Previous Article | Next Article ![]()
Infection and Immunity, June 2003, p. 3320-3328, Vol. 71, No. 6
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.6.3320-3328.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Center for Molecular Medicine and Infectious Diseases, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061,1 Department of Basic Sciences, College of Veterinary Medicine, Mississippi State University, Mississippi State, Mississippi 397622
Received 7 October 2002/ Returned for modification 18 December 2002/ Accepted 10 March 2003
|
|
|---|
cps1N and strain 4074
cps1B, respectively. Strain 4074
cps1N produced no detectable CP, but strain 4074
cps1B made 15% of the serotype 1 CP made by the parent strain, 4074, as determined by enzyme-linked immunosorbent assay and precipitation of free CP. The cps1ABC genes of strain 4074 and the cps5ABC and cps5ABCDE genes of serotype 5a strain J45 were cloned into the shuttle vector pLS88 and electroporated into 4074
cps1N to produce 4074
cps1N(pABcps101), 4074
cps1N(pJMLcps53), and 4074
cps1N(pABcps55), respectively. Strain 4074
cps1N(pABcps101) produced about 33% of the serotype 1 CP produced by strain 4074. Strains 4074
cps1N(pJMLcps53) and 4074
cps1N(pABcps55) produced serotype 5a CP in similar quantity or in fourfold excess, respectively, to that produced by strain 4074. With intratracheal challenge in pigs at similar dosages, the order of virulence of strains producing serotype 1 CP (assessed by mortality, lung consolidation, hemorrhage, and fibrinous pleuritis) was the following: strain 4074 > strain 4074
cps1N(pABcps101)
strain 4074
cps1N > strain 4074
cps1B. Strain 4074
cps1N(pJMLcps53) was less virulent than strain 4074
cps1N(pABcps55). However, both strains produced serotype 5a CP in similar or greater quantities than was observed for production of serotype 1 CP by the parent strain, 4074, but were less virulent than the parent strain. Therefore, the amount of serotype 1 or 5a CP produced by isogenic strains of A. pleuropneumoniae correlated with the virulence of the bacteria in pigs. However, virulence was also influenced by the type of CP produced or by its mechanism of expression. |
|
|---|
Unlike encapsulated parent strains, nonencapsulated mutants of A. pleuropneumoniae derived by chemical mutagenesis (19), allelic exchange (55), or transposon mutagenesis (36) are attenuated in pigs, again indicating the importance of CP in virulence (19, 21). Variation in CP content may also contribute to differences in virulence among A. pleuropneumoniae isolates. In general, isolates with thick CP layers (determined by electron microscopy) appear to be more virulent. Jensen and Bertram (24) reported that serotype 5 isolate B8, which contained a fragile, less adherent CP, was less virulent than isolate I2000, which had a thick, well-adherent CP. Rosendal and MacInnes (39) also associated virulence with CP thickness by demonstrating that an attenuated strain (CM5A) derived after in vitro passage of a virulent serotype 1 strain (CM5) contained a thinner CP. Jacques et al. (23) and Steffens et al. (50) also observed that A. pleuropneumoniae strains containing a thicker CP were more virulent than those with a thinner CP. However, none of these strains was isogenic. Therefore, differences in virulence between strains or serotypes may be due to variation of other phenotypic traits. Furthermore, reproducible stabilization of the CP for electron microscopy can be difficult, and electron microscopy cannot provide a quantitative measurement of CP content, only the relative amount of CP associated with the cell.
The objective of the present study was to further clarify the relationship between CP production and virulence in A. pleuropneumoniae, using isogenic strains that differed only by the type or amount of CP produced. The virulence of these strains in swine was determined by an established intratracheal challenge. Our findings suggest that the virulence of A. pleuropneumoniae in pigs is influenced by the amount of CP and by the type of CP produced or its mechanism of expression.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids used
|
Recombinant DNA methods. Genomic DNA was isolated from A. pleuropneumoniae using a Qiagen Blood and Tissue DNA kit (Qiagen Inc., Valencia, Calif.). Plasmid DNA was isolated using plasmid mini or midi prep purification kits (Qiagen). Restriction digests, Klenow reactions, and ligations of DNA were performed as described elsewhere (42). Restriction enzymes were obtained from New England Biolabs (Beverly, Mass.). Ligated DNA or purified plasmid DNA was electroporated into E. coli and A. pleuropneumoniae strains with a BTX ECM-600 electroporator (BTX, Inc., San Diego, Calif.), as described previously (9, 55).
DNA sequencing and analysis. Nucleotide sequencing was done at the Virginia Bioinformatics Institute core sequencing facility with an ABI-377 automated system (Applied Biosystems, Foster City, Calif.) using BigDye Terminator Cycle sequencing (version 2.0) chemistry (Applied Biosystems). The nucleotide sequence was analyzed with DNASTAR analysis software (DNASTAR, Inc., Madison, Wis.). Sequence similarity searches of the EMBL/GenBank/DDBJ databases were performed using BLAST software (1) at the National Center for Biotechnology Information (Bethesda, Md.).
Mutation of the A. pleuropneumoniae cps region by allelic exchange.
The A. pleuropneumoniae serotype 1 cps DNA upstream of the region I CP export genes was identified by Southern blotting with 1.2-kb BamHI-XbaI fragment of pCW-1C that contained a portion of the cpxD gene (57). This cpxD-specific probe hybridized to a 5.0-kb EcoRI fragment of strain 4074 chromosomal DNA, which was cloned into the EcoRI site of pBluescript. The resulting plasmid was designated pGSAp11. The suicide vector, pAp12KB, was constructed as follows: a 3-kb cps (capsular polysaccharide synthesis) HindIII DNA fragment from pGSAp11 (Fig. 1) was cloned into a HindIII digest of pBluescript (Stratagene). The resulting plasmid (designated pABAp11) was digested with BglII to delete a 750-bp region spanning cps1AB (Fig. 1). The BglII sites on the 5.2-kb plasmid were filled in by reaction with Klenow enzyme and ligated to the 1.2-kb SalI fragment of pUC4K (also blunt ended) containing the Tn903 npt gene (34), which confers kanamycin resistance (Kanr) to A. pleuropneumoniae (52). The resulting suicide vector was designated pAp12KB. Electroporation of 9.6 x 109 CFU of log phase A. pleuropneumoniae strain 4074 (27, 55) with 1 µg of pAp12KB resulted in 43 Kanr colonies. Twenty-one of these transformants were noniridescent when visualized with obliquely transmitted light, suggesting that they were nonencapsulated. A probe specific for the ampicillin resistance (Ampr) gene of pBluescript was used in a colony blot to determine if a single- or double-crossover event had occurred. Eight of ten colonies contained the Ampr gene, suggesting that a single-crossover event had occurred in these transformants. Two other colonies did not hybridize with the Ampr probe, suggesting that a double-crossover event had occurred. One of these recombinant strains was chosen for further analyses and designated 4074
cps1N.
![]() View larger version (20K): [in a new window] |
FIG. 1. Physical map of pGSAp11 insert from A. pleuropneumoniae strain 4074. Solid-fill arrows indicate the location and direction of transcription of the two complete open reading frames (cps1AB), identified by sequencing. Solid-unfilled arrows indicate the location and direction of transcription of the incomplete cpsC and cpxD genes located on this DNA fragment. Shaded rectangles indicate the regions deleted by mutagenesis. Line arrows indicate locations of the primers used in PCR.
|
cps1B. PCR amplification and restriction enzyme digestion of the recombinant fragment indicated that the Kanr gene was in same orientation as the cps fragment in both plasmids pAp12KB and pGSAp11K (results not shown).
PCR.
PCR was used to confirm the deletion in the cps genes of recombinant strains 4074
cps1B and 4074
cps1N. The genes to which the primers were designed are shown in Fig. 1. The forward primer was CPS1U2 (5' ATGGGTTACCTTTATTGAT 3'), and the reverse primer was CPS1L3 (5' CCAATACATATCATAAAGAGCCG 3') (Genosys Biotechnologies, Inc., the Woodlands, Tex.). A 560-bp product was amplified by PCR as described previously (2, 29), with the exception that the annealing temperature was 50°C. Strains 4074
cps1B and 4074
cps1N were confirmed to be A. pleuropneumoniae serotype 1 by amplification of a 557-bp product from the 5' end of cps1A using primers CPS1U3 (5' CTTGGGTAGATGGTTCTGATCC 3') and CPS1L4 (5' AAGTGTGTACAAGTGGTGAGTCA 3') (Genosys Biotechnologies, Inc.); the annealing temperature was 59.5°C. Nonencapsulated, recombinant strain J45-100 (55), which lacks cps5aABC, was used as the negative control in PCR.
Expression of cps1ABC, cps5ABC, and cps5ABCDE in strain 4074
cps1N.
A 5-kb DNA fragment in pGSAp11 containing cps1ABC from strain 4074 was cloned into the broad-host-range vector pLS88 (58) to obtain pABcps101, which was electroporated into 4074
cps1N. Five of 31 Strr colonies analyzed by gel electrophoresis contained a plasmid of the expected size (data not shown). One of these colonies was designated 4074
cps1N(pABcps101) and used for further analyses.
The 8.2-kb fragment in pMLAp53 containing cps5ABCDE (55) was cloned into the HindIII site of the shuttle vector pLS88 (58) by blunt-end ligation, following fill-in reactions with Klenow, to obtain pABcps55. The resulting plasmid was introduced into the mutant strain 4074
cps1N by electroporation (27, 55). After recovery, the bacteria were cultured on TSY-N agar containing 80 µg of streptomycin/ml at 37°C. Fifteen Strr colonies were screened, and seven were found to contain a plasmid of the expected size (data not shown). One strain was selected for further investigation and designated 4074
cps1N(pABcps55).
Plasmid pJMLcps53, which contains cps5ABC (55), was electroporated into the mutant 4074
cps1N, and 9 of 15 Strr colonies were found to contain a plasmid of the expected size. One colony was selected for further study [4074
cps1N(pJMLcps53)] and was confirmed by Southern blotting to carry the 4.7-kb insert containing cps5ABC.
Determination of the CP content. Latex agglutination and sandwich enzyme-linked immunosorbent assay (ELISA) assays were performed as previously described (18, 55) to quantify CP. Optimal antibody concentrations were determined by checkerboard titration. Monospecific immunoglobulin G (IgG) to capsule was prepared by thorough adsorption of antiserum to whole cells by a nonencapsulated mutant of the same strain because the purified capsule was nonimmunogenic. Previous tests have shown that this IgG is absolutely serotype specific, whereas antibodies to LPS and membrane proteins are not (20). Reagents were added to polystyrene plates (Nunc, Inc., Naperville, Ill.) in the following order: 100 µl of 272-µg/ml monospecific rabbit IgG (18) to serotype 1 or serotype 5a CP in carbonate buffer, 200 µl of blocking buffer (phosphate-buffered saline [PBS] containing 0.05% Tween 20, 5% nonfat dry milk, and 10% normal goat serum), 100 µl of antigen containing 10,000 to 0.01 ng of purified CP or dilutions of bacterial culture/ml in blocking buffer, 100 µl of 2.5-µg/ml purified pig IgG to serotype 1 or serotype 5a CP in blocking buffer, 100 µl of a 1:3,000 dilution of goat anti-swine IgG conjugated to horseradish peroxidase (Jackson ImmunoResearch Laboratories, Inc., West Grove, Pa.), and 100 µl of 2,2'azinobis(3-ethylbenzthiazolinesulfonic acid peroxidase substrate (Kirkegaard & Perry Laboratories, Gaithersburg, Md.). All incubations were for 1 h at 37°C, except after addition of 2,2'azinobis(3-ethylbenzthiazolinesulfonic acid substrate, which was for 30 min at room temperature. Wells were washed five times in PBS-Tween 20 between each step. The absorbance at 405 nm was determined with a microplate reader (Molecular Devices Corp., Menlo Park, Calif.). Control wells for subtraction of background absorbance contained all reagents except antigen. All assays were done in quadruplicate. The mean CP content between strains was compared using the least-significant difference pair-wise comparison procedure (Statistical Analysis System Institute [49]), and a P value of < 0.05 was considered significant.
Serum bactericidal assay. The sensitivity of A. pleuropneumoniae to the bactericidal activity at 25% serum (precolostral calf serum) as source of complement was determined after 0 and 60 min of incubation at 37°C as described previously (56).
Challenge of pigs. The procedures adopted by the Animal Care Committee of the Virginia Polytechnic Institute and State University were followed in handling research animals. Crossbred piglets 7 to 9 weeks old were obtained from the Virginia Tech Swine Center, which is a closed research herd. Groups of pigs were housed in separate pens, with no direct physical contact permitted between groups. Broth-grown bacteria were harvested by centrifugation at 7,000 x g and resuspended to approximately 109 CFU/ml in PBS, determined spectrophotometrically. The inoculating dose was confirmed by viable plate counts. Pigs were challenged intratracheally with 5 ml of a dilution of this suspension following mild sedation with Stresnil (Pittman-Moore, Inc., Washington Crossing, N.J.). Any pigs appearing to suffer due to the challenge were euthanatized immediately with excess intravenous sodium pentobarbital. All the surviving pigs were euthanatized in the same manner 96 h after challenge. Pigs were necropsied as soon as possible after death or immediately after euthanasia. Lung lesions were scored on a scale of 0 to 100 as previously described (21). The mean lung lesion score of each group of pigs was compared using the least-significant difference pair-wise comparison procedure (Statistical Analysis System Institute [49]) and were considered significantly different at P values of <0.05. If blood was visible in the lungs, the respective pig was considered "hemorrhage positive." The severity of fibrinous pleuritis (defined as inflammation, discoloration, and fibrin deposition) was rated based on the percent area of the pleura affected. The severity of fibrinous pleuritis was considered slight, moderate, or severe if less than 10%, 10 to 25%, or greater than 25% of the pleura was affected, respectively. Lung samples were taken at necropsy from the right cranial-dorsal aspect of the caudal lobe and cultured on TSY-N for isolation of A. pleuropneumoniae.
Nucleotide sequence accession number. The nucleotide sequence accession number of the cpx1D, cps1A, cps1B, and cps1C genes have been deposited in the DDBJ, EMBL, and GenBank databases under accession number AF518558.
RESULTS
Identification and cloning of serotype-specific DNA.
The A. pleuropneumoniae serotype 1 cps DNA upstream of the region I CP export genes was identified by Southern blotting with a 1.2-kb BamHI-XbaI fragment of pCW-1C that contained a portion of the cpxD gene (57). This cpxD-specific probe hybridized to a 5.0-kb EcoRI fragment of strain 4074 chromosomal DNA, which was cloned into the EcoRI site of pBluescript. The resulting plasmid was designated pGSAp11. The nucleotide sequence of the 5-kb EcoRI fragment of pGSAp11 was found to contain three open reading frames, designated cps1A, cps1B, and cps1C, upstream and on the opposite strand from cpxD (Fig. 1) (GenBank accession no. AF518558). The AUG initiation codon of cps1A was 234 bases downstream from the AUG initiation codon of cpx1D. The AUG initiation codon of cps1B was 27 bases downstream from the UAA termination codon of cps1A, and the AUG initiation codon of cps5C was identified 198 bases downstream from the UAA termination codon of cps5B. Shine-Dalgarno ribosome-binding consensus sequences (45) were identified within eight bases upstream of the AUG initiation codons of cps1B and cps1C. Putative promoters containing sequences similar to the E. coli
70 -10 (TATAAT) and -35 (TTGACA) consensus sequences (16) were identified upstream of cps1A. The G+C content for the DNA region encoding cps1ABC was 28.2%, whereas the overall G+C content of the A. pleuropneumoniae genome is 42% (27).
The predicted molecular masses for Cps1A, Cps1B, and Cps1C were 43.2, 35.9, and 49.4 kDa, respectively. Hydropathy plots demonstrated that Cps1A, Cps1B, and Cps1C were relatively hydrophilic, suggesting that these proteins may be associated with the cytoplasmic compartment (analysis not shown). At the amino acid level, Cps1A shared 57% identity with the recently discovered protein LcbA (a member of a new protein family and involved in capsule biosynthesis) of Neisseria meningitidis (GenBank accession no. AAF21950), 34% with CpsY of Mycobacterium tuberculosis (6), and 34% with UDP-glucose-4-epimerase of Mycobacterium leprae (7). Cps1B exhibited 41% homology with the putative bifunctional polymerase protein of N. meningitidis, 35% with a teichoic acid biosynthesis protein of Bacillus subtilis (GenBank accession no. P46918), 32% with a teichoic acid biosynthesis protein of Listeria innocua (GenBank accession no. CAC96304), and 32% with a putative glycosyl transferase protein of Streptococcus agalactiae (GenBank accession no. AAK43612). Cps1C shared 36% identity with a teichoic acid biosynthesis protein of B. subtilis (GenBank accession no. P46918). Cps1A, Cps1B, and Cps1C did not share homology with any Cps proteins thus far identified for A. pleuropneumoniae serotypes 2 (M. L. Lawrence, T. J. Inzana, and C. K. Ward, Abstr. 78th Conf. Res. Workers Anim. Dis., abstr. 39, 1997), 5 (55), or 8 (J. A. Schuchert, T. J. Inzana, S. Jessing, and Ø. Angen, Abstr. 101st Gen. Meet. Am. Soc. Microbiol., abstr. Z-58, 2001.).
Production of capsule-deficient A. pleuropneumoniae strains by allelic exchange.
Primers specific for the regions deleted by mutagenesis (cps1AB and cps1B) (Fig. 1) amplified a 560-bp product from encapsulated strain 4074, but these primers did not amplify any product from recombinant strains 4074
cps1N or 4074
cps1B (Fig. 2). These results indicated that the mutant strains had lost part, or all, of the 750-bp cps1AB region or the 512-bp cps1B region, respectively, due to double-crossover events because strain 4074 carries only one copy of cps1AB (unpublished data). Primers specific for the region spanning cpxD and cps1A (Fig. 1) amplified a 557-bp product from strains 4074 and 4074
cps1N, indicating that these strains were A. pleuropneumoniae serotype 1 (Fig. 2).
![]() View larger version (31K): [in a new window] |
FIG. 2. Deletion of cps1AB in strain 4074 cps1N. (A) The primers CPS1U2 and CPS1L3 were used to amplify the region deleted by mutagenesis of cps1AB. (B) The primers CPS1U3 and CPS1L4 were used to amplify the region not deleted by mutagenesis. The strains used were the serotype 5a knockout mutant strain J45-100 as a negative control (lanes 2), the serotype 1 parent strain 4074 (lanes 3), and the serotype 1 knockout mutant strain 4074 cps1N (lanes 4).
|
cps1N, which contained a deletion in cps1AB, did not agglutinate sensitized latex particles conjugated to IgG specific for serotype 1 CP (Fig. 3), indicating that this strain could no longer synthesize CP. A quantitative analysis of the CP content of strains 4074, 4074
cps1B, and 4074
cps1N was performed by sandwich ELISA. The total amount of CP measured from strains 4074 and 4074
cps1B was 4.98 and 0.75 pg/CFU, respectively (Table 2). The difference in CP quantity determined by ELISA was supported by recovery of similar amounts of CP from culture supernatant following precipitation by hexadecyltrimethyl ammonium bromide. Latex agglutination tests confirmed that strain 4074
cps1B produced some serotype 1 CP. No CP was detected in strain 4074
cps1N by either assay (Fig. 3; Table 1). All three strains demonstrated similar amounts and electrophoretic profiles of ApxI, ApxII, outer membrane proteins, and LPS by gel electrophoresis (data not shown).
![]() View larger version (77K): [in a new window] |
FIG. 3. Qualitative determination of CP production. Latex beads conjugated to IgG specific for serotype 1 CP was used. The parent strain, 4074, producing serotype 1 CP, agglutinated with the beads, while the nonencapsulated mutant 4074 cps1N did not.
|
|
View this table: [in a new window] |
TABLE 2. Capsule production and degree of virulence in pigs of Ap serotype 1 isogenic strains
|
cps1N.
cps1N were resistant to killing by 25% precolostral calf serum (complement source). In contrast, the A. pleuropneumoniae serotype 5a nonencapsulated mutant strain J45-100 (55) was rapidly killed by the same concentration of serum (Fig. 4).
![]() View larger version (12K): [in a new window] |
FIG. 4. Bactericidal activity of precolostral calf serum for strains 4074, 4074 cps1N, and J45-100. The percent viability of each strain was evaluated 0 and 60 min after incubation at 37°C with 25% precolostral calf serum. Each data point represents the mean for three separate experiments performed in duplicate.
|
cps1N, strain 4074
cps1N(pABcps101) agglutinated latex particles sensitized with IgG to serotype 1 CP, indicating that serotype 1 expression had been complemented in trans (data not shown). Strain 4074
cps1N(pABcps101) produced 1.64 pg of serotype 1 CP/CFU (Table 2) as determined by ELISA.
Strains 4074
cps1N(pJMLcps53) and 4074
cps1N(pABcps55) agglutinated latex particles sensitized with IgG specific for serotype 5a CP but not particles sensitized with IgG specific for serotype 1 CP (Fig. 5). Analyses by sandwich ELISA indicated that strains 4074
cps1N(pJMLcps53) and 4074
cps1N(pABcps55) produced 4.24 and 23.04 pg of serotype 5a CP/CFU in mid-logarithmic phase, respectively (Table 2). There was no difference in growth rate or hemolytic activity between the parent and any of the recombinant strains (data not shown).
![]() View larger version (60K): [in a new window] |
FIG. 5. Qualitative determination of CP production by latex beads conjugated to IgG specific for serotype 5 CP. Strains 4074 and 4074 cps1N did not produce serotype 5 CP and did not agglutinate the beads, while the serotype 5 CP-producing chimeric strains 4074 cps1N(pABcps55) and 4074 cps1N(pJMLcps53) did agglutinate.
|
In trial 1, parent strain 4074 (producing 5.0 pg of CP/CFU) caused 66% mortality and 46% lung lesion consolidation with challenge in pigs at a dose of 8.2 x 106 CFU/pig. All challenged pigs showed moderate thoracic fibrinous pleuritis, while two of three pigs had hemorrhagic pleuritis. Strain 4074
cps1B produced almost 15% of the serotype 1 CP produced by strain 4074 and did not cause any pleuropneumonia-related deaths or hemorrhage in pigs when challenged at a similar dose. All challenged pigs did show slight fibrinous pleuritis, with an average lung consolidation score of 3.6%. Average lung consolidation scores differed significantly between strains 4074 and 4074
cps1B (P value, <0.001). When nonencapsulated mutant 4074
cps1N was administered at a challenge dose of 3.3 x 107 CFU/pig, 40% of pigs died and 30 to 80 ml of fluid was present in their lungs. Moderate to severe serofibrinous thoracic pleuritis was also present. All pigs had slight to moderate pleuritis and an average lung consolidation score of 45%. The type of lesions in each pig varied, but consisted of congestion, consolidation, and some hemorrhagic necrosis, suggesting that the lesions were due to the Apx toxins. All bacteria recovered from pigs challenged with strain 4074
cps1N were nonencapsulated, as determined by failure to agglutinate serotype 1-specific latex beads.
To determine if the difference in virulence between strains 4074
cps1B and 4074
cps1N was due to differences in the dose, the challenge dose of strain 4074
cps1B was increased and recombinant strain 4074
cps1N(pABcps101) was included at different dosages. At a dose of 1.7 x 107 CFU/pig, strain 4074
cps1B did not cause any pleuropneumonia-related deaths or hemorrhage in pigs. The average lung score in pigs challenged with this dose increased to 16%. Most of the challenged pigs showed moderate fibrinous pleuritis. Strain 4074
cps1N(pABcps101) produced about 67% less CP than strain 4074 and caused no mortality when challenged at 4.2 x 106 CFU/pig. Hemorrhage was reported from all pigs, and the average lung consolidation score was 21%. Various degrees of serofibrinous pleuritis occurred in all challenged pigs. When the dose of this strain was raised to 1.7 x 107 CFU, there was an average of 24.3% lung consolidation and hemorrhagic lesions occurred in two of three pigs. Pleuritis ranged from slight to severe. However, the overall difference of lung consolidation scores between strains 4074
cps1B and 4074
cps1N(pABcps101) was not statistically significant (P = 0.86).
In trial 3, parent strain 4074 at a challenge dose of 9.7 x 106 CFU caused 50% mortality and 62% lung consolidation in pigs. Hemorrhage was reported from 50% of the challenged pigs, while all pigs exhibited moderate to severe serofibrinous thoracic pleuritis. Nonencapsulated strain 4074
cps1N did not cause any pleuropneumonia-related mortality at a dose of 5.4 x 106 CFU, which was reduced from the dose given in trial 1. All challenged pigs were clinically normal and showed an average of 19.5% lung consolidation. None of the pigs exhibited hemorrhage in the lungs, but they developed slight to moderate thoracic fibrinous pleuritis. Average lung consolidation scores differed significantly between strains 4074 and 4074
cps1N (P < 0.001). Strain 4074
cps1N(pJMLcps53) produced 4.2 pg of serotype 5a CP/CFU and also caused no pleuropneumonia-related deaths at 5.0 x 106 CFU/pig. None of the challenged pigs exhibited hemorrhage or significant fibrinous pleuritis. The average lung consolidation score was 9.5%. In contrast, strain 4074
cps1N(pABcps55) produced 23 pg of serotype 5a CP/CFU and caused hemorrhage in three out of four challenged pigs at a dose of 4.7 x 106 CFU. All pigs challenged with this strain showed moderate serofibrinous thoracic lesions, with an average lung consolidation score of 37.7%, and one pig died due to severe pleuropneumonia. Average lung consolidation scores differed significantly between strains 4074
cps1N(pJMLcps53) and 4074
cps1N(pABcps55) (P < 0.001).
|
|
|---|
Both strain 4074 and the mutant strain 4074
cps1N were resistant to killing in precolostral calf serum, an antibody-deficient source of complement. Rioux et al. (36) reported that a nonencapsulated serotype 1 mutant made by transposon mutagenesis was also serum resistant. However, nonencapsulated mutants derived from serotype 5 by allelic exchange (55) and by chemical mutagenesis (20) are efficiently killed in precolostral calf serum (55, 56). A. pleuropneumoniae serotypes 1 and 5 differ in the nature of their LPS O-side chain (31). The O-side chain of serotype 1 is a branched, tetrameric repeating chain of glucose, rhamnose, and N-acetylglucosamine. In contrast, the O-side chain of serotype 5 is a galactose polymer (31). Therefore, the more complex O-side chain of serotype 1 LPS may limit the amount of specific antibody and C9 deposited on the bacterial surface. In support of this hypothesis, O-side-chain-deficient LPS mutants of A. pleuropneumoniae generated by transposon mutagenesis are sensitive to the bactericidal action of normal pig serum (15, 35).
We could complement CP production in mutant 4074
cps1N by introducing homologous and heterologous cps genes in trans. Complementation with cps1ABC restored serotype 1 CP production by the mutant 4074
cps1N by 33%, whereas introduction of the cps5 genes resulted in expression of serotype 5a CP. The amount of serotype 5a CP made by the recombinant strain 4074
cps1N(pJMLcps53) was similar to the amount of serotype 1 CP made by the parent strain, 4074. In contrast, the recombinant strain 4074
cps1N(pABcps55), which contained all five cps genes, produced greater than fourfold more serotype 5a CP. Apparently the presence of cps5ABC was sufficient for production of serotype 5a CP, but the addition of cps5DE enhanced the quantity of CP. There is a high degree of sequence homology between cps5DE and the kdsAB genes from other gram-negative bacteria. Therefore, cps5DE appears to be the functional equivalent of kdsAB. The kds genes are involved in synthesis of 3-deoxy-d-manno-2-octulosonic acid (KDO), a component of the LPS (32, 59), and serotype 5a CP (55). kdsA is a KDO 8-phosphate synthase, and kdsB is a CMP-KDO synthetase. Southern blot analysis indicated that serotype 1 carries one copy of the kdsA gene, whereas serotype 5a carries two copies (data not shown). The kdsA homologue present in 4074
cps1N was presumably being utilized to complete biosynthesis of serotype 5a CP in strains 4074
cps1N(pJMLcps53) and 4074
cps1N(pABcps55). However, strain 4074
cps1N(pABcps55) contained two copies of kdsA, which resulted in expression of more CP. Ward et al. (55) cloned the cps5ABC genes into the serotype 1 strain 4074, resulting in a recombinant strain that produced relatively little serotype 5a CP in log phase but greater amounts in stationary phase (in addition to serotype 1 CP). We postulated that during log phase, the kdsA gene product is utilized primarily for LPS biosynthesis and cell growth (32),whereas in late stationary phase, more of the kdsA gene product could be applied to the biosynthesis of serotype 5a CP (55). Therefore, consistent with these previous results, strain 4074
cps1N(pABcps55) would be expected to produce more serotype 5a CP due to the presence of two copies of the kdsA gene homologue.
The nonencapsulated and capsule-deficient serotype 1 mutants were highly attenuated in vivo, even though they were resistant to the bactericidal action of serum. Nonencapsulated mutants of A. pleuropneumoniae serotype 5a created by knockout mutagenesis (55) and chemical mutagenesis (19) are also avirulent compared to their encapsulated parent strains and are also serum sensitive. Thus, CP is essential for the virulence of A. pleuropneumoniae in pigs. However, CP was not required for serum resistance in serotype 1, and serum resistance was not sufficient for full virulence (4).
The results of pig challenges with isogenic strains expressing different amounts of CP show a correlation between A. pleuropneumoniae virulence and the amount of CP produced, regardless of whether the CP produced is derived from serotype 1 or serotype 5a. Although strains 4074
cps1B and 4074
cps1N were significantly attenuated in pigs, the small amount of CP made by strain 4074
cps1B did not make it more virulent than strain 4074
cps1N, which lacks any detectable CP. In fact, strain 4074
cps1N at twice the dose appeared to be more virulent than strain 4074
cps1B. However, small differences in the challenge doses of the same strains in different groups of pigs on different days can result in substantial variation in disease status. Therefore, innate differences in the susceptibility of the pigs in each group appeared to influence the pathogenesis of each strain more than small differences in the amount of CP produced. Furthermore, clinical signs do not always correlate well with gross pathology. Some pigs that were challenged with strains expressing more CP were euthanatized earlier due to more severe clinical symptoms but had less-severe fibrinous pleuritis and hemorrhaging than pigs challenged with strains producing less CP and that existed in the lungs for a longer period of time. The latter group of pigs may have had more-severe lesions due to a longer period of exposure to the Apx toxins. Larger groups of pigs would need to be challenged to confirm if the differences were specific to the bacterial strains. In contrast to the nonencapsulated and capsule-deficient strains, strain 4074
cps1N(pABcps101) produced 33% of the serotype 1 CP produced by strain 4074 and caused greater lung consolidation and higher levels of hemorrhaging and fibrinous pleuritis than the same dose of strain 4074
cps1B. Therefore, partial virulence could be restored when at least one-third of the CP expression was restored by complementation with cps genes in trans.
The virulence of strain 4074
cps1N expressing serotype 5a CP compared to that of strain 4074 was somewhat unexpected. The amount of CP5a produced in trans by strain 4074
cps1N(pJMLcps53) was similar to the amount of CP1 produced by strain 4074. However, when strain 4074
cps1N(pJMLcps53) was administered intratracheally, none of the pigs died and there was no hemorrhage in the lungs, but some minor lung lesions and consolidations were noted. However, strain 4074
cps1N(pABcps55) produced approximately four times more CP5a than strain 4074
cps1N(pJMLcps53) and caused mortality, hemorrhaging, and greater lung consolidation and pleuritis in challenged pigs. These results clearly indicate that the virulence of A. pleuropneumoniae is influenced by the amount of CP it produces, and they support other studies suggesting a relationship between A. pleuropneumoniae virulence and the amount of CP produced (23, 24, 38, 50). However, this is the first study to demonstrate this association using isogenic strains. The results also suggest that the type of CP may also be important in virulence. Serotype 1 is considered by many to be the most virulent serotype (4, 25, 38), which was supported in this study. However, since the serotype 5a CP was expressed in trans it is possible that the CP was not as integrally associated with the bacterial cell membrane or was in some other way unable to mimic all of the protective functions of CP synthesized in cis.
In conclusion, CP synthesis is essential to the virulence of A. pleuropneumoniae. However, the amount of CP produced by a strain can influence its degree of virulence. The type of CP or whether the CP is produced in trans may also influence the bacterium's virulence. Therefore, the virulence of A. pleuropneumoniae in pigs was influenced by the amount and possibly the type of CP synthesized.
This work was supported by National Research Initiative grant 98-35204-6811 from the Cooperative State Research, Education, and Extension Service of the United States Department of Agriculture and by Hatch formula funds to the Virginia Agricultural Experiment Station.
|
|
|---|
-2,8 polysialic acid capsule by Neisseria meningitidis serogroup B. Mol. Microbiol. 14:141-149.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»