![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Infection and Immunity, July 2003, p. 3766-3774, Vol. 71, No. 7
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.7.3766-3774.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
R. M. James,
G. McLachlan, and C. Haslett
Rayne Laboratory, Respiratory Medicine Unit, MRC Centre for Inflammation Research, University of Edinburgh, Edinburgh EH8 9AG, Scotland, United Kingdom
Received 3 December 2002/ Returned for modification 21 January 2003/ Accepted 2 April 2003
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
), macrophage inflammatory protein 2, and monocyte chemoattractant protein 1, than wild-type mice. There was a concomitant increase in inflammatory cell influx, showing that there was potential priming of innate responses in the lungs. When LPS was given systemically, the mice expressing elafin had reduced levels of serum TNF- compared to the levels in wild-type mice. These results indicate that elafin may have a dual function, promoting up-regulation of local lung innate immunity while simultaneously down-regulating potentially unwanted systemic inflammatory responses in the circulation. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Of interest in this context are low-molecular-weight mucosal elastase inhibitors, such as secretory leukocyte protease inhibitor (SLPI) and elafin/elastase-specific inhibitor (34, 35). These agents have been shown to be induced by early wave cytokines, such as interleukin-1 and tumor necrosis factor (TNF) (32), and to have antimicrobial properties (17, 36, 37, 47). Their concentrations are very low in blood, and they are not expressed in the liver (1, 20, 27, 29).
Recently, it has been shown that a transient overexpression approach in which adenovirus is used as a gene vector is efficient for delivering human elafin (driven by the powerful mouse cytomegalovirus [MCMV] promoter) to mouse lung tissues (37, 38). In addition, it was found that in mice there was an increase in inflammatory cell migration to airways in response to intratracheally instilled bacterial LPS (38), suggesting that this inhibitor may be important as a chemoattractant and in the priming of innate responses in lung cells.
Because lung-targeted adenovirus protocols give rise to lung compartmentalization of transgene expression (49) and hence only local elafin expression in the previously described model (37), we decided to create transgenic mice expressing human elafin more ubiquitously in order to have coexistent local expression and systemic expression of elafin. To do this, a mouse transgenic line expressing human elafin cDNA under control of the MCMV promoter was generated, and its characteristics were assessed in two self-limiting models of inflammation, first by using intratracheally instilled bacterial LPS (akin to the method used in the adenovirus study mentioned above) and second by using a systemic LPS administration protocol.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Transgenic mice were generated by a standard protocol (18) by injecting linear DNA (5 ng/µl) into the male pronuclei of fertilized ova derived from C57BL6 x CBA F1 females. Injected ova at the two-cell stage were transferred to the oviducts of surrogate pseudopregnant CD1 females, where development was allowed to progress to term. One founder line was identified (see below) which transmitted the elafin cDNA transgene under control of the MCMV promoter to its offspring in Mendelian fashion. The transgenic line was then bred to homozygosity. The number of elafin transgene copies was determined by standard methods. Briefly, the intensity (as determined by Phosphorimager analysis) of HindIII-digested genomic DNA was compared with the intensities of spiked known amounts of elafin cDNA. The numbers of copies were determined by using the following equation: 1 copy of transgene = 0.538(3.78 x 10-6 µg) = 2 pg of genomic DNA.
The wild-type controls used had the same mixed background (C57BL6 xCBA) as the transgenic mice expressing elafin.
All results described for the wild-type and transgenic mice expressing elafin were obtained with F2 generation mice.
Southern genomic analysis. Transgenic mice were identified by Southern blot analysis of DNA samples isolated from tail biopsies by using standard procedures. Briefly, tail DNA samples were extracted with phenol-chloroform following proteinase K digestion overnight. The resulting DNA was subsequently precipitated with ethanol. Genomic DNA samples (10 µg) were digested with HindIII, resolved on a 1% agarose gel, and transferred in 0.4 N NaOH to a GeneScreen Plus nylon membrane (NEN-Dupont, Stevenage, Hertsfordshire, United Kingdom). The filter was then hybridized with a 32P-labeled random primer-labeled human elafin cDNA probe. Prehybridization (1 h) and hybridization (overnight) were performed in 0.5 M Na2HPO4 (pH 7)-1 mM EDTA-7% sodium dodecyl sulfate at 65°C. The filter was washed twice in 0.04 M Na2HPO4-1% sodium dodecyl sulfate at 65°C for 30 min and exposed for autoradiography, typically overnight.
RNA preparation and Northern blot analysis. Tissues were harvested from adult (8-week-old) female mice. Total RNA from various murine tissues was prepared with the Trizol reagent used according to the manufacturer's instructions (Gibco BRL, Paisley, United Kingdom). Total RNA (20 µg) was resolved on a 1% agarose-1.7 M formaldehyde gel, transferred overnight in 20x SSC to a Zetaprobe membrane (Bio-Rad, Hemel Hempstead, Hertfordshire, United Kingdom), and then baked at 80°C for 1 to 2 h (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate). The filter was prehybridized, hybridized, and washed as described above for the Southern analysis but at 55°C instead of 65°C. The filter was exposed for autoradiography for 1 week.
DNase treatment of RNA templates. To eliminate the possibility of genomic DNA contamination, RNA samples prepared from murine tissues or macrophages were digested with RQ1 RNase-free DNase I (Promega, Southampton, United Kingdom) used in accordance with the manufacturer's instructions prior to use in a reverse transcription-PCR (RT-PCR) (see below).
RT-PCR and Southern analysis. Total RNA isolated from a variety of mouse tissues (0.35 µg) and peritoneal macrophages was used as the template for first-strand cDNA synthesis. Oligonucleotide primers (MWG-Biotech, Milton Keynes, United Kingdom) were designed to amplify a 477-bp fragment of the elafin transcript. The elafin primers were sense primer 5' GCAGCTTCTTGATCGTGGTG 3' (starting at nucleotide 11 after the ATG start codon) and antisense primer 5' GCCGTGGGCATCCTGAATGG 3' (nucleotides 467 to 486).
Primers were also designed to amplify a 258-bp fragment of murine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (sense primer, 487 to 506 bp; antisense primer, 726 to 745 bp). Total RNA was incubated with 0.25 µg of oligo(dT) (Promega), 1 µl of 10x PCR buffer (Promega), 100 U of Moloney murine leukemia virus reverse transcriptase (Gibco BRL), 7 U of RNasin (Gibco BRL), and 125 µl of each deoxynucleoside triphosphate (Pharmacia, Buckingham, Hertfordshire, United Kingdom) in a 10-µl (total volume) reaction mixture. The reaction mixture was incubated at 37°C for 45 min and then heated at 90°C for 5 min. Then 4 µl of 10x PCR buffer, 80 pmol (each) of the forward and reverse elafin primers, 8 pmol (each) of the forward and reverse GAPDH primers, 2.5 U of Taq DNA polymerase (Promega), and enough H2O to bring the total volume to 50 µl were added to the RT reaction mixture. The reaction mixture was subjected to 35 cycles of DNA amplification (94°C for 30 s, 60°C for 30 s, 70°C for 1 min) in a MJ Research thermocycler. The reaction mixture was then held for 5 min at 70°C. When necessary, Southern blot analysis was performed by using a standard method, when the concentrations of RT-PCR products were at the limit of detection by ethidium bromide gel staining.
In vivo experiments. (i) Intratracheal instillation of LPS. Female transgenic mice expressing elafin and wild-type (WT) mice (ages, 8 to 10 weeks) were instilled intratracheally with 50 µg of Escherichia coli O127:B8 LPS, as described previously (37). Twenty-four hours later, mice were sacrificed under anesthesia by transection of the abdominal aorta, blood was retrieved for further serum preparation, and the lungs and trachea were removed en bloc. A bronchoalveolar lavage (BAL) was immediately performed with two serial instillations of 250 and 200 µl of phosphate-buffered saline (PBS). Recovered BAL fluid (BALF) (typically 350 to 450 µl) was centrifuged at 2,000 x g for 5 min. Supernatants were frozen at -20°C until they were used, while each cell pellet was resuspended in 100 µl of PBS. Cell counting (with a hemacytometer) and cytospinning (300 rpm for 3 min at room temperature) were performed. After cytospinning preparations were stained with Diff-quick (Dade Diagnostika, GmbH, Germany) for analysis of differential cell counts.
(ii) Intraperitoneal instillation of LPS. Female transgenic mice expressing elafin and WT mice (ages, 8 to 10 weeks) each received one intraperitoneal dose of 120 µg of LPS (as described above) in 100 µl of PBS. Control mice were injected with PBS alone. Serum samples were collected after 1.5 h and 24 h by tail bleeding.
Thioglycolate challenge and culture of peritoneal macrophages. Female transgenic mice expressing elafin and WT mice (ages, 8 to 10 weeks) were injected intraperitoneally with 1 ml of 4% thioglycolate broth to induce peritonitis. The mice were sacrificed after 120 h, and peritoneal lavage performed with 5 ml of cold PBS. The cells were pooled and washed with PBS. A total of 5 x 105 cells were then cultured in 48-well plates in 1 ml of RPMI 1640 (Gibco BRL) medium supplemented with 25 mM HEPES, 2 mM glutamine, 100 U of penicillin per ml, 100 µg of streptomycin per ml, and 10% fetal bovine serum. After overnight incubation, nonadherent cells were removed by washing with serum-free medium, and all of the adherent cells were macrophages. LPS was then added at different concentrations (0 to 5 ng/ml), and the cells were cultured for 48 h in serum-containing medium. Each supernatant was removed and stored at -20°C until it was used for enzyme-linked immunosorbent assay (ELISA) analysis.
ELISA.
ELISA analyses to detect murine TNF alpha (TNF-), monocyte chemotactic protein 1 (MCP-1), and macrophage inflammatory protein 2 (MIP-2) were performed by using commercially available ELISA kits (R & D Systems, Abingdon, Oxon, United Kingdom) in accordance with the manufacturer's instructions. Human elafin was measured by using an ELISA available in-house (37). Culture supernatants from peritoneal macrophages were diluted 1:20 before ELISA analysis of cytokines. Serum samples (collected either 1.5 or 24 h after treatment) and BALFs were either not diluted or diluted fivefold in PBS.
Statistical analysis. Normally distributed data were analyzed by the Student unpaired t test. When data were not normally distributed, nonparametric tests (Kruskal-Wallis and Mann-Whitney tests) were employed. Data were considered to be statistically significantly different when the P value was <0.05.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
When tissues were analyzed for protein production (by ELISA), the elafin levels were not always reliably measured, which probably reflected the relative lack of sensitivity of the assay (data not shown).
Inflammatory responses to intratracheally instilled bacterial LPS. (i) Cytokines.
In order to assess whether elafin mice responded differently to LPS than WT mice responded, both groups of mice were instilled intratracheally with 50 µg of LPS (or PBS). Because of the importance of TNF- as an early mediator of inflammation, we first measured the TNF- levels in BALF and serum. As shown in Table 1, as expected, both groups of LPS-treated mice had higher BALF TNF- levels than their PBS-treated counterparts. It should be noted that the response to LPS was largely (but not totally) compartmentalized in the lungs in WT mice (there was a 22-fold increase in the TNF- level in BALF and a 1.3-fold increase in serum after LPS treatment). There was also a trend (not statistically significant) toward increased levels of the cytokines in BALF from LPS-treated elafin mice compared to the levels in LPS-treated WT mice. When the systemic levels of TNF- in serum were examined, the elafin mice had lower levels than the WT mice after PBS or LPS treatment, suggesting that elafin may have a stronger systemic anti-inflammatory activity than a local lung proinflammatory activity in these mice.
|
is an early cytokine involved in initiation of the inflammatory response, we extended our study to two other cytokines, MCP-1 and MIP-2, which are chemokines for monocytes and neutrophils, respectively. Because of the potential dual activity of elafin in altering the TNF- response (weakly proinflammatory in the lung and strongly anti-inflammatory systemically), we expressed the data as serum/BAL cytokine ratios (Fig. 3). In accordance with the TNF- data, elafin mice exhibited the same decrease in serum/BALF MCP-1 and MIP-2 ratios as those WT mice. It should be noted that as shown in Table 1, although a trend was observed, the transgene did not have a significant effect on the absolute cytokine levels in the BALF.
|
|
, MCP-1, and MIP-2 (Fig. 5).
|
and elafin levels approached statistical significance (P = 0.081).
Serum TNF- levels after intraperitoneal LPS administration.
The in vivo experiments whose results are shown in Table 1 and Fig. 3 showed that intratracheal instillation of 50 µg of LPS did not lead to total lung compartmentalization of the LPS stimulus in WT mice since the TNF- levels were increased in the serum of these mice. Since elafin mice had lower levels of circulating TNF- (Table 1), we hypothesized that if elafin could down-regulate the systemic effect of LPS when LPS is administered intratracheally, it may dampen the responses when LPS is injected systemically. Since the level of TNF- in serum is known to increase transiently after systemic LPS administration and TNF- is considered a major initiator of the septic response (4-6, 13, 39, 42), we used previously established protocols to measure TNF- immunoreactivity in serum 1.5 and 24 h after intraperitoneal LPS injection.
Figure 6 shows that as expected, the serum TNF- levels in WT mice were greater 1.5 h after LPS administration and returned to the baseline value within 24 h. In sera from elafin mice, the TNF- levels were significantly lower than those in WT mice at 1.5 h, suggesting that elafin is indeed involved in down-regulating systemic endotoxin responses.
|
expression in vivo (Fig. 6). To further investigate this, we isolated monocyte-derived peritoneal macrophages 4 days after intraperitoneal thioglycolate injection and stimulated the cells in vitro with different levels of LPS. Figure 7 shows that peritoneal macrophages from elafin mice produced less TNF-, MCP-1, and MIP-2 than peritoneal macrophages from WT mice produced, and Fig. 8 shows that these cells produced elafin mRNA, as determined by RT-PCR (the protein level was below the threshold of detection) (data not shown).
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recently, the use of adenovirus as a lung vector for transient gene expression of potentially therapeutic transgenes under control of the strong MCMV promoter allowed us to discover a new property for elafin, its chemotactic activity for lung inflammatory cells (38).
In order to determine thoroughly the role of this molecule in local and systemic inflammation, in the present study we used transgenic mice that were engineered to express human elafin constitutively under control of the same MCMV promoter.
Importantly, our elafin construct codes for the full-length protein, which contains transglutamination-cementoin sites (27, 29, 34, 35) thought to be important in binding of the molecule to the interstitium. Recently, Aiba-Masago et al. studied expression in transgenic mice of bacterial ß-galactosidase driven by an MCMV promoter similar to the one used in our study (2). These authors found that the brain, stomach, kidney, and skeletal muscle were the major organs which expressed the transgene. Our study (Fig. 2) showed that the stomach, small intestine, skeletal muscle, and bone are major sites of expression. The reasons for the slight difference in the spectrum of organs in which the transgene is expressed between the two studies are unclear, but the difference could reflect differences in the read-outs (i.e., mRNA levels in our study and protein levels in the study of Aiba-Masago et al.) or differences in the chromosomal location of the transgenes. Alternatively, our human elafin cDNA construct has a 158-bp 3' untranslated region which may contain positive or negative regulatory binding sites which could influence the MCMV-associated specificity of expression. Interestingly, when studying endogenous expression of human elafin RNA, Nara et al. found that in accordance with our results, stomach and small intestine tissues were positive as determined by an RNase protection assay (27). Using Northern blot analysis, Pfundt et al. showed that the human tongue and pharynx (organs not assessed in the other studies mentioned here) are strong expressers of elafin, although these workers did not study the stomach, small intestine, skeletal muscle, and bone (29).
Although some organs expressed elafin more strongly than other organs, it was demonstrated by using RT-PCR that all the organs tested here were positive for expression of human elafin in the transgenic mice. The results of this study also confirmed the results of a previous study (33) showing that the human elafin cDNA probe does not cross-react with any murine message.
In the second part of our study we tested whether the elafin mice generated here were able to modulate the activity of intratracheally instilled LPS to the same extent that was observed in the adenovirus-elafin model (38).
Figure 4 shows that there was increased inflammatory cell influx (both neutrophils and macrophages) in BALF from elafin mice compared to that in WT mice following intratracheal LPS administration. A net increase in lung chemotactic activity is caused by chemokine gradients generated either by an increase in the levels of lung chemokines or a decrease in the levels of systemic chemokines (3, 28, 43, 46). We therefore measured serum and BALF chemokine levels and found that neutrophilic, monocytic cytokine, and chemokine (TNF-, MIP-2, and MCP-1) ratios were lower in the elafin mice (Fig. 3). In addition, the cytokine levels were found to correlate with elafin concentrations (Fig. 5). These results are qualitatively similar to the results observed in our adenovirus study (38). Interestingly, although as indicated above there was a trend toward increased numbers of macrophages in BALF from mice given adenovirus elafin intratracheally, the number of neutrophils prominently increased in that study. In contrast, the numbers of both neutrophils and macrophages were elevated in elafin mice in the present study. The difference between the transient adenovirus and constitutive transgenic models could result from differential chemotactic activity due to a difference in lung elafin expression, which was much higher in the adenovirus study (nanogram levels, compared with the picogram levels in this study), the numbers of potential different receptors (currently uncharacterized), and the affinities on macrophages and neutrophils. Alternatively, a difference in mouse strains (pure C57BL6 mice for the adenovirus-derived experiments and a mixture of CBA and C57BL6 mice for the transgenic mouse experiments) could also be an explanation. Regardless, the results are reminiscent of those obtained with defensins and cathelicidins; indeed, these molecules have also been shown to have cytokine-stimulating activities (7, 41) and chemotactic properties for a variety of cell types in vitro (for a recent review, see reference 52). In some instances, a receptor has been identified; human ß-defensin 2 acts via CCR6 on immature dendritic cells and memory T cells (50), and LL37 acts via the formyl peptide receptor-like 1 on human neutrophils, monocytes, and T cells (51).
In addition to the in vitro studies, Zhang et al. recently showed that when administered intratracheally to mouse lungs, human -defensins (a mixture of -defensin 1, -defensin 2, and -defensin 3) also induced an increased flux of inflammatory cells in the alveolar space (53). Significantly, these authors also reported increased levels of proinflammatory cytokines, including MCP-1, and a serum-BAL cytokine gradient similar to the one found in our study. Interestingly, chemotactic activity of defensins has also been demonstrated in the peritoneal cavity following Klebsiella pneumoniae infection of mice (45).
As mentioned above, the intratracheal LPS data suggested that in elafin mice there is an elevated gradient of cytokines across the alveolus-blood barrier. The reduced serum TNF- levels in elafin mice after intratracheal LPS administration (Table 1) suggests that elafin may act in this model in part by inhibiting circulating (but not lung) LPS signaling, after partial leakage of LPS from the lung. Indeed, following intratracheal LPS administration, there was a trend toward increased (not decreased) lung TNF- production in elafin mice, which would argue in our model against spillover of TNF- from the lung into the circulation.
The cytokine gradient generated by elafin may have a dual function; it may promote up-regulation of innate immunity responses in the lung compartment and simultaneous down-regulation of inflammatory responses in the circulation. The latter down-regulation would be akin to that caused by SLPI, which has been shown to decrease in vitro production of proinflammatory mediators in human monocytes and murine macrophages (10, 21, 26, 54).
In the third part of our study, to test this hypothesis, we injected WT mice and elafin mice intraperitoneally with LPS and measured serum TNF- levels after treatment. Figure 6 shows that the serum TNF- levels were indeed reduced in the elafin mice. This systemic hyporesponsiveness of elafin mice was further studied ex vivo by examining macrophage responses to LPS. Following stimulation of peritoneal macrophages with LPS, it was apparent that cells from elafin mice made elafin mRNA and that LPS was able to up-regulate the message. This up-regulation by LPS was probably due to the presence of nuclear factor 
B sites within the MCMV promoter, as observed previously in the adenovirus study (38). In addition, cells from elafin mice produced less TNF-, MIP-2, and MCP-1 than cells from WT mice produced (Fig. 7). Interestingly, macrophages from elafin mice produced less TNF- than macrophages from WT mice produced under basal (PBS) conditions, echoing data presented in Table 1, which show that the serum TNF- levels were lower in the former mice.
In conclusion, these are the three main findings of the present study. (i) The elafin mice that we created expressed human elafin mRNA in a variety of organs (Fig. 1 and 2) and expressed protein levels in the lung and serum, as assessed by ELISA analysis. (ii) After intratracheal LPS administration, increases in numbers of inflammatory cells in BALF and decreases in the serum/BALF cytokine ratios were observed in the elafin mice compared to the values for WT mice (Table 1 and Fig. 3 and 4). In addition, the cytokine levels were correlated with the elafin concentrations in BALF (Fig. 5). (iii) Elafin mice were less responsive to LPS, as assessed in vivo, after intraperitoneal injection of LPS and measurement of circulating TNF- (Fig. 6) and ex vivo (with peritoneal macrophages) (Fig. 7).
Because of the role of TNF- in many of the pathophysiologic events in sepsis (14, 15), inhibitors of the TNF- cascade have been extensively studied (9, 10, 12, 16, 19, 21, 23, 24, 26, 48). We believe that elastase inhibitors, such as elafin, are particularly interesting because of their small size, which allows better diffusion in tissues. Both in a previous adenovirus study (38) and in the present study a decrease in blood-BALF TNF--chemokine gradient in mice overexpressing elafin was found. We believe that the elafin mice should help in assessing which of the two strategies (i.e., local application or systemic application of elastase inhibitors) should be more beneficial in clinical applications. As pointed out above, because of possible differences in site expression, care should be taken to differentiate the physiological effects of an endogenous protein and the potential therapeutic effects of a transgene. We are currently pursuing this line of investigation in our laboratory and with our clinical colleagues.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by the Salvesen Research Trust and the MRC.
|
FOOTNOTES |
|---|
Present address: Department of Biochemistry, Conway Institute of Biomolecular and Biomedical Research, Belfield, Dublin 4, Ireland.
Present address: Sir Alastair Currie Cancer Research UK Laboratories, Molecular Medicine Centre, University of Edinburgh, Western General Hospital, Edinburgh EH4 2XU, Scotland, United Kingdom.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
| 1. | Abe, T., N. Kobayashi, K. Yoshimura, B. C. Trapnell, H. Kim, R. C. Hubbard, M. T. Brewer, R. C. Thompson, and R. G. Crystal. 1991. Expression of the secretory leukoprotease inhibitor gene in epithelial cells. J. Clin. Investig. 87:2207-2215. |
| 2. | Aiba-Masago, S., S. Baba, R. Y. Li, Y. Shinmura, I. Kosugi, Y. Arai, M. Nishimura, and Y. Tsutsui. 1999. Murine cytomegalovirus immediate-early promoter directs astrocyte-specific expression in transgenic mice. Am. J. Pathol. 154:735-743. |
| 3. | Blackwell, T. S., L. H. Lancaster, T. R. Blackwell, A. Venkatakrishnan, and J. W. Christman. 1999. Chemotactic gradients predict neutrophilic alveolitis in endotoxin-treated rats. Am. J. Respir. Crit. Care Med. 159:1644-1652. |
| 4. | Calandra, T., J. D. Baumgartner, G. E. Grau, M. M. Wu, P. H. Lambert, J. Schellekens, J. Verhoef, and M. P. Glauser. 1990. Prognostic values of tumor necrosis factor/cachectin, interleukin-1, interferon-, and interferon- in the serum of patients with septic shock. Swiss-Dutch J5 Immunoglobulin Study Group. J. Infect. Dis. 161:982-987. |
| 5. | Cannon, J. G., R. G. Tompkins, J. A. Gelfand, H. R. Michie, G. G. Stanford, J. W. van der Meer, S. Endres, G. Lonnemann, J. Corsetti, and B. Chernow. 1990. Circulating interleukin-1 and tumor necrosis factor in septic shock and experimental endotoxin fever. J. Infect. Dis. 161:79-84.[Medline] |
| 6. | Casey, L. C., R. A. Balk, and R. C. Bone. 1993. Plasma cytokine and endotoxin levels correlate with survival in patients with the sepsis syndrome. Ann. Intern. Med. 119:771-778. |
| 7. | Chaly, Y. V., E. M. Paleolog, T. S. Kolesnikova, I. I. Tikhonov, E. V. Petratchenko, and N. N. Voitenok. 2000. Neutrophil alpha-defensin human neutrophil peptide modulates cytokine production in human monocytes and adhesion molecule expression in endothelial cells. Eur. Cytokine Netw. 11:257-266.[Medline] |
| 8. | Chen, G. H., R. C. Reddy, M. W. Newstead, K. Tateda, B. L. Kyasapura, and T. Standiford. 2000. Intrapulmonary TNF gene therapy reverses sepsis-induced suppression of lung antibacterial host defense. J. Immunol. 165:6496-6503. |
| 9. | Churg, A., J. Dai, K. Zay, A. Karsan, R. Hendricks, C. Yee, R. Martin, R. MacKenzie, C. Xie, L. Zhang, S. Shapiro, and J. L. Wright. 2001. Alpha-1-antitrypsin and a broad spectrum metalloprotease inhibitor, RS113456, have similar acute anti-inflammatory effects. Lab. Investig. 81:1119-1131.[Medline] |
| 10. | Ding, A., N. Thieblemont, J. Zhu, F. Jin, J. Zhang, and S. Wright. 1999. Secretory leukocyte protease inhibitor interferes with uptake of lipopolysaccharide by macrophages. Infect. Immun. 67:4485-4489. |
| 11. | Donnelly, S. C., R. M. Strieter, S. L. Kunkel, A. Walz, C. R. Robertson, D. C. Carter, I. S. Grant, A. J. Pollok, and C. Haslett. 1993. Interleukin-8 (IL-8) and the development of the adult respiratory distress syndrome (ARDS). Lancet 341:643-647.[CrossRef][Medline] |
| 12. | Gipson, T. S., N. M. Bless, T. P. Shanley, L. D. Crouch, M. R. Bleavins, E. M. Younkin, V. Sarma, D. F. Gibbs, W. Tefera, P. C. McConnell, W. T. Mueller, K. J. Johnson, and P. A. Ward. 1999. Regulatory effects of endogenous protease inhibitors in acute lung inflammatory injury. J. Immunol. 162:3653-3662. |
| 13. | Girardin, E., G. E. Grau, J. M. Dayer, P. Roux-Lombard, and P. H. Lambert. 1988. Tumor necrosis factor and interleukin-1 in the serum of children with severe infectious purpura. N. Engl. J. Med. 319:397-400.[Abstract] |
| 14. | Grau, G. E., and D. N. Maennel. 1997. TNF inhibition and sepsis—sounding a cautionary note. Nat. Med. 3:1193-1195.[CrossRef][Medline] |
| 15. | Gutierrez-Ramos, J. C., and H. Bluethmann. 1997. Molecules and mechanisms operating in septic shock: lessons from knockout mice. Immunol. Today 18:329-334.[CrossRef][Medline] |
| 16. | Hemachandra, S., K. Kamboj, J. Copfer, G. Pier, L. L. Green, and J. R. Schreiber. 2001. Human monoclonal antibodies against Pseudomonas aeruginosa lipopolysaccharide derived from transgenic mice containing megabase human immunoglobulin loci are opsonic and protective against fatal pseudomonas sepsis. Infect. Immun. 69:2223-2229. |
| 17. | Hiemstra, P. S., R. J. Maassen, J. Stolk, R. Heinzel-Wieland, G. J. Steffens, and J. H. Dijkman. 1996. Antibacterial activity of antileukoprotease. Infect. Immun. 64:4520-4524.[Abstract] |
| 18. | Hogan, B., R. Beddington, F. Constantini, and E. Lacey. 1994. Manipulating the mouse embryo. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 19. | Kirikae, T., M. Hirata, H. Yamasu, F. Kirikae, H. Tamura, F. Kayama, K. Nakatsuka, T. Yokochi, and M. Nakano. 1998. Protective effects of a human 18-kilodalton cationic antimicrobial protein (CAP18)-derived peptide against murine endotoxemia. Infect. Immun. 66:1861-1868. |
| 20. | Kramps, J. A., C. Franken, and J. H. Dijkman. 1984. ELISA for quantitative measurement of low-molecular-weight brochial protease inhibitor in human sputum. Am. Rev. Respir. Dis. 129:959-963. |
| 21. | Jin, F., C. F. Nathan, D. Radzioch, and A. Ding. 1998. Lipopolysaccharide-related stimuli induce expression of the secretory leukocyte protease inhibitor, a macrophage-derived lipopolysaccharide inhibitor. Infect. Immun. 66:2447-2452. |
| 22. | Lee, C. T., A. M. Fein, M. Lippman, H. Holtzman, P. Kimbel, and G. Weinbaum. 1981. Elastolytic activity in pulmonary lavage fluid from patients with adult respiratory syndrome. N. Engl. J. Med. 304:192-196.[Abstract] |
| 23. | Lentsch, A. B., J. A. Jordan, B. J. Czermak, K. M. Diehl, E. M. Younkin, V. Sarma, and P. A. Ward. 1999. Inhibition of NF-kappaB activation and augmentation of IkappaBbeta by secretory leukocyte protease inhibitor during lung inflammation. Am. J. Pathol. 154:239-247. |
| 24. | Libert, C., W. Van Molle, P. Brouckaert, and W. Fiers. 1996. Alpha-1-antitrypsin inhibits the lethal response to TNF in mice. J. Immunol. 157:5126-5129.[Abstract] |
| 25. | Miller, E. J., S. Nagao, A. B. Cohen, D. Griffith, R. J. Maunder, T. R. Martin, J. P. Weiner-Kronish, M. Sticherling, E. Christophers, and M. A. Matthay. 1992. Elevated levels of NAP-1/interleukin-8 are present in the airspaces of patients with the adult respiratory distress syndrome and are associated with increased mortality. Am. Rev. Respir. Dis. 146:427-432.[Medline] |
| 26. | Mulligan, M. S., A. B. Lentsch, M. Huber-Lang, R. F. Guo, V. Sarma, C. D. Wright, T. R. Ulich, and P. A. Ward. 2000. Anti-inflammatory effects of mutant forms of secretory leukocyte protease inhibitor. Am. J. Pathol. 156:1033-1039. |
| 27. | Nara, K., S. Ito, T. Ito, Y. Suzuki, M. A. Ghoneim, S. Tachibana, and S. Hirose. 1994. Elastase inhibitor elafin is a new type of proteinase inhibitor which has a transglutaminase-mediated anchoring sequence termed "cementoin." J. Biochem. 115:441-448. |
| 28. | Nelson, S., C. Chidiac, G. Bagby, and W. R. Summer. 1990. Endotoxin-induced suppression of lung host defenses. J. Med. 21:85-103. |
| 29. | Pfundt, R., F. van Ruissen, I. M. J. J. van Vlijmen-Willems, H. A. C. Alkemade, P. L. J. M. Zeeuwen, and J. Schalkwijk. 1996. Constitutive and inducible expression of SKALP/elafin provides anti-elastase defence in human epithelia. J. Clin. Investig. 98:1389-1399.[Medline] |
| 30. | Rudolphus, A., J. Stolk, J. H. Dijkman, and J. A. Kramps. 1993. Inhibition of lipopolysaccharide-induced pulmonary emphysema by intratracheally instilled recombinant secretory leukocyte proteinase inhibitor. Am. Rev. Respir. Dis. 147:442-447.[Medline] |
| 31. | Rudolphus, A., J. A. Kramps, I. Mauve, and J. H. Dijkman. 1994. Intratracheally instilled antileukoprotease and alpha 1-proteinase inhibitor: effect on human neutrophil elastase-induced experimental emphysema and pulmonary localization. Histochem. J. 26:817-824.[Medline] |
| 32. | Sallenave, J. M., J. Shulmann, J. Crossley, M. Jordana, and J. Gauldie. 1994. Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/elafin) in human airway epithelial cells by cytokines and neutrophilic enzymes. Am. J. Respir. Cell Mol. Biol. 11:733-741.[Abstract] |
| 33. | Sallenave, J.-M., Z. Xing, A. J. Simpson, F. L. Graham, and J. Gauldie. 1998. Adenovirus-mediated expression of an elastase-specific inhibitor (elafin): a comparison of different promoters. Gene Ther. 5:352-360.[CrossRef][Medline] |
| 34. | Sallenave, J. M. 2000. The role of secretory leukocyte proteinase inhibitor and elafin (elastase-specific inhibitor/skin-derived antileukoprotease) as alarm antiproteinases in inflammatory lung disease. Respir. Res. 1:87-92.[CrossRef][Medline] |
| 35. | Schalkwijk, J., O. Wiedow, and S. Hirose. 1999. The trappin gene family: proteins defined by an N-terminal transglutaminase substrate domain and a C-terminal four-disulphide core. Biochem. J. 340:569-577. |
| 36. | Simpson, A. J., A. I. Maxwell, J. R. Govan, C. Haslett, and J.-M. Sallenave. 1999. Elafin (elastase-specific inhibitor) has anti-microbial activity against gram-positive and gram-negative respiratory pathogens. FEBS Lett. 452:309-313.[CrossRef][Medline] |
| 37. | Simpson, A. J., W. A. Wallace, M. E. Marsden, J. R. Govan, D. J. Porteous, C. Haslett, and J.-M. Sallenave. 2001. Adenoviral augmentation of elafin protects the lung against acute injury mediated by activated neutrophils and bacterial infection. J. Immunol. 167:1778-1786. |
| 38. | Simpson, A. J., G. A. Cunningham, D. J. Porteous, C. Haslett, and J.-M. Sallenave. 2001. Regulation of adenovirus-mediated elafin transgene expression by bacterial lipopolysaccharide. Hum. Gene Ther. 12:1395-1406.[CrossRef][Medline] |
| 39. | van der Poll, T., and S. F. Lowry. 1995. Tumor necrosis factor in sepsis: mediator of multiple organ failure or essential part of host defense? Shock 3:1-12.[Medline] |
| 40. | Van Molle, W., C. Libert, W. Fiers, and P. Brouckaert. 1997. Alpha 1-acid glycoprotein and alpha 1-antitrypsin inhibit TNF-induced but not anti-Fas-induced apoptosis of hepatocytes in mice. J. Immunol. 159:3555-3564.[Abstract] |
| 41. | Van Wetering, S., S. P. Mannesse-Lazeroms, M. A. Van Sterkenburg, M. R. Daha, J. H. Dijkman, and P. S. Hiemstra. 1997. Effect of defensins on interleukin-8 synthesis in airway epithelial cells. Am. J. Physiol. 272:L888-L896. |
| 42. | Waage, A., P. Brandtzaeg, A. Halstensen, P. Kierulf, and T. Espevik. 1989. The complex pattern of cytokines in serum from patients with meningococcal septic shock: association between interleukin 6, interleukin 1, and fatal outcome. J. Exp. Med. 169:333-338. |
| 43. | Wagner, J. G., K. E. Driscoll, and R. A. Roth. 1999. Inhibition of pulmonary neutrophil trafficking during endotoxemia is dependent on the stimulus for migration. Am. J. Respir. Cell Mol. Biol. 20:769-776. |
| 44. | Weiland, J. E., W. B. Davis, J. F. Holter, J. R. Mohammed, P. M. Dorinsky, and J. E. Gadek. 1986. Lung neutrophils in the adult respiratory distress syndrome. Am. Rev. Respir. Dis. 133:218-225.[Medline] |
| 45. | Welling, M. M., P. S. Hiemstra, M. T. van den Barselaar, A. Paulusma-Annema, P. H. Nibbering, E. K. Pauwels, and W. Calame. 1998. Antibacterial activity of human neutrophil defensins in experimental infections in mice is accompanied by increased leukocyte accumulation. J. Clin. Investig. 102:1583-1590.[Medline] |
| 46. | White, J. C., S. Nelson, J. A. Winkelstein, F. V. M. Booth, and G. J. Jakab. 1986. Impairment of antibacterial defense mechanisms of the lung by extrapulmonary infection. J. Infect. Dis. 153:202-208.[Medline] |
| 47. | Wiedow, O., J. Harder, J. Bartels, V. Streit, and E. Christophers. 1998. Antileukoprotease in human skin: an antibiotic peptide constitutively produced by keratinocytes. Biochem. Biophys. Res. Commun. 248:904-909.[CrossRef][Medline] |
| 48. | Wielockx, B., F. Bussolino, S. D. Shapiro, and C. Libert. 2001. Involvement of a serine protease, but not of neutrophil elastase, in tumor necrosis factor-induced lethal hepatitis and induction of platelet-activating factor. J. Hepatol. 35: 490-497.[CrossRef][Medline] |
| 49. | Xing, Z., T. Braciak, Y. Ohkawara, J.-M. Sallenave, R. Foley, P. J. Sime, M. Jordana, F. L. Graham, and J. Gauldie. 1994. Gene transfer for cytokine functional studies in the lung: the multifunctional role of GM-CSF in pulmonary inflammation. J. Leukoc. Biol. 59:481-488. |
| 50. | Yang, D., O. Chertov, S. N. Bykovskaia, Q. Chen, M. J. Buffo, J. Shogan, M. Anderson, J. M. Schroder, J. M. Wang, O. M. Howard, and J. J. Oppenheim. 1999. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286:525-528. |
| 51. | Yang, D., Q. Chen, A. P. Schmidt, G. M. Anderson, J. M. Wang, J. Wooters, J. J. Oppenheim, and O. Chertov. 2000. LL-37, the neutrophil granule- and epithelial cell-derived cathelicidin, utilizes formyl peptide receptor-like 1 (FPRL1) as a receptor to chemoattract human peripheral blood neutrophils, monocytes, and T cells. J. Exp. Med. 192:1069-1074. |
| 52. | Yang, D., A. Biragyn, L. W. Kwak, and J. J. Oppenheim. 2002. Mammalian defensins in immunity: more than just microbicidal. Trends Immunol. 23:291-296.[CrossRef][Medline] |
| 53. | Zhang, H., G. Porro, N. Orzech, B. Mullen, M. Liu, and A. S. Slutsky. 2001. Neutrophil defensins mediate acute inflammatory response and lung dysfunction in dose-related fashion. Am. J. Physiol. Lung Cell Mol. Physiol. 280:L947-L954. |
| 54. | Zhang, Y., D. L. DeWitt, T. B. McNeely, S. M. Wahl, and L. M. Wahl. 1997. Secretory leukocyte protease inhibitor suppresses the production of monocyte prostaglandin H synthase-2, prostaglandin E2, and matrix metalloproteinases. J. Clin. Investig. 99:894-900.[Medline] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. |
|---|
