Previous Article | Next Article 
Infection and Immunity, June 2003, p. 3419-3428, Vol. 71, No. 6
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.6.3419-3428.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Antigenic Composition of Borrelia burgdorferi during Infection of SCID Mice
Timothy R. Crother,1,2* Cheryl I. Champion,1,2 Xiao-Yang Wu,1,2 David R. Blanco,1,2 James N. Miller,2 and Michael A. Lovett1
Departments of Medicine,1
Microbiology, Immunology, and Molecular Genetics, University of California, Los Angeles, Los Angeles, California2
Received 6 November 2002/
Returned for modification 16 December 2002/
Accepted 7 March 2003

ABSTRACT
The general concept that during infection of mice the
Borrelia burgdorferi surface protein composition differs profoundly from
that of tick-borne or in vitro-cultivated spirochetes is well
established. Specific knowledge concerning the differences is
limited because the small numbers of spirochetes present in
tissue have not been amenable to direct compositional analysis.
In this report we describe novel means for studying the antigenic
composition of host-adapted
Borrelia (HAB). The detergent Triton
X-114 was used to extract the detergent-phase HAB proteins from
mouse ears, ankles, knees, and hearts. Immunoblot analysis revealed
a profile distinct from that of in vitro-cultivated
Borrelia (IVCB). OspA and OspB were not found in the tissues of SCID
mice 17 days after infection. The amounts of antigenic variation
protein VlsE and the relative amounts of its transcripts were
markedly increased in ear, ankle, and knee tissues but not in
heart tissue. VlsE existed as isoforms having both different
unit sizes and discrete lower molecular masses. The hydrophobic
smaller forms of VlsE were also found in IVCB. The amounts of
the surface protein (OspC) and the decorin binding protein (DbpA)
were increased in ear, ankle, knee, and heart tissues, as were
the relative amounts of their transcripts. Along with these
findings regarding VlsE, OspC, and DbpA, two-dimensional immunoblot
analysis with immune sera also revealed additional details of
the antigenic composition of HAB extracted from ear, heart,
and joint tissues. A variety of novel antigens, including antigens
with molecular masses of 65 and 30 kDa, were found to be upregulated
in mouse tissues. Extraction of hydrophobic
B. burgdorferi antigens
from tissue provides a powerful tool for determining the antigenic
composition of HAB.

INTRODUCTION
Several key developmental events mark the transmission of
Borrelia burgdorferi from feeding ticks to mammalian hosts. As ticks
ingest a blood meal, synthesis of the surface protein OspA is
downregulated as midgut spirochetes multiply and migrate to
the salivary glands. In parallel, synthesis of another surface
lipoprotein, OspC, is enhanced (
13,
46). After transmission,
OspA synthesis remains repressed (
4,
12,
37). Antigenic variation
of the surface lipoprotein VlsE is initiated (
60) and is likely
to be an important facet of
B. burgdorferi virulence (
29,
41).
Recently, it has been shown that
ospC synthesis wanes in apparent
response to the synthesis of OspC antibody by infected mice
(
31). There has been growing appreciation that surface changes
that distinguish host-adapted
Borrelia (HAB) from tick-borne
B. burgdorferi are likely to be related to protective immunity
(
47).
Much effort has therefore been directed at defining the structural differences between HAB and in vitro-cultivated Borrelia (IVCB). The small numbers of HAB found in the tissues of infected mice have been regarded as insufficient for direct protein and antigenic analysis. PCR-based methods have detected 3 x 105 spirochetes per mg of mouse ear DNA (2), as well as 106 spirochetes per mg of heart DNA and 3 x 105 spirochetes per mg of joint DNA in both C3H and C3H-SCID mice (2, 35, 57). Because mouse ears, hearts, and joints contain severalfold less than 1 mg of DNA (Champion, unpublished observations) and because there may be many copies of the chromosome in each spirochete (26, 47), the actual numbers of HAB in a mouse may be less than the numbers given above seem to indicate.
A variety of genetic approaches have therefore been employed to search for genes differentially expressed by HAB and IVCB. In two recent studies the researchers examined genes downregulated during infection in response to immune pressure (31, 34). Liang et al. showed that ospC is downregulated soon after infection of immunocompetent mice but not after infection of SCID mice (31). Liang and colleagues used reverse transcription PCR (RT-PCR) to determine whether 137 lipoprotein genes were expressed during skin infection of normal and SCID mice; 97 of these genes were downregulated in immunocompetent mice (34). The genes upregulated during infection include eppA (7), pG (55), bbk2.1 (1), ospE paralogues (54), p35 or the gene encoding fibronectin binding protein, bbk32 (16, 40, 53), and p37 (53), as well as dbpA (6, 21). However, because HAB strains have not been available for direct study, the full set of genes upregulated during infection, the quantitative extent of upregulation, and the cellular location of upregulated proteins have remained unknown or have been inferred. There has been only one study in which intact HAB strains were used for structural analysis of any sort. Using immunofluorescence, Montgomery and colleagues showed that OspC could be detected on the surface of B. burgdorferi recovered from mice by peritoneal washing (37). Pathogenic mechanisms that have been elucidated, such as VlsE antigenic variation, have been examined by using genetic strategies (58-60) rather than direct analysis of HAB.
In this report, we describe new methods that allow direct determination of the HAB protein composition in ear, joint, and heart tissues of immunodeficient mice. By extracting hydrophobic HAB proteins from tissues and then performing immunoblotting with two-dimensional gels, we were able to visualize the constellation of major changes that comprise the early stage of spirochetal adaptation to the host environment.

MATERIALS AND METHODS
Bacterial strains.
Virulent
B. burgdorferi sensu stricto strain B31 was isolated
from infected rabbit skin and grown at 34°C in BSKII supplemented
with 6% normal rabbit serum as described previously (
17). Low-passage
(

3 passages) virulent B31 was used in all experiments. Strain
ME3-2 is a B31 clonal isolate that was grown from SCID mouse
blood and lacks
vlsE (data not shown).
Infection of C3H SCID mice with B. burgdorferi.
Seven-week-old C3HSmn.CB17-Prkdcscid/J (C3H SCID) mice (Jackson Laboratory, Bar Harbor, Maine) were inoculated intradermally with 107 virulent B. burgdorferi B31 cells. Seventeen days later, the animals were sacrificed, and the ears, ankles, knees, and hearts were collected and snap frozen in an ethanol-dry ice bath.
RT-PCR.
A DNeasy tissue kit from Qiagen (Valencia, Calif.) was used according to the manufacturer's instructions to obtain genomic DNA from tissue samples and IVCB. Purified DNA samples were ethanol precipitated and resuspended in 50 µl of water. Primers and probes were selected for the flagellin gene (GenBank accession no. AE001126) for use in quantitation of B. burgdorferi strain B31 in infected tissues. The upstream primer for flaB corresponds to the region from base 579 to base 602 (TGTTGCAAATCTTTTCTCTGGTGA) of the open reading frame. The downstream primer corresponds to the region from base 635 to base 656 (CCTTCCTGTTGAACACCCTCTT). The probe corresponds to the region from base 609 to base 631 (TCAAACTGCTCAGGCTGCACCGG). The nidogen gene (exon 2) was selected for murine tissue quantitation (GenBank accession no. L17323). The upstream primer for nidogen-1 corresponds to the region from base 86 to base 105 (CACCCAGCTTCGGCTCAGTA) of the open reading frame. The downstream primer corresponds to the region from base 133 to base 148 (TCCCCAGGCCATCGGT). The probe corresponds to the region from base 107 to base 131 (CGCCTTTCCTGGCTGACTTGGACAC). The probes were labeled with 6-carboxyfluorescein at the 5' end and with 6-carboxy-N,N,N',N'-teramethylrhodamine at the 3' end. The primers were purchased from Invitrogen (Carlsbad, Calif.), and the probes were purchased from Qiagen. TaqMan universal PCR master mixture (Applied Biosystems, Foster City, Calif.) was used for all reactions. Each reaction mixture (25 µl) contained each primer at a concentration of 900 nM and the probe at a concentration of 250 nM. Amplification and detection were performed with an ABI 7700 system by utilizing the following parameters: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The fluorescence was monitored continuously. The data were analyzed, and the cycle threshold value was determined by using the ABI Sequence Detection System software, version 1.9. Flagellin and nidogen reactions were performed in separate wells. One hundred nanograms of DNA from infected tissue was used for most reactions; the exceptions were the reactions for the ear tissue, for which 10 ng was used. The amounts of B31 and mouse DNA were calculated based on standard curves for a 6-log dilution series for B. burgdorferi and a 4-log dilution series for mouse DNA (Novagen, Madison, Wis.). Values for the B31 standard curve were obtained in the presence of 100 ng of mouse DNA. The copy number of each sample was determined by plotting the cycle threshold value versus the log of the copy numbers included in each standard curve. All samples were examined in triplicate. No-template controls were included with every assay for each primer set.
RT-PCR analysis of vlsE, ospC, and dbpA in HAB and IVCB.
In order to determine the relative amounts of VlsE, OspC, and DbpA in HAB and IVCB, RT-PCR was performed as described previously (47). In this study, the flagellin subunit gene flaB was used as a normalizing control for HAB and IVCB. The following primer sets were used for the PCR: flaB forward (5' CTGGCAAGATTAATGCTCAA 3') and flaB reverse (5' CAGGAGAATTAACTCCACCT 3'); OspC forward (5' GAAAAAGAATACATTAAGTGC 3') and OspC reverse (5' CTTGTAAGCTCTTTAACTGAA 3'); DbpA forward (5' TAACTATACTTGTTAACCTAC 3') and DbpA reverse (5' AGTTTCTTTGAGTTTAGTAGC 3'); and VlsE forward (5' AGATGATAACTTATACTTTTCATTA TAAGGAGACG 3') and VlsE reverse (5' ACGGCAGTTCCAACAGAACCTGTACTATCT 3'). The PCR conditions were as follows: 94°C for 10 min to activate the AmpliTaq Gold (Perkin-Elmer, Norwalk, Conn.), followed by 40 to 45 cycles of denaturation at 94°C for 1 min, annealing at 48°C for 1 min, and elongation at 72°C for 1 min.
Extraction of hydrophobic HAB antigens from B31-infected tissues.
Infected tissue was homogenized in a PowerGen 125 tissue grinder (Fisher Scientific Co., Pittsburgh, Pa.) in 10 mM Tris (pH 8.0)-1 mM EDTA-1 mM phenylmethylsulfonyl fluoride (approximately 50 mg of tissue/ml). Triton X-114 was added to a final concentration of 3%, and the samples were incubated overnight at 4°C with gentle rocking. Insoluble material was pelleted by centrifugation for 30 min at 16,000 x g at 4°C. The cell-free lysate was then incubated at 37°C for 5 min, and this was followed by centrifugation at 3,400 x g for 15 min at room temperature in order to generate aqueous and detergent phases. The detergent phase was washed three times with 10 mM Tris-1 mM EDTA (pH 8.0). IVCB were washed three times with phosphate-buffered saline and resuspended in 10 mM Tris (pH 8.0)-1 mM EDTA-1 mM phenylmethylsulfonyl fluoride. Triton X-114 extraction and precipitation were performed as described above. For sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) analysis, detergent-phase samples were precipitated by mixing them with 3 volumes of -20°C acetone and incubated at -20°C for 2 h. The precipitate was pelleted by centrifugation for 30 min at 16,000 x g and 4°C. The pellet was air dried and resuspended in final sample buffer. For two-dimensional electrophoresis analysis, detergent-phase samples were precipitated by addition of three volumes of 10% trichloroacetic acid-20 mM dithiothreitol (DTT) in -20°C acetone and incubated at -20°C for 2 h. The precipitate was pelleted by centrifugation at 16,000 x g for 30 min at 4°C, and the pellet was washed once with -20°C acetone containing 20 mM DTT. The pellet was then air dried and resuspended in 7 M urea-2 M thiourea-1% amidosulfobetaine-14 (8, 36).
SDS-PAGE and immunoblot analysis.
Protein samples were separated by SDS-PAGE (12% acrylamide) by using the Laemmli method (30). The proteins were transferred to polyvinylidene difluoride membranes and stained with amido black. The membranes were probed with either immune rabbit serum (IRS) (diluted 1:1,000),
OspC (diluted 1:1,000),
VlsE (diluted 1:2,000),
DbpA (diluted 1:2,000),
BmpA (diluted 1:10,000),
LA7 (diluted 1:10), or mouse serum (diluted 1:1,000), each diluted in phosphate-buffered saline containing 0.05% Tween 20 and in 5% nonfat dry milk. For OspC, LA7, and mouse serum from B31 chronically infected mice (CMS), horseradish-linked sheep anti-mouse secondary antibody (Amersham Biosciences) was used at a dilution of 1:2,500 as a secondary antibody. For all other analyses, horseradish-linked donkey ant-rabbit antibody (Amersham Biosciences) was used at a dilution of 1:2,500. Visualization was performed with the ECL Plus system from Amersham Pharmacia Biotech and an Alpha Innotech Fluorchem 8000 imager. Band densitometry was performed with the Fluorchem imaging software (version 2.0). The following individuals provided antisera: Steven Norris, University of Texas at Houston (
VlsE) (unpublished data); Steven Callister, Gundersen Lutheran Medical Center (
OspC) (44); Felipe Cabello, New York Medical College (
BmpA) (unpublished data); and Magnus Hook, Texas A&M University (
DbpA) (20). Anti-LA7 monoclonal serum was provided by the Institut für Immunologie, Heidelberg Germany (19, 56). IRS was obtained from rabbits with complete infection-derived immunity to reinfection (17, 18, 48).
Immobilized pH gradient two-dimensional electrophoresis (IPG-2DE).
Protein samples were analyzed by two-dimensional electrophoresis by using the IPGPhor-2D system from Amersham Pharmacia Biotech. Acetone pellets were resuspended in 7 M urea-2 M thiourea-1% ASB-14. DTT was added to a concentration of 20 mM prior to loading onto the first dimension (immobilized pH gradient), along with the appropriate pH range immobilized pH gradient buffer (pH 3 to 10) at a concentration of 0.05%. Samples were included directly in the rehydration buffer and allowed to swell the immobilized pH gradient strip overnight (30 V, 20°C) or were loaded directly onto the swollen strip (18 cm) via cup loading. The isoelectric focusing parameters were as follows: (i) 1 min at a 500-V gradient, (ii) 1.5 h at a 4,000-V gradient, and (iii) 8,000 V for 40,000 V · h, with a 50-µA/strip maximum setting at 20°C. The completed first-dimension strip was separated by conventional SDS-12% PAGE, and the proteins were transferred to polyvinylidene difluoride for immunoblotting as described above.

RESULTS
Quantitation of B. burgdorferi in SCID mouse tissues.
C3H SCID mice were infected with 1
x 10
7 B. burgdorferi B31
cells (passage two) and were sacrificed 17 days later, as described
in Materials and Methods. In order to determine the number of
spirochetes present in infected tissues, RT-PCR was performed
with samples of ears, ankles, knees, and hearts (Table
1). The
values shown in Table
1 were derived from three separate animals
and indicate that the tissues investigated contained 5,400 to
9,900
Borrelia cells per µg of mouse DNA. We estimated
that these values correspond to approximately 1
x 10
5 to 5
x 10
5 Borrelia cells per ear, ankle, knee, or heart.
Extraction of HAB antigens from SCID mouse tissues by Triton X-114 phase partitioning.
HAB antigens were extracted from the infected tissues (ear,
ankle, knee, and heart) with Triton X-114, as described Materials
and Methods. Triton X-114 detergent-phase-derived samples representing
one-half of an individual tissue structure (ear, ankle, knee,
or heart) were analyzed by SDS-PAGE and immunoblotted with serum
from rabbits immune to reinfection (IRS) (
17). Figure
1 shows
the antigenic profiles of 10
5 IVCB cells and of HAB cells extracted
from mouse ears, ankles, knees, and hearts. IRS detected OspA
and OspB in 10
5 IVCB cells but did not detect OspA and OspB
in the infected tissues. The antigenic profile of HAB is clearly
distinct from that of IVCB. A band with the molecular mobility
of VlsE (43 kDa) was detected in ear, ankle, and knee tissues
but was not detected in heart tissue or in 10
5 IVCB cells. A
band with the molecular mobility of OspC (22 kDa) was detected
faintly in ear tissue and strongly in heart tissue. The identities
of these bands were confirmed with monospecific VlsE and OspC
antisera, as described below. Uninfected SCID mouse tissues
that were processed identically did not react with IRS (data
not shown).
Relative amounts of VlsE, DbpA, and OspC in infected tissues and IVCB.
To assess the amounts of VlsE, DbpA, and OspC found in SCID
mouse tissues relative to the amounts in IVCB, an immunoblot
analysis was performed by using monospecific antisera, as shown
in Fig.
2. As described above, the tissue samples analyzed each
represented one-half of an individual tissue structure (ear,
ankle, knee, heart). VlsE was readily detected in 5
x 10
6 IVCB
cells but was barely detected in 5
x 10
5 IVCB cells (Fig.
2A).
Both unit-size and smaller forms of VlsE were found in ear,
ankle, and knee tissues and in 5
x 10
6 IVCB cells. The amount
of VlsE detected in one-half a heart was similar to the amount
found in 5
x 10
5 IVCB cells. Given the numbers of HAB cells
detected in knees (Table
1), it is clear that VlsE is much more
abundant in HAB cells found in knee tissues than in a corresponding
number of IVCB cells. While IVCB and HAB both contained smaller
VlsE forms whose sizes were similar, the relative proportion
of the smaller forms of VlsE detected in the ear and ankle tissue
samples was greater than in IVCB. In conditions under which
OspC was barely detected in 5
x 10
6 IVCB cells and was not detected
in 5
x 10
5 IVCB cells, it was readily detected in the comparable
numbers of HAB cells found in heart tissue and was also prominent
in ear tissue (Fig.
2B). In conditions under which DbpA was
barely detectable in 5
x 10
6 IVCB cells and was undetectable
in 5
x 10
5 IVCB cells, it was readily detected in all the infected
tissues except the ear (Fig.
2C). Uninfected SCID mouse tissues
that were processed identically did not react with IRS (data
not shown).
Multiple sizes and isoforms of VlsE in tissue samples and IVCB.
VlsE is known to undergo antigenic variation during infection
(
60). To assess the number of VlsE isoforms in tissues and to
further characterize the smaller forms of VlsE whose existence
was revealed by the one-dimensional immunoblot shown in Fig.
2A, the SCID mouse tissue samples were analyzed by IPG-2DE (Fig.
3). Monospecific polyclonal VlsE antiserum detected multiple
isoforms of unit-size VlsE in IVCB and in each of the tissue
samples. It should be noted that the B31 strain used to infect
the mice was not clonal with regard to the
vlsE loci. Smaller
forms of VlsE were also found in each of the tissue samples
(Fig.
3A to D) and in IVCB (Fig.
3E). Like unit-size VlsE, the
smaller forms were also present as multiple isoforms. The relative
amounts of the lower-molecular-mass forms varied among the tissue
samples; ear tissue contained the highest proportion of the
lower-molecular-mass forms relative to unit-size VlsE, and heart
tissue contained the lowest proportion of the lower-molecular-mass
forms relative to unit-size VlsE. The smaller VlsE forms that
were readily detected with VlsE antiserum were not detected
with IRS (Fig.
1).
In order to determine if the smaller forms of VlsE were artifacts
of the extraction process, intact IVCB cells were solubilized
directly in buffer containing 7 M urea, 2 M thiourea, and 1%
ASB-14 for analysis by IPG-2DE. As shown in Fig.
3F, smaller
VlsE forms were readily detected. To determine if the smaller
forms of VlsE were the result of cross-reactivity between the
sera and
Borrelia proteins other than VlsE, a B31 clonal isolate,
ME3-2, which lacks linear plasmid 28.1 and therefore cannot
express
vlsE, was also analyzed with the monospecific VlsE antiserum
(Fig.
3G). After a longer exposure (10 min, compared with 1
to 2 min for the other samples) only a single species was observed
around 40 kDa, which did not correspond to unit-size VlsE or
its smaller forms. Because immune rabbit serum did not bind
the smaller VlsE forms (Fig.
1), we probed an immunoblot of
ear tissue infected with CMS. The pattern of reactivity of CMS
with infected ear tissue (Fig.
3I) showed striking overlap with
the pattern of reactivity of the rabbit polyclonal monospecific
VlsE antiserum with ear tissue (Fig.
3A). The smaller forms
of VlsE were also found in infected rabbit skin and were detectable
with CMS (data not shown).
Relative amounts of vlsE, dbpA, and ospC transcripts in HAB and IVCB.
The findings presented above provide a measure of the relative amounts of VlsE, DbpA, and OspC found in SCID mouse tissues and in IVCB. We also determined the relative amounts of the transcripts by RT-PCR as described in Materials and Methods. IVCB cells were added to normal mouse tissue and processed in the same way as the infected tissue (Fig. 4). In conditions under which approximately equal amounts of the flaB product were detected in IVCB and in infected ear, knee, ankle, and heart tissues, vlsE, ospC, and dbpA products were detected in the infected tissues but not in identically processed IVCB. These findings indicate that transcription of these genes is upregulated during infection. ospC and dbpA products were most prominently detected in infected ankle and ear tissues, respectively. The relative amounts of vlsE, ospC, and dbpA transcripts with respect to each other varied considerably from tissue to tissue in conditions under which flaB detection was constant. The amount of dbpA transcripts in ear tissue was not in accord with the relative paucity of DbpA detected in ear tissue by immunoblotting (Fig. 2C).
HAB antigenic composition revealed by IPG-2DE and immunoblotting with IRS.
In the experiments described above we assessed the process of
B. burgdorferi host adaptation insofar as it extends to OspA,
OspB, VlsE, DbpA, and OspC, surface proteins that have been
the focus of extensive study by workers in the
Borrelia field.
Our findings are the first direct demonstration that the amount
of VlsE is markedly increased relative to the amount in IVCB,
a finding that is not surprising given the possible importance
of VlsE as a virulence factor during infection (
29,
41). To
obtain a broader view of the antigenic changes that comprise
host adaptation, we analyzed SCID mouse tissues, extracted with
Triton X-114 as described in Materials and Methods, by IPG-2DE
and immunoblotting with IRS. Figure
5 shows the antigenic profiles
of 10
7 IVCB cells and of ear samples (derived from 10 ears),
ankle samples (derived from 2.5 ankles), and heart samples (derived
from two hearts), as determined by probing immunoblots with
IRS. OspA and OspB were the most prominent hydrophobic constituents
of IVCB detected with IRS (Fig.
5A). OspA and OspB were not
detected in any of the tissue samples (Fig.
5B to D). The positions
of BmpA, OspC, and LA7 were determined by probing parallel tissue
immunoblots with the individual monospecific antisera; spot
matching was performed with ImageMaster software (APBiotech).
These individual monospecific sera were found to react with
only a single band when they were used to probe an immunoblot
of IVCB cells separated by SDS-PAGE. The gene encoding BmpA
(basic membrane protein A) is part of a cluster of paralogous
genes whose function is unknown (
14,
49,
50). LA7, originally
identified as a
Borrelia antigen that is reactive with a monoclonal
antibody, is a lipoprotein that is believed to be localized
to the outer membrane (
19,
27,
56). The function of this protein
has not been determined yet. IRS detected prominent unit-size
VlsE isoforms in ear and ankle tissues. (IRS, as shown above,
does not bind the smaller forms of VlsE in two-dimensional immunoblots,
and CMS strongly binds the smaller VlsE forms found in ear tissue,
as shown in Fig.
3I.) The failure of IRS to detect VlsE in heart
tissue was striking and corroborates the immunoblot findings
shown in Fig.
1 and
2 obtained with monospecific VlsE antiserum.
OspC was the most prominent antigen found in heart tissue. IRS
detected BmpA in IVCB and in ear, ankle, and heart tissues.
IRS detected LA7 in IVCB and in ear tissue. IRS detected an
approximately 65-kDa antigen in ear, ankle, and heart tissues
but not in IVCB. It appears that there are many isoforms of
this antigen, and it is possible that more than one protein
reacts with the IRS. Heart tissue contained a novel 30-kDa antigen
not detected by IRS in IVCB.
In addition to these proteins that appear to be upregulated
during mammalian infection, IRS reacted with antigens found
in both IVCB and tissues; these antigens had molecular masses
of 58, 18.9, 16.7, and 14.8 kDa (Fig.
5). The 14.8-kDa antigen
is particularly reactive in both IVCB and tissue. The identities
of these protein species are unknown, and the proteins are being
studied. Uninfected SCID mouse tissues processed identically
were probed with IRS, and no cross-reactivity was found (data
not shown). Additionally, normal rabbit skin spiked with IVCB
cells and processed in the same manner showed no difference
in IRS reactivity when it was compared with IVCB cells alone
(data not shown).

DISCUSSION
Understanding the membrane protein changes that
B. burgdorferi undergoes after transmission to vertebrate hosts has become
an important goal of Lyme disease research. Underscoring the
importance of this goal is the fact that immunity to challenge
with IVCB does not necessarily correspond to immunity to HAB
in mice (
4) and rabbits (
47). The fact that relatively small
numbers of spirochetes are present in the tissues of infected
mice (
2,
35,
57) has been a significant obstacle to direct compositional
analysis of HAB. No method has been described to release intact
spirochetes from tissue. Montgomery et al. recovered HAB from
mice by peritoneal lavage and reported detection of surface
OspC by immunofluorescence (
37). There has been no other such
direct analysis of HAB surface antigenic structure. Microarray
technology has been used recently to explore differential expression
of
B. burgdorferi genes under different environmental conditions
during in vitro cultivation (
33,
45). In a recent elegant study,
Fikrig and colleagues used a microarray system to assess expression
of 137 genes encoding lipoproteins in immunodeficient and immunocompetent
mice (
34). All but 40 of these genes were downregulated after
infection in immunocompetent mice, presumably as a response
to host immunity.
In this report, we describe a novel approach for determining the hydrophobic antigen composition of HAB in infected tissue. This approach, termed hydrophobic antigen tissue Triton extraction (HATTREX), was used to determine the amounts of VlsE, DbpA, and OspC in tissue in relation to the relative amounts in IVCB. HATTREX is based on the fact that most B. burgdorferi membrane proteins are hydrophobic (52), although there are exceptions, such as the channel-forming protein P66 (Oms66) (51), which is believed to be an integrin binding protein (9). Triton X-114 phase partitioning has been employed for a long time to obtain a membrane protein-enriched fraction from pathogenic spirochetes (11, 42, 43). In this study, Triton X-114 extraction of infected SCID mouse tissues followed by phase partitioning proved to be a remarkably effective way of concentrating the small numbers of HAB cells (about 105 spirochetes) found in individual biological structures, such as a mouse heart, ear, ankle, or knee joint, for antigenic analysis by immunoblotting. HATTREX works because only a small proportion of mouse tissue proteins are hydrophobic, whereas most HAB antigens of interest are hydrophobic. Analysis of HAB antigens in the hydrophilic or aqueous phase has been problematic because the large amount of mouse protein relative to the amount of HAB hydrophilic protein can result in overloading of gels. The findings presented here were restricted to analysis of hydrophobic detergent-phase antigens. Because flagellin is a hydrophilic protein, it could not be included as a reference for a protein whose abundance should be constant under different environmental conditions. It should also be noted that a limitation of conclusions that can be drawn after use of HATTREX is related to the fact that this method is a method for determining antigenic composition and does not assess the antigenic structure of the intact spirochete. Cox and colleagues have shown that the surface exposure of OspA is far less than its compositional abundance suggests (10). Abundance, as shown by HATTREX and immunoblotting, does not differentiate between surface and subsurface hydrophobic antigens. It is also conceivable that some proportion of the antigens detected by HATTREX could have an extracellular location (for example, in the form of membrane blebs).
At this time, OspC (23, 28, 31), DbpA (6, 22, 23), and the antigenic variation protein VlsE (15, 24, 32, 39) are the most intensively studied B. burgdorferi membrane proteins. While it has been established that VlsE antigenic variation occurs only during mammalian infection (24) and that the VlsE-encoding plasmid Lp28-1 is important to the virulence of B. burgdorferi during infection of mice (29, 41), VlsE is not an abundant constituent of IVCB, and there have been no reports of the degree of VlsE expression during infection. The hydrophobic antigen composition of HAB revealed by the HATTREX approach is distinctly different from that of IVCB. HAB cells lack detectable OspA and OspB. In this regard our findings are not in accord with a recent report which demonstrated that ospB transcripts are present throughout infection of immunodeficient mice (34). It is striking that VlsE is the most abundant hydrophobic antigen of HAB extracted from ear and joint tissues, as judged by immunoblotting with IRS, while it is an undetectable constituent of IVCB probed with the same antiserum under identical conditions. Equally striking is the consistent observation in three separate experiments of the paucity of VlsE in heart tissue. One possible explanation for this could be the presence of a protease in the heart tissue that is not as abundant as it is in other tissues. Alternatively, regulation of VlsE could be tissue specific. It will be interesting to ascertain the level of VlsE expression in the hearts of immunocompetent mice. While OspC is a prominent constituent of HAB in SCID mouse ear, heart, and joint tissues, Liang and colleagues have shown that OspC synthesis decreases in response to the development of specific antibodies by immunocompetent mice, as discussed below (31).
The antigenic profiles of HAB provide a relative indication of spirochetal proteins that are far more abundant than they are in IVCB. While we and other workers have estimated the numbers of B. burgdorferi cells in infected tissues by PCR (47, 57), the estimates are based on the assumption that there is one copy of the chromosome per spirochete (38). There is no information about the chromosome content of HAB.
We also employed RT-PCR as a means of determining whether there was correspondence between the amount of an antigen in infected tissues as detected by HATTREX and the amount of the antigen in infected tissues as detected by immunoblotting. An advantage of the RT-PCR approach was its ability to provide an internal control for a gene whose expression was unlikely to be environmentally regulated, the gene encoding the flagellar subunit protein, flaB. This hydrophilic protein could not be recovered by HATTREX. When RT-PCR was used and HAB and IVCB samples were normalized relative to the amount of flaB present in each sample, the higher levels of vlsE, dbpA, and ospC RT-PCR transcripts in HAB than in IVCB were apparent, just as HATTREX revealed larger amounts of VlsE, DbpA, and OspC in HAB cells than in similar numbers of IVCB cells. HATTREX-immunoblotting and RT-PCR findings diverged, however, with regard to tissue-specific differences in the amounts of the antigens or their transcripts relative to each other. For example, the relative amount of the dbpA transcript in ear tissue was greater than the amount of DbpA relative to OspC and VlsE. However, it should be emphasized that all these antigens and transcripts are abundant in tissues relative to the amounts in IVCB. The role of tissue-specific differences in abundance is of potential interest for pathogenesis but is conjectural at this time. It has been shown that dbpA synthesis and ospC synthesis are coordinately regulated by RpoN-RpoS in vitro (23). In vivo expression may be multifactorial and tissue specific.
Recently, Liang et al. used RT-PCR to study the temporal expression of ospC in normal and SCID mice (31). ospC transcription is upregulated in SCID mice compared with transcription in IVCB. In normal mice, ospC transcription decreases in conjunction with the appearance of OspC antibodies. Infusion of OspC antibodies into SCID mice eliminated ospC transcription. In our work with SCID mice, ospC was clearly upregulated at the time point studied, 17 days after infection. We used HATTREX to examine the temporal expression of B. burgdorferi antigens in the skin of rabbits. In this case, the amount of ospC expressed was diminished in the same time frame as that described by Liang et al. for mice (31; T. Crother, C. Champion, J. Whitelegge, X. Wu, D. Blanco, J. Miller, and M. Lovett, unpublished data).
The amount of VlsE in HAB found during infection of SCID mice complements previous findings that VlsE undergoes antigenic variation during SCID mouse infection (60). Although VlsE appears to have a likely role in immune evasion through antigenic variation, initiation of VlsE antigenic variation does not seem to be dependent on an active immune system (29, 41, 60). It has been suggested that the gamma interferon pathway may be involved in activating VlsE recombination (3).
The lower-molecular-mass forms of VlsE, although present at minor levels in IVCB, are a striking feature of HAB in all mouse tissues except heart. Because the smaller VlsE forms are hydrophobic, as judged by isolation from the Triton X-114 detergent phase, it can be concluded that the hydrophobicity is due to retention of amino-terminal acylation. The predicted sequence topology of VlsE does not include membrane-spanning domains that would convey hydrophobicity (58). Therefore, it is likely that the smaller VlsE forms are generated by C-terminal proteolysis. This proteolysis appears to be of a specific nature, given the discrete molecular mobilities of the smaller VlsE forms. Smaller forms of the other abundant surface proteins, OspC and DbpA, were not found in the mouse tissue samples or in IVCB, arguing against generalized proteolytic degradation of surface proteins. It should be noted that smaller forms of OspA and OspB were not detected in IVCB (Fig. 5), while the smaller VlsE forms were readily detected in IVCB (Fig. 3E and F). The fact that smaller VlsE forms are found in IVCB supports the hypothesis that they are generated by a specific B. burgdorferi protease and do not reflect an autolytic activity of infected tissue.
Several additional lines of evidence are in accord with the possibility that the smaller VlsE forms are specifically produced by B. burgdorferi and are not artifactual. To assess the possibility that the smaller VlsE forms were generated by the Triton X-114 extraction process, intact IVCB cells were directly solubilized in sample buffer containing 7 M urea, 2 M thiourea, and 1% ASB-14 prior to IPG-2DE. The smaller VlsE forms were readily detected (Fig. 3F). To assess the possibility that the smaller VlsE forms represented cross-reactions of the smaller VlsE form monospecific antiserum with other B. burgdorferi proteins, we analyzed a clonal isolate of B. burgdorferi that lacked Lp28.1 and was therefore unable to express VlsE. Smaller VlsE form bands were not detected, indicating that the binding of the VlsE antiserum to smaller VlsE forms was specific (Fig. 3G). Because the monospecific VlsE antiserum was generated by immunization with recombinant VlsE, we considered the possibility that its ability to bind smaller VlsE forms reflected immunization with breakdown products of recombinant VlsE. We found, however, that serum from mice chronically infected with B. burgdorferi (CMS) also bound the smaller VlsE forms (Fig. 3I).
Apart from specific proteolysis, another possible route for generation of the smaller VlsE forms is by illegitimate recombination events during antigenic variation. However, no truncated vlsE open reading frames have been found in the numerous studies performed on VlsE (24, 25, 58, 59). Furthermore, analysis of VlsE in several individual clonal isolates of B31 revealed both unit-size VlsE and smaller VlsE forms (Crother and Lovett, unpublished observations). Taken together, our data suggest that B. burgdorferi produces smaller VlsE forms through a specific mechanism both during infection and during in vitro cultivation.
There has been one previous study in which smaller forms of a B. burgdorferi surface protein were detected. Bundoc and Barbour found that clonal isolates of strain HB19 expressed different forms of OspB (5). Some clones expressed unit-size (33-kDa) OspB, some expressed both 33-kDa OspB and a 21-kDa form of OspB, and others expressed only an 18.5-kDa form of OspB. The mechanistic basis for these modes of OspB expression was not determined. Our studies did not reveal smaller forms of OspB in IVCB cells of strain B31 (Fig. 5), and OspB was not detected in HAB. In addition, we analyzed VlsE forms from clonal isolates of strain B31 (data not shown), and each clone contained the full set of smaller VlsE forms shown in Fig. 3. The smaller VlsE forms therefore do not appear to be expressed as a result of clonal variation.
The crystal structure of VlsE has recently been described (15). Precise determination of VlsE cleavage sites in relation to the topology is of great interest and may provide an indication of whether the protein is cleaved prior to export and mature folding. It seems highly likely that the cleavage events greatly change VlsE topology. As such, VlsE processing and creation of smaller VlsE forms could be yet another means by which B. burgdorferi can evade the immune response.
It is noteworthy that the antigenic profile of HAB obtained by HATTREX, while dominated in ear and joint tissues by VlsE, contains novel antigens that are upregulated relative to their representation in IVCB. The cellular location and biological significance of these proteins remain to be determined. Using the HATTREX approach, we also identified proteins, such as LA7 and BmpA, which are readily detectable but not massively upregulated in certain tissues, as well as in IVCB. The use of complementary methodological approaches to ascertain HAB gene expression and antigenic composition during infection is clearly indicated given both the difficulty of obtaining this information and its importance.

ACKNOWLEDGMENTS
This research was funded by NIH grants AI 29733 and AI 37312.
We thank Evelyn Pineda for her invaluable assistance.

FOOTNOTES
* Corresponding author. Mailing address: Department of Medicine, Division of Infectious Diseases, University of California, Los Angeles, 37-121 Center for Health Sciences, 10833 LeConte Ave., Los Angeles, CA 90095. Phone: (310) 825-4188. Fax: (310) 267-2265. E-mail:
tcrother{at}ucla.edu.

Editor: D. L. Burns

REFERENCES
1 - Akins, D. R., S. F. Porcella, T. G. Popova, D. Shevchenko, S. I. Baker, M. Li, M. V. Norgard, and J. D. Radolf. 1995. Evidence for in vivo but not in vitro expression of a Borrelia burgdorferi outer surface protein F (OspF) homologue. Mol. Microbiol. 18:507-520.[CrossRef][Medline]
2 - Anguita, J., S. Samanta, B. Revilla, K. Suk, S. Das, S. W. Barthold, and E. Fikrig. 2000. Borrelia burgdorferi gene expression in vivo and spirochete pathogenicity. Infect. Immun. 68:1222-1230.[Abstract/Free Full Text]
3 - Anguita, J., V. Thomas, S. Samanta, R. Persinski, C. Hernanz, S. W. Barthold, and E. Fikrig. 2001. Borrelia burgdorferi-induced inflammation facilitates spirochete adaptation and variable major protein-like sequence locus recombination. J. Immunol. 167:3383-3390.[Abstract/Free Full Text]
4 - Barthold, S. W., E. Fikrig, L. K. Bockenstedt, and D. H. Persing. 1995. Circumvention of outer surface protein A immunity by host-adapted Borrelia burgdorferi. Infect. Immun. 63:2255-2261.[Abstract]
5 - Bundoc, V. G., and A. G. Barbour. 1989. Clonal polymorphisms of outer membrane protein OspB of Borrelia burgdorferi. Infect. Immun. 57:2733-2741.[Abstract/Free Full Text]
6 - Cassatt, D. R., N. K. Patel, N. D. Ulbrandt, and M. S. Hanson. 1998. DbpA, but not OspA, is expressed by Borrelia burgdorferi during spirochetemia and is a target for protective antibodies. Infect. Immun. 66:5379-5387.[Abstract/Free Full Text]
7 - Champion, C. I., D. R. Blanco, J. T. Skare, D. A. Haake, M. Giladi, D. Foley, J. N. Miller, and M. A. Lovett. 1994. A 9.0-kilobase-pair circular plasmid of Borrelia burgdorferi encodes an exported protein: evidence for expression only during infection. Infect. Immun. 62:2653-2661.[Abstract/Free Full Text]
8 - Chevallet, M., V. Santoni, A. Poinas, D. Rouquie, A. Fuchs, S. Kieffer, M. Rossignol, J. Lunardi, J. Garin, and T. Rabilloud. 1998. New zwitterionic detergents improve the analysis of membrane proteins by two-dimensional electrophoresis. Electrophoresis 19:1901-1909.[CrossRef][Medline]
9 - Coburn, J., W. Chege, L. Magoun, S. C. Bodary, and J. M. Leong. 1999. Characterization of a candidate Borrelia burgdorferi beta3-chain integrin ligand identified using a phage display library. Mol. Microbiol. 34:926-940.[CrossRef][Medline]
10 - Cox, D. L., D. R. Akins, K. W. Bourell, P. Lahdenne, M. V. Norgard, and J. D. Radolf. 1996. Limited surface exposure of Borrelia burgdorferi outer surface lipoproteins. Proc. Natl. Acad. Sci. USA 93:7973-7978.[Abstract/Free Full Text]
11 - Cunningham, T. M., E. M. Walker, J. N. Miller, and M. A. Lovett. 1988. Selective release of the Treponema pallidum outer membrane and associated polypeptides with Triton X-114. J. Bacteriol. 170:5789-5796.[Abstract/Free Full Text]
12 - Das, S., S. W. Barthold, S. S. Giles, R. R. Montgomery, S. R. Telford 3rd, and E. Fikrig. 1997. Temporal pattern of Borrelia burgdorferi p21 expression in ticks and the mammalian host. J. Clin. Investig. 99:987-995.[Medline]
13 - de Silva, A. M., S. R. Telford 3rd, L. R. Brunet, S. W. Barthold, and E. Fikrig. 1996. Borrelia burgdorferi OspA is an arthropod-specific transmission-blocking Lyme disease vaccine. J. Exp. Med. 183:271-275.[Abstract/Free Full Text]
14 - Dobrikova, E. Y., J. Bugrysheva, and F. C. Cabello. 2001. Two independent transcriptional units control the complex and simultaneous expression of the bmp paralogous chromosomal gene family in Borrelia burgdorferi. Mol. Microbiol. 39:370-378.[CrossRef][Medline]
15 - Eicken, C., V. Sharma, T. Klabunde, M. B. Lawrenz, J. M. Hardham, S. J. Norris, and J. C. Sacchettini. 2002. Crystal structure of Lyme disease variable surface antigen VlsE of Borrelia burgdorferi. J. Biol. Chem. 28:28.
16 - Fikrig, E., W. Feng, S. W. Barthold, S. R. Telford 3rd, and R. A. Flavell. 2000. Arthropod- and host-specific Borrelia burgdorferi bbk32 expression and the inhibition of spirochete transmission. J. Immunol. 164:5344-5351.[Abstract/Free Full Text]
17 - Foley, D. M., R. J. Gayek, J. T. Skare, E. A. Wagar, C. I. Champion, D. R. Blanco, M. A. Lovett, and J. N. Miller. 1995. Rabbit model of Lyme borreliosis: erythema migrans, infection-derived immunity, and identification of Borrelia burgdorferi proteins associated with virulence and protective immunity. J. Clin. Investig. 96:965-975.
18 - Foley, D. M., Y. P. Wang, X. Y. Wu, D. R. Blanco, M. A. Lovett, and J. N. Miller. 1997. Acquired resistance to Borrelia burgdorferi infection in the rabbit. Comparison between outer surface protein A vaccine- and infection-derived immunity. J. Clin. Investig. 99:2030-2035.[Medline]
19 - Grewe, C., and J. H. Nuske. 1996. Immunolocalization of a 22 kDa protein (IPLA7, P22) of Borrelia burgdorferi. FEMS Microbiol. Lett. 138:215-219.[Medline]
20 - Guo, B. P., E. L. Brown, D. W. Dorward, L. C. Rosenberg, and M. Hook. 1998. Decorin-binding adhesins from Borrelia burgdorferi. Mol. Microbiol. 30:711-723.[CrossRef][Medline]
21 - Guo, B. P., S. J. Norris, L. C. Rosenberg, and M. Hook. 1995. Adherence of Borrelia burgdorferi to the proteoglycan decorin. Infect. Immun. 63:3467-3472.[Abstract]
22 - Hagman, K. E., X. Yang, S. K. Wikel, G. B. Schoeler, M. J. Caimano, J. D. Radolf, and M. V. Norgard. 2000. Decorin-binding protein A (DbpA) of Borrelia burgdorferi is not protective when immunized mice are challenged via tick infestation and correlates with the lack of DbpA expression by B. burgdorferi in ticks. Infect. Immun. 68:4759-4764.[Abstract/Free Full Text]
23 - Hubner, A., X. Yang, D. M. Nolen, T. G. Popova, F. C. Cabello, and M. V. Norgard. 2001. Expression of Borrelia burgdorferi OspC and DbpA is controlled by a RpoN-RpoS regulatory pathway. Proc. Natl. Acad. Sci. USA 98:12724-12729.[Abstract/Free Full Text]
24 - Indest, K. J., J. K. Howell, M. B. Jacobs, D. Scholl-Meeker, S. J. Norris, and M. T. Philipp. 2001. Analysis of Borrelia burgdorferi vlsE gene expression and recombination in the tick vector. Infect. Immun. 69:7083-7090.[Abstract/Free Full Text]
25 - Iyer, R., J. M. Hardham, G. P. Wormser, I. Schwartz, and S. J. Norris. 2000. Conservation and heterogeneity of vlsE among human and tick isolates of Borrelia burgdorferi. Infect. Immun. 68:1714-1718.[Abstract/Free Full Text]
26 - Kitten, T., and A. G. Barbour. 1992. The relapsing fever agent Borrelia hermsii has multiple copies of its chromosome and linear plasmids. Genetics 132:311-324.[Abstract]
27 - Kramer, M. D., U. E. Schaible, R. Wallich, S. E. Moter, D. Petzoldt, and M. M. Simon. 1990. Characterization of Borrelia burgdorferi associated antigens by monoclonal antibodies. Immunobiology 181:357-366.[Medline]
28 - Kumaran, D., S. Eswaramoorthy, B. J. Luft, S. Koide, J. J. Dunn, C. L. Lawson, and S. Swaminathan. 2001. Crystal structure of outer surface protein C (OspC) from the Lyme disease spirochete, Borrelia burgdorferi. EMBO J. 20:971-978.[CrossRef][Medline]
29 - Labandeira-Rey, M., and J. T. Skare. 2001. Decreased infectivity in Borrelia burgdorferi strain B31 is associated with loss of linear plasmid 25 or 28-1. Infect. Immun. 69:446-455.[Abstract/Free Full Text]
30 - Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
31 - Liang, F. T., M. B. Jacobs, L. C. Bowers, and M. T. Philipp. 2002. An immune evasion mechanism for spirochetal persistence in lyme borreliosis. J. Exp. Med. 195:415-422.[Abstract/Free Full Text]
32 - Liang, F. T., M. B. Jacobs, and M. T. Philipp. 2001. C-terminal invariable domain of VlsE may not serve as target for protective immune response against Borrelia burgdorferi. Infect. Immun. 69:1337-1343.[Abstract/Free Full Text]
33 - Liang, F. T., F. K. Nelson, and E. Fikrig. 2002. DNA microarray assessment of putative Borrelia burgdorferi lipoprotein genes. Infect. Immun. 70:3300-3303.[Abstract/Free Full Text]
34 - Liang, F. T., F. K. Nelson, and E. Fikrig. 2002. Molecular adaptation of Borrelia burgdorferi in the murine host. J. Exp. Med. 196:275-280.[Abstract/Free Full Text]
35 - Ma, Y., K. P. Seiler, E. J. Eichwald, J. H. Weis, C. Teuscher, and J. J. Weis. 1998. Distinct characteristics of resistance to Borrelia burgdorferi-induced arthritis in C57BL/6N mice. Infect. Immun. 66:161-168.[Abstract/Free Full Text]
36 - Molloy, M. P., B. R. Herbert, M. B. Slade, T. Rabilloud, A. S. Nouwens, K. L. Williams, and A. A. Gooley. 2000. Proteomic analysis of the Escherichia coli outer membrane. Eur. J. Biochem. 267:2871-2881.[Medline]
37 - Montgomery, R. R., S. E. Malawista, K. J. Feen, and L. K. Bockenstedt. 1996. Direct demonstration of antigenic substitution of Borrelia burgdorferi ex vivo: exploration of the paradox of the early immune response to outer surface proteins A and C in Lyme disease. J. Exp. Med. 183:261-269.[Abstract/Free Full Text]
38 - Morrison, T. B., Y. Ma, J. H. Weis, and J. J. Weis. 1999. Rapid and sensitive quantification of Borrelia burgdorferi-infected mouse tissues by continuous fluorescent monitoring of PCR. J. Clin. Microbiol. 37:987-992.[Abstract/Free Full Text]
39 - Philipp, M. T., L. C. Bowers, P. T. Fawcett, M. B. Jacobs, F. T. Liang, A. R. Marques, P. D. Mitchell, J. E. Purcell, M. S. Ratterree, and R. K. Straubinger. 2001. Antibody response to IR6, a conserved immunodominant region of the VlsE lipoprotein, wanes rapidly after antibiotic treatment of Borrelia burgdorferi infection in experimental animals and in humans. J. Infect. Dis. 184:870-878.[CrossRef][Medline]
40 - Probert, W. S., and B. J. Johnson. 1998. Identification of a 47 kDa fibronectin-binding protein expressed by Borrelia burgdorferi isolate B31. Mol. Microbiol. 30:1003-1015.[CrossRef][Medline]
41 - Purser, J. E., and S. J. Norris. 2000. Correlation between plasmid content and infectivity in Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 97:13865-13870.[Abstract/Free Full Text]
42 - Radolf, J. D., N. R. Chamberlain, A. Clausell, and M. V. Norgard. 1988. Identification and localization of integral membrane proteins of virulent Treponema pallidum subsp. pallidum by phase partitioning with the nonionic detergent Triton X-114. Infect. Immun. 56:490-498.[Abstract/Free Full Text]
43 - Radolf, J. D., and M. V. Norgard. 1988. Pathogen specificity of Treponema pallidum subsp. pallidum integral membrane proteins identified by phase partitioning with Triton X-114. Infect. Immun. 56:1825-1828.[Abstract/Free Full Text]
44 - Remington, M. C., E. L. Munson, S. M. Callister, M. L. Molitor, J. A. Christopherson, D. J. DeCoster, S. D. Lovrich, and R. F. Schell. 2001. Interleukin-6 enhances production of anti-OspC immunoglobulin G2b borreliacidal antibody. Infect. Immun. 69:4268-4275.[Abstract/Free Full Text]
45 - Revel, A. T., A. M. Talaat, and M. V. Norgard. 2002. DNA microarray analysis of differential gene expression in Borrelia burgdorferi, the Lyme disease spirochete. Proc. Natl. Acad. Sci. USA 99:1562-1567.[Abstract/Free Full Text]
46 - Schwan, T. G., J. Piesman, W. T. Golde, M. C. Dolan, and P. A. Rosa. 1995. Induction of an outer surface protein on Borrelia burgdorferi during tick feeding. Proc. Natl. Acad. Sci. USA 92:2909-2913.[Abstract/Free Full Text]
47 - Shang, E. S., C. I. Champion, X. Y. Wu, J. T. Skare, D. R. Blanco, J. N. Miller, and M. A. Lovett. 2000. Comparison of protection in rabbits against host-adapted and cultivated Borrelia burgdorferi following infection-derived immunity or immunization with outer membrane vesicles or outer surface protein A. Infect. Immun. 68:4189-4199.[Abstract/Free Full Text]
48 - Shang, E. S., X. Y. Wu, M. A. Lovett, J. N. Miller, and D. R. Blanco. 2001. Homologous and heterologous Borrelia burgdorferi challenge of infection-derived immune rabbits using host-adapted organisms. Infect. Immun. 69:593-598.[Abstract/Free Full Text]
49 - Simpson, W. J., W. Cieplak, M. E. Schrumpf, A. G. Barbour, and T. G. Schwan. 1994. Nucleotide sequence and analysis of the gene in Borrelia burgdorferi encoding the immunogenic P39 antigen. FEMS Microbiol. Lett. 119:381-387.[CrossRef][Medline]
50 - Simpson, W. J., M. E. Schrumpf, and T. G. Schwan. 1990. Reactivity of human Lyme borreliosis sera with a 39-kilodalton antigen specific to Borrelia burgdorferi. J. Clin. Microbiol. 28:1329-1337.[Abstract/Free Full Text]
51 - Skare, J. T., T. A. Mirzabekov, E. S. Shang, D. R. Blanco, H. Erdjument-Bromage, J. Bunikis, S. Bergstrom, P. Tempst, B. L. Kagan, J. N. Miller, and M. A. Lovett. 1997. The Oms66 (p66) protein is a Borrelia burgdorferi porin. Infect. Immun. 65:3654-3661.[Abstract]
52 - Skare, J. T., E. S. Shang, D. M. Foley, D. R. Blanco, C. I. Champion, T. Mirzabekov, Y. Sokolov, B. L. Kagan, J. N. Miller, and M. A. Lovett. 1995. Virulent strain associated outer membrane proteins of Borrelia burgdorferi. J. Clin. Investig. 96:2380-2392.
53 - Suk, K., S. Das, W. Sun, B. Jwang, S. W. Barthold, R. A. Flavell, and E. Fikrig. 1995. Borrelia burgdorferi genes selectively expressed in the infected host. Proc. Natl. Acad. Sci. USA 92:4269-4273.[Abstract/Free Full Text]
54 - Sung, S. Y., J. V. McDowell, J. A. Carlyon, and R. T. Marconi. 2000. Mutation and recombination in the upstream homology box-flanked ospE-related genes of the Lyme disease spirochetes result in the development of new antigenic variants during infection. Infect. Immun. 68:1319-1327.[Abstract/Free Full Text]
55 - Wallich, R., C. Brenner, M. D. Kramer, and M. M. Simon. 1995. Molecular cloning and immunological characterization of a novel linear-plasmid-encoded gene, pG, of Borrelia burgdorferi expressed only in vivo. Infect. Immun. 63:3327-3335.[Abstract]
56 - Wallich, R., M. M. Simon, H. Hofmann, S. E. Moter, U. E. Schaible, and M. D. Kramer. 1993. Molecular and immunological characterization of a novel polymorphic lipoprotein of Borrelia burgdorferi. Infect. Immun. 61:4158-4166.[Abstract/Free Full Text]
57 - Yang, L., J. H. Weis, E. Eichwald, C. P. Kolbert, D. H. Persing, and J. J. Weis. 1994. Heritable susceptibility to severe Borrelia burgdorferi-induced arthritis is dominant and is associated with persistence of large numbers of spirochetes in tissues. Infect. Immun. 62:492-500.[Abstract/Free Full Text]
58 - Zhang, J. R., J. M. Hardham, A. G. Barbour, and S. J. Norris. 1997. Antigenic variation in Lyme disease borreliae by promiscuous recombination of VMP-like sequence cassettes. Cell 89:275-285.[CrossRef][Medline]
59 - Zhang, J. R., and S. J. Norris. 1998. Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion. Infect. Immun. 66:3698-3704.[Abstract/Free Full Text]
60 - Zhang, J. R., and S. J. Norris. 1998. Kinetics and in vivo induction of genetic variation of vlsE in Borrelia burgdorferi. Infect. Immun. 66:3689-3697.[Abstract/Free Full Text]
Infection and Immunity, June 2003, p. 3419-3428, Vol. 71, No. 6
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.6.3419-3428.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Xu, Q., McShan, K., Liang, F. T.
(2008). Modification of Borrelia burgdorferi to overproduce OspA or VlsE alters its infectious behaviour. Microbiology
154: 3420-3429
[Abstract]
[Full Text]
-
Embers, M. E., Alvarez, X., Ooms, T., Philipp, M. T.
(2008). The Failure of Immune Response Evasion by Linear Plasmid 28-1-Deficient Borrelia burgdorferi Is Attributable to Persistent Expression of an Outer Surface Protein. Infect. Immun.
76: 3984-3991
[Abstract]
[Full Text]
-
Hughes, J. L., Nolder, C. L., Nowalk, A. J., Clifton, D. R., Howison, R. R., Schmit, V. L., Gilmore, R. D. Jr., Carroll, J. A.
(2008). Borrelia burgdorferi Surface-Localized Proteins Expressed during Persistent Murine Infection Are Conserved among Diverse Borrelia spp.. Infect. Immun.
76: 2498-2511
[Abstract]
[Full Text]
-
Xu, Q., Seemanaplli, S. V., McShan, K., Liang, F. T.
(2007). Increasing the Interaction of Borrelia burgdorferi with Decorin Significantly Reduces the 50 Percent Infectious Dose and Severely Impairs Dissemination. Infect. Immun.
75: 4272-4281
[Abstract]
[Full Text]
-
von Lackum, K., Ollison, K. M., Bykowski, T., Nowalk, A. J., Hughes, J. L., Carroll, J. A., Zuckert, W. R., Stevenson, B.
(2007). Regulated synthesis of the Borrelia burgdorferi inner-membrane lipoprotein IpLA7 (P22, P22-A) during the Lyme disease spirochaete's mammal-tick infectious cycle. Microbiology
153: 1361-1371
[Abstract]
[Full Text]
-
Shi, Y., Xu, Q., Seemanapalli, S. V., McShan, K., Liang, F. T.
(2006). The dbpBA Locus of Borrelia burgdorferi Is Not Essential for Infection of Mice. Infect. Immun.
74: 6509-6512
[Abstract]
[Full Text]
-
Xu, Q., Seemanapalli, S. V., McShan, K., Liang, F. T.
(2006). Constitutive Expression of Outer Surface Protein C Diminishes the Ability of Borrelia burgdorferi To Evade Specific Humoral Immunity. Infect. Immun.
74: 5177-5184
[Abstract]
[Full Text]
-
Nowalk, A. J., Gilmore, R. D. Jr, Carroll, J. A.
(2006). Serologic Proteome Analysis of Borrelia burgdorferi Membrane-Associated Proteins. Infect. Immun.
74: 3864-3873
[Abstract]
[Full Text]
-
Bykowski, T., Babb, K., von Lackum, K., Riley, S. P., Norris, S. J., Stevenson, B.
(2006). Transcriptional Regulation of the Borrelia burgdorferi Antigenically Variable VlsE Surface Protein. J. Bacteriol.
188: 4879-4889
[Abstract]
[Full Text]
-
Champion, C. I., Blanco, D. R., Lovett, M. A.
(2005). Quantitative Assessment of Protection in Experimental Syphilis. Infect. Immun.
73: 5923-5927
[Abstract]
[Full Text]
-
Aguero-Rosenfeld, M. E., Wang, G., Schwartz, I., Wormser, G. P.
(2005). Diagnosis of Lyme Borreliosis. Clin. Microbiol. Rev.
18: 484-509
[Abstract]
[Full Text]
-
Guerau-de-Arellano, M., Alroy, J., Huber, B. T.
(2005). {beta}2 Integrins Control the Severity of Murine Lyme Carditis. Infect. Immun.
73: 3242-3250
[Abstract]
[Full Text]
-
Hodzic, E., Tunev, S., Feng, S., Freet, K. J., Barthold, S. W.
(2005). Immunoglobulin-Regulated Expression of Borrelia burgdorferi Outer Surface Protein A In Vivo. Infect. Immun.
73: 3313-3321
[Abstract]
[Full Text]
-
Blanco, D. R., Champion, C. I., Dooley, A., Cox, D. L., Whitelegge, J. P., Faull, K., Lovett, M. A.
(2005). A Monoclonal Antibody That Conveys In Vitro Killing and Partial Protection in Experimental Syphilis Binds a Phosphorylcholine Surface Epitope of Treponema pallidum. Infect. Immun.
73: 3083-3095
[Abstract]
[Full Text]
-
Lawrenz, M. B., Wooten, R. M., Norris, S. J.
(2004). Effects of vlsE Complementation on the Infectivity of Borrelia burgdorferi Lacking the Linear Plasmid lp28-1. Infect. Immun.
72: 6577-6585
[Abstract]
[Full Text]
-
Liang, F. T., Yan, J., Mbow, M. L., Sviat, S. L., Gilmore, R. D., Mamula, M., Fikrig, E.
(2004). Borrelia burgdorferi Changes Its Surface Antigenic Expression in Response to Host Immune Responses. Infect. Immun.
72: 5759-5767
[Abstract]
[Full Text]
-
Crother, T. R., Champion, C. I., Whitelegge, J. P., Aguilera, R., Wu, X.-Y., Blanco, D. R., Miller, J. N., Lovett, M. A.
(2004). Temporal Analysis of the Antigenic Composition of Borrelia burgdorferi during Infection in Rabbit Skin. Infect. Immun.
72: 5063-5072
[Abstract]
[Full Text]
-
Shin, J. J., Bryksin, A. V., Godfrey, H. P., Cabello, F. C.
(2004). Localization of BmpA on the Exposed Outer Membrane of Borrelia burgdorferi by Monospecific Anti-Recombinant BmpA Rabbit Antibodies. Infect. Immun.
72: 2280-2287
[Abstract]
[Full Text]
-
Seshu, J., Boylan, J. A., Gherardini, F. C., Skare, J. T.
(2004). Dissolved Oxygen Levels Alter Gene Expression and Antigen Profiles in Borrelia burgdorferi. Infect. Immun.
72: 1580-1586
[Abstract]
[Full Text]