. The single peak that was immunoreactive to both anti-PT and anti-CtxB antibodies has a molecular weight of 122,500 as estimated by comparisons to known protein standards (Sigma). The result suggests that the chimera is the expected MBPS1S1A2(CtxB)5. It is interesting that the MBPS1S1CtxA2B chimera is considerably larger than the holocholera toxin (84 kDa) and the SBRCtxA2B chimera (107.9 kDa [6]). Our results indicate that the A2 fragment can direct a polypeptide as large as 76 kDa for association with the CtxB pentamer.
The functionality of the isolated chimeric protein was demonstrated by GM1-binding ELISA in a dose-dependent manner. In the assay, microtiter plates were coated with 230 ng of GM1 ganglioside (CalBiochem, San Diego, Calif.) and blocked with 1% gelatin in phosphate-buffered saline (PBS) with 0.1% Tween 20 and 5 mM MgCl2, and samples were added. The chimeric protein bound to GM1 was detected with a rabbit anti-PT (1/300; [11]) or a goat anti-CtxB antibody followed by the goat anti-rabbit immunoglobulin G (IgG) (1/30,000; Sigma) or rabbit anti-goat IgG (1/20,000; Sigma) alkaline phosphatase conjugates, respectively. As shown in Fig. 1, the titration curves in GM1-binding ELISA probed with anti-PT and anti-CtxB antibodies were very similar. The curves were also very similar to that of a commercial CtxB.
![]() View larger version (20K): [in a new window] |
FIG. 1. GM1-binding ELISA of MBPS1S1CtxA2B. The chimera was detected with a rabbit anti-PT antibody or a goat anti-CtxB antibody. Open squares represent a parallel ELISA with a commercial CtxB probed with the goat anti-CtxB antibody.
|
Immunogenicity of the MBPS1S1CtxA2B chimera. BALB/c mice (n = 5; female; 3 weeks old) were immunized intranasally with 25 µg of MBPS1S1CtxA2B at days 1, 11, 21, 41, 51, and 61 by pipetting the immunogen into the nostrils. A second cohort of mice (n = 5) was similarly immunized with 25 µg of pertussis toxoid (SmithKline Beecham, Rixensart, Belgium), and a third cohort (n = 5) was sham immunized with PBS. Saliva and blood were collected at days 0, 18, 28, 48, 57, and 67 as described previously (9, 10). Vaginal washes (VW) were collected at days 0 and 67 (9, 10). Bronchoalveolar lavage (BAL) fluids were obtained with 1 ml of PBS at day 67 (7, 9). Specific antibodies in samples were measured by ELISA in end-point dilutions as described previously (10). Titers of the specific antibodies were defined as the highest dilution that gave an A405 value at least 0.05 higher than that of a pool of pre- or nonimmune sample.
Following a series of four intranasal immunizations, the chimera elicited a salivary IgA response to PT (Fig. 2A). The titer of the anti-PT IgA antibodies was tripled following two additional immunizations. In contrast, the salivary IgA response to CtxB was much more rapid and greater in magnitude than the anti-PT response. IgA antibodies to PT and CtxB were also found in BAL and VW samples from animals immunized with the chimera (Fig. 2C). The animals that received the soluble pertussis toxoid (PTd) also demonstrated a mucosal IgA response, but the titers of antibody in saliva, BAL, and VW were three-, six-, and threefold lower (P = 0.05; Student's t test) than that from animals immunized with the chimera.
![]() View larger version (25K): [in a new window] |
FIG. 2. Immune responses following intranasal immunization with MBPS1S1CtxA2B. (A) Specific titers of IgA antibody in saliva. (B) Specific titers of IgG antibody in sera. (C) Specific titers of IgA antibody in BAL and VW. Symbols: , anti-PT antibodies; , anti-CtxB antibodies; , anti-PT antibodies in PTd-immunized samples. In panels A and B, for the PTd group, only samples from the last time point were assayed. Results are mean titers (± standard error; n = 5) for individual animal samples.
|
In vitro PT neutralization. The ability of the antiserum to neutralize the cytotoxic effect of PT was assessed by the CHO cell clustering assay using the method described previously (7). The neutralization titers (reciprocal of dilution which showed complete neutralization) for the preimmune and chimera-immunized sera (day 67) were <2 and 256, respectively. The neutralization titer for the Ptd sera (day 67) was 1,024. In comparison, the serum from a human subject (CD95) who had pertussis showed a neutralization titer of >4,096. The PT neutralization titer for the chimera-immunized serum is comparable to that for serum obtained from parenteral immunization using diphtheria toxin subunit A-S1 fusion protein (1) or S1-tetanus toxic fragment C fusion protein (2).
Protection in the mouse respiratory model. The ability of the chimera to confer protection in vivo was tested using the mouse respiratory model of B. pertussis infection (7). Briefly, cohorts of BALB/c mice were immunized as described above and were exposed to an aerosol of 5 x 108 CFU of virulent B. pertussis (Tohama)/ml at day 68. As shown in Fig. 3, the animals that were immunized with the chimera had a bacterial count in the lungs of 9.80 x 103 on day 7, which was significantly lower than the sham group's count of 1.86 x 105 bacteria (P = 0.01; Student's t test). The lung bacterial count for the pertussis toxoid group was 5.20 x 104 (P = 0.136 compared to the sham group and P = 0.135 compared to the chimera group). On day 15, the lung bacterial counts were 4.27 x 103, 7.87 x 103, and 1.48 x 103 for the chimera, sham, and pertussis toxoid groups, respectively.
![]() View larger version (22K): [in a new window] |
FIG. 3. Protection against B. pertussis respiratory infection in BALB/c mice. Each point represents mean (± standard error) for four or five animals. Day zero counts were determined for animals euthanatized within an hour after inoculation.
|
In conclusion, a divalent pertussis toxin S1 fragment fused to CtxA2B is an immunogenic antigen and can elicit protective immunity against B. pertussis infection in a mouse model. A similar strategy may be employed to investigate the mucosal immunogenicity and protective potential of other pertussis vaccine antigens.
This study is supported by an MRC/CIHR Regional Partnership Program grant with the IWK Health Centre. D. Salloum was a recipient of an IWK Graduate Studentship Award.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»