![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Infection and Immunity, July 2003, p. 4151-4158, Vol. 71, No. 7
0019-9567/03/$08.00+0 DOI: 10.1128/IAI.71.7.4151-4158.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Microbiology and Tumorbiology Center, Karolinska Institutet, SE-171 77 Stockholm, Sweden,1 Divisions of Cell Biology and Immunology,2 Structural Biology, Gesellschaft für Biotechnologische Forschung, D-38124 Braunschweig, Germany3
Received 25 November 2002/ Returned for modification 29 January 2003/ Accepted 7 April 2003
 |
ABSTRACT |
|---|
 Top Abstract TextReferences |
|---|
|
TEXT |
|---|
|
TopAbstractTextReferences |
|---|
The rdar morphotype is a multicellular behavior commonly expressed by Salmonella enterica serotype Typhimurium isolates (26) and certain isolates of Escherichia coli (2, 24). The rdar morphotype mediates different types of multicellular behavior, for example, cell aggregation in liquid culture, pellicle formation at the air-liquid interface, and biofilm formation at liquid-solid interfaces (17). The rdar morphotype produces an extracellular matrix consisting of cellulose and curli fimbriae, which is the major determinant of cell-cell interactions and cell adherence to hydrophilic and hydrophobic abiotic surfaces. Besides their distinct roles in bacterial self-organization, features related to virulence and transmission such as adherence and invasion of epithelial cells and chlorine resistance have been assigned to curli fimbriae and cellulose, respectively (3, 8, 13, 21, 22).
Gene required for cellulose biosynthesis are encoded by the bcsABZC operon. While bcsA encodes the cellulose synthase, the exact functions of the other genes remain to be determined. Structural genes for curli fimbriae are encoded by the csgBA(C) operon. Cellulose and curli fimbria biosynthesis is commonly regulated, either through adrA or directly by csgD, a transcriptional activator, divergently transcribed to csgBA(C).
Performing this study, we wanted to gain insights into the ability of clinically important Enterobacteriaceae besides E. coli and serotype Typhimurium to express cellulose and curli fimbriae. The isolates were collected from the gastrointestinal tract as the major human reservoir for dissemination of isolates.
Isolation and phenotypic characterization of bacterial strains. Since we suspected that cellulose and curli fimbria expression are unstable phenotypes upon subculture, we collected primary isolates of bacterial strains from 21 volunteers who provided fecal samples. Fecal swabs were immediately inoculated on MacConkey agar plates (Oxoid) and incubated overnight at 37°C. The confluent microbial outgrowth was collected and resuspended, and appropriate dilutions were plated on MacConkey agar plates for single colonies. A total of 25 non-E. coli isolates which belonged to 13 species were identified with the API 20E kit (BioMerieux, Nürtingen, Germany): Citrobacter sp. (isolated independently two times), Citrobacter freundii (n = 3), Citrobacter koseri/farmeri (n = 1), Enterobacter sp. (n = 1), Enterobacter aerogenes (n = 2), Enterobacter cloacae (n = 3), Enterobacter sakazakii (n = 2), Klebsiella sp. (n = 2), K. oxytoca (n = 2), K. pneumoniae (n = 2), Klyvera sp. (n = 2), Proteus mirabilis (n = 1), and Raoultella ornithinolytica (n = 2). When the fecal strains were grown on Congo Red (CR) plates (17), we observed that several of the isolates selectively bound CR, thereby resembling the rdar, bdar, or pdar morphotype of serotype Typhimurium reference strains (Fig. 1). Serotype Typhimurium colonies which show the rdar morphotype express cellulose and curli fimbriae, while colonies which show the pdar morphotype express cellulose and colonies which show the bdar morphotype express curli fimbriae (17, 26).
|
Expression of curli fimbriae and cellulose. Three strains with characteristic morphotypes, Citrobacter sp. strain Fec2, C. freundii Fec4, and E. sakazakii Fec39, were chosen for more detailed analyses. Citrobacter sp. strain Fec2 expressed the bdar morphotype at 28°C, C. freundii Fec4 expressed the rdar morphotype at 28°C, and E. sakazakii Fec39 expressed the pdar morphotype at 28°C and 37°C (Fig. 1). However, as displayed in Fig. 1, during storage for several months at -70°C, Citrobacter sp. strain Fec2 changed morphotype to rdar at 28°C and pdar at 37°C, indicating enhanced cellulose biosynthesis. However, since those changes occurred after the molecular study of the isolates, they will not be considered here.
After an enrichment procedure employed for plate-grown cultures of Citrobacter sp. strain Fec2 (18a), the putative curli fimbria subunit was detected as a prominent band at 
16 kDa that was cut out, trypsin digested, and subjected to sequence analysis by quadruple time-of-flight mass spectrometry (20). Sequence comparison of three peptides with the database indicated that the protein was homologous to CsgA, the structural subunit of curli fimbriae expressed by E. coli and serotype Typhimurium. Western blot analysis detected curli fimbriae after formic acid treatment (5) produced by Citrobacter sp. strain Fec2 and C. freundii Fec4 at 28°C, while E. sakazakii Fec39 did not produce any curli fimbriae (data not shown).
Calcofluor binding indicated variable production of cellulose, a 1,4-ß-glucan, in the three strains (Fig. 1). Since Calcofluor binding is not absolutely specific for cellulose, we confirmed cellulose production by isolating crystalline cellulose by the Updegraff method with a mixture of hot 58% acetic acid and 19% nitric acid (25, 26). After hydrolysis of the isolated polymer, the glucose monomers detected by high-pressure liquid chromatography (HPLC) (Fig. 2) were indicative of cellulose production. While glucose was detected when samples from E. sakazakii Fec39 grown at 28°C and 37°C and C. freundii Fec4 grown at 28°C were analyzed, Citrobacter sp. strain Fec2 samples did not show any significant glucose peak.
|
Multicellular behavior of isolates. The expression of the extracellular matrix components cellulose and curli fimbriae is associated with biofilm formation and other modes of multicellular behavior (17). We used a steady-state model, incubation of the strains in glass tubes (17), to test biofilm formation by Citrobacter sp. strain Fec2, C. freundii Fec4, and E. sakazakii Fec39. Optimal biofilm formation was achieved with different incubation conditions for each strain (Fig. 3A and data not shown), which indicated that the regulatory patterns of biofilm formation with respect to oxygen tensions were different between the strains. Pellicle formation was observed for all three strains (data not shown). While E. sakazakii Fec39 formed a pellicle after just 24 h of incubation at 28°C in standing cultures, pellicle formation in cultures of Citrobacter sp. strain Fec2 and C. freundii Fec4 required 48 h to develop. In liquid culture at 28°C after incubation for 24 h, all three strains formed clumps, although the extent of clumping and the consistency of the clumps varied between the strains (Fig. 3B and data not shown). When observed by fluorescence microscopy, Calcofluor-stained cellulose fibrils could be observed for E. sakazakii Fec39 and C. freundii Fec4 (Fig. 3B). Free-floating cellulose fibrils associated with cell clumps were observed for E. sakazakii Fec39, as in serotype Typhimurium when cellulose is the sole extracellular matrix component (26). On the other hand, C. freundii Fec4 produced cellulose fibrils which were tightly wrapped around the cells, as in serotype Typhimurium when cellulose is coexpressed with curli fimbriae (17). Electron microscopy studies of the extracellular matrix of plate-grown colonies of E. sakazakii Fec39 and C. freundii Fec4 further supported the view that the extracellular matrix components cellulose and curli formed structures similar to those in serotype Typhimurium (Fig. 3C).
|
For bcsA, the following consensus primers were used: BCSA74A (CTTCCGTATTGGCAGTCAGGTTCAGGACG) and BCSA70 (GCGCCAGCGGGTTAAACGGCTG) for the N terminus, BCSA74 (GCAACAGATTCAATTTCTGCCCTTC) and BCSA86 (GCACCCGC-GCTGGCAGCGTATTCG) for the middle part of the gene, and BCSA62 (TGGGTCTTCTACAACCTGATTA) and BCSA62A (GCGGCGGTGCAATTTGCGCAAAGGT) for the C terminus.
Sequence data were submitted to the EMBL data library under the following accession numbers: Citrobacter sp. strain Fec2, csgD-csgBA, AJ515700; bcsA, AJ515698; C. freundii Fec4, csgD-csgBA, AJ515701; E. sakazakii Fec39, csgD-csgBA, AJ515702; bcsA, AJ515699. Although E. sakazakii Fec39 did not express curli fimbriae, it contained the csgD-csgBA region with intact genes.
CsgD, the central regulator for multicellular behavior, was highly conserved among the species (data not shown). Most diverse were the CsgD proteins from E. sakazakii Fec39 and serotype Typhimurium ATCC 14028, with a homology of 94%. While several amino acid substitutions were found in the N-terminal domain, a single amino acid substitution was found in the DNA binding domain.
csgD expression is highly regulated by environmental conditions mediated by response regulators and DNA architectural proteins (9, 12), which bind in the intergenic region. Surprisingly, binding sites for OmpR and IHF are not located in the most conserved regions (data not shown). This finding suggested that OmpR and IHF binding might differ among the species and consequently the response to environmental conditions. The 521-bp csgD-csgBA intergenic region can be divided into four regions, IR1 to IR4 (17). The sequence of the IR3 region is highly diverse among the species, but its length is conserved in all strains, suggesting structural importance.
CsgA and CsgB, the structural proteins of curli fimbriae, were also highly conserved (Fig. 4A and data not shown). Most diverse were the CsgA and CsgB proteins from C. freundii Fec4 and E. sakazakii Fec39 with a homology of 80% and 78%, respectively. Polymerized CsgA of Salmonella enteritidis possesses two domains, an N-terminal domain of 22 residues, which is proteinase K susceptible, and a C-terminal core domain, which is proteinase K resistant (6). The highest sequence diversity among the CsgA proteins was found in the glycine-rich N-terminal domain, which is proteinase K susceptible. The C-terminal domain of each protein consisted of five tandemly arranged sequences each containing the SX5QXGX2NXAX3Q consensus sequence (6).
|
Sequence alignment of BcsA, the cellulose synthase, is shown in Fig. 4B. Previously, sequence comparison of all available bacterial cellulose synthases detected a highly conserved core region of 350 residues which contains the D3D2D35QRXRWA motif, common to processive ß-glycosyltransferases, and five additional motifs (16). Although the overall sequence was highly conserved among the species over the whole length of the protein, again BcsA of E. sakazakii Fec39 showed the highest sequence diversity (Fig. 4C). Most remarkable, the PVDPYE and the FFCGS motif were replaced by a different sequence (Fig. 4B).
Detection of csgA, csgD, and bcsA in other enterobacterial species isolated from feces. Conserved primers were used to detect the presence of csgA, csgD, and bcsA genes in other species isolated from feces (Fig. 5 and data not shown). bcsA was present in all species. In E. aerogenes Fec135 and R. ornithinolytica Fec153, csgD could not be detected, while csgA was present. We expect csgD to be present but not detectable by the primer pair used, because csgA is present. In summary, the genes required for the biosynthesis of curli fimbriae were present in all species investigated besides K. pneumoniae and K. oxytoca. Klebsiella ornithinolytica, which has recently been shown to belong to a phylogenetic line distinct from K. pneumoniae and K. oxytoca and therefore has been renamed R. ornithinolytica (10), harbors the gene cluster for curli biosynthesis.
|
In the family Enterobacteriaceae, cellulose biosynthesis has been shown to occur in Salmonella spp., E. coli, and K. pneumoniae (21, 26). In this study, we found that most of the Enterobacter isolates produced cellulose. In particular, two unrelated isolates of E. sakazakii showed pronounced cellulose production at 28°C and 37°C (Fig. 1 and data not shown). Clinical isolates of E. sakazakii have been reported to display a peculiar wrinkled, leathery colony morphology, which, upon storage as agar stocks, readily dissociated into the standard smooth colony morphology (11). Based on the results from this study, this colony morphology is due to cellulose production, which is retained by E. sakazakii upon infection. Species from the genus Klebsiella and R. ornithinolytica isolated from feces did not show elevated expression of cellulose (Fig. 1), although the genetic information for the biosynthesis of cellulose is present (Fig. 5 and data not shown). However, as a possibility, cellulose biosynthesis might be induced in response to specific environmental signals, as shown for the plant symbiont Rhizobium leguminosarum bv. trifolii by contact with roots (1, 7). The observed species-specific expression pattern of curli fimbriae and cellulose in fecal strains raises the question of whether species-specific and consequently morphotype-specific niches exist in the gastrointestinal tract. Alternatively, a habitat-specific morphotype for each species is already determined outside the human body and retained when a strain passes through the gastrointestinal tract.
Multicellular behavior, including biofilm formation, is a fundamental life style of bacteria. It is reasonable to assume that such ancient behavior has common principles among bacteria. The rdar morphotype, defined as the expression of cellulose and curli fimbriae, represents a basic multicellular behavior of Enterobacteriaceae closely related to serotype Typhimurium and E. coli, but individual components of the rdar morphotype and its expression pattern are subject to species-specific adaptation for which no simple pathogen-commensal soil organism classification scheme can be proposed. For example, although semiconstitutive expression of the rdar morphotype is observed (17), the vast majority of pathogenic serovar Typhimurium and serotype Enteritidis strains express the rdar morphotype highly regulated by environmental conditions and only at ambient temperature (18, 18a). Otherwise, Shigella spp. and enteroinvasive E. coli, which cause invasive gastrointestinal disease (19), have lost the rdar morphotype and multicellular behavior. The rdar morphotype was also not found in the Klebsiella species analyzed in this study. However, constitutive expression of cellulose was observed in E. sakazakii, which can cause newborn meningitis, and the majority of E. coli strains from sepsis produce curli fimbriae or the rdar morphotype constitutively (2). Therefore, the expression of cellulose and curli fimbriae is complex and might be highly determined by the environmental microniche of the organism under study. In any case, the capacity to produce cellulose and curli fimbriae in Citrobacter, Enterobacter, and potentially Klebsiella species might contribute to the significant role those species play in biofilm-related infections.
|
ACKNOWLEDGMENTS |
|---|
The excellent technical assistance of J. Majewski and A. Tiepold in mass spectrometric analysis is gratefully acknowledged. We thank Anne von Euler-Matell for electron microscopy of strains.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractTextReferences |
|---|
| 1. | Ausmees, N., H. Jonsson, S. Hoglund, H. Ljunggren, and M. Lindberg. 1999. Structural and putative regulatory genes involved in cellulose synthesis in Rhizobium leguminosarum bv. trifolii. Microbiology 145:1253-1262. |
| 2. | Bian, Z., A. Brauner, Y. Li, and S. Normark. 2000. Expression of and cytokine activation by Escherichia coli curli fibers in human sepsis. J. Infect. Dis. 181:602-612.[CrossRef][Medline] |
| 3. | Bian, Z., Z. Q. Yan, G. K. Hansson, P. Thoren, and S. Normark. 2001. Activation of inducible nitric oxide synthase/nitric oxide by curli fibers leads to a fall in blood pressure during systemic Escherichia coli infection in mice. J. Infect. Dis. 183:612-69.[CrossRef][Medline] |
| 4. | Bouza, E., R. San Juan, P. Munoz, A. Voss, and J. Kluytmans. 2001. A European perspective on nosocomial urinary tract infections II. Report on incidence, clinical characteristics and outcome (ESGNI-004 study). European Study Group on Nosocomial Infection. Clin. Microbiol. Infect. 7:532-542.[CrossRef][Medline] |
| 5. | Collinson, S. K., L. Emody, K. H. Muller, T. J. Trust, and W. W. Kay. 1991. Purification and characterization of thin, aggregative fimbriae from Salmonella enteritidis. J. Bacteriol. 173:4773-4781. |
| 6. | Collinson, S. K., J. M. Parker, R. S. Hodges, and W. W. Kay. 1999. Structural predictions of AgfA, the insoluble fimbrial subunit of Salmonella thin aggregative fimbriae. J. Mol. Biol. 290:741-756.[CrossRef][Medline] |
| 7. | Dazzo, F. B., G. L. Truchet, J. E. Sherwood, E. M. Hrabak, M. Abe, and S. H. Pankratz. 1984. Specific phases of root hair attachment in the Rhizobium trifolii-clover symbiosis. Appl. Environ. Microbiol. 48:1140-1150. |
| 8. | Dibb-Fuller, M. P., E. Allen-Vercoe, C. J. Thorns, and M. J. Woodward. 1999. Fimbria- and flagella-mediated association with and invasion of cultured epithelial cells by Salmonella enteritidis. Microbiology 145:1023-1031.[Abstract] |
| 9. | Dorel, C., O. Vidal, C. Prigent-Combaret, I. Vallet, and P. Lejeune. 1999. Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol. Lett. 178:169-175.[CrossRef][Medline] |
| 10. | Drancourt, M., C. Bollet, A. Carta, and P. Rousselier. 2001. Phylogenetic analyses of Klebsiella species delineate Klebsiella and Raoultella gen. nov., with description of Raoultella ornithinolytica comb. nov., Raoultella terrigena comb. nov. and Raoultella planticola comb. nov. Int. J. Syst. Evol. Microbiol. 51:925-932.[Abstract] |
| 11. | Farmer, J. J., III, M. A. Asbury, F. W. Hickman, D. J. Brenner, and the Enterobacteriaceae Study Group. 1980. Enterobacter sakazakii: a new species of "Enterobacteriaceae" isolated from clinical specimens. Int. J. Syst. Bacteriol. 30:569-584. |
| 12. | Gerstel, U., and U. Römling. 2001. Oxygen tension and nutrient starvation are major signals that regulate agfD promoter activity and expression of the multicellular morphotype in Salmonella typhimurium. Environ. Microbiol. 3:638-648.[CrossRef][Medline] |
| 13. | Gophna, U., M. Barlev, R. Seijffers, T. A. Oelschlager, J. Hacker, and E. Z. Ron. 2001. Curli fibers mediate internalization of Escherichia coli by eukaryotic cells. Infect. Immun. 69:2659-2665. |
| 14. | Leclerc, H., D. A. Mossel, S. C. Edberg, and C. B. Struijk. 2001. Advances in the bacteriology of the coliform group: their suitability as markers of microbial water safety. Annu. Rev. Microbiol. 55:201-234.[CrossRef][Medline] |
| 15. | Olsen, A., H. Herwald, M. Wikstrom, K. Persson, E. Mattsson, and L. Bjorck. 2002. Identification of two protein-binding and functional regions of curli, a surface organelle and virulence determinant of Escherichia coli. J. Biol. Chem. 277:34568-34572. |
| 16. | Römling, U. 2002. Molecular biology of cellulose production in bacteria. Res. Microbiol. 153:205-212.[Medline] |
| 17. | Römling, U., W. D. Sierralta, K. Eriksson, and S. Normark. 1998. Multicellular and aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in the agfD promoter. Mol. Microbiol. 28:249-264.[CrossRef][Medline] |
| 18. | Römling, U., W. Bokranz, U. Gerstel, H. Lünsdorf, M. Nimtz, W. Rabsch, H. Tschäpe, and X. Zogaj. 2002. Dissection of the genetic pathway leading to multicellular behaviour in Salmonella typhimurium and other Enterobacteriaceae, p. 231-261. In M. Wilson and D. Devine (ed.), Medical implications of biolfilms. Cambridge University Press, Cambridge, England. |
| 18. | Römling, U., W. Bokranz, W. Rabsch, X. Zogaj, M. Nimtz, and H. Tschäpe. Occurrence and regulation of the multicellular morphotype in Salmonella serovars important in human disease. Int. J. Med. Microbiol., in press. |
| 19. | Sakellaris, H., N. K. Hannink, K. Rajakumar, D. Bulach, M. Hunt, C. Sasakawa, and B. Adler. 2000. Curli loci of Shigella spp. Infect. Immun. 68:3780-3783. |
| 20. | Shevchenko, A., M. Wilm, O. Vorm, and M. Mann. 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68:850-858.[Medline] |
| 21. | Solano, C., B. Garcia, J. Valle, C. Berasain, J. M. Ghigo, C. Gamazo, and I. Lasa. 2002. Genetic analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Mol. Microbiol. 43:793-808.[CrossRef][Medline] |
| 22. | Sukupolvi, S., R. G. Lorenz, J. I. Gordon, Z. Bian, J. D. Pfeifer, S. J. Normark, and M. Rhen. 1997. Expression of thin aggregative fimbriae promotes interaction of Salmonella typhimurium SR-11 with mouse small intestinal epithelial cells. Infect. Immun. 65:5320-5325.[Abstract] |
| 23. | Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882. |
| 24. | Uhlich, G. A., J. E. Keen, and R. O. Elder. 2001. Mutations in the csgD promoter associated with variations in curli expression in certain strains of Escherichia coli O157:H7. Appl. Environ. Microbiol. 67:2367-2370. |
| 25. | Updegraff, D. M. 1969. Semimicro determination of cellulose in biological materials. Anal. Biochem. 32:420-424.[CrossRef][Medline] |
| 26. | Zogaj, X., M. Nimtz, M. Rohde, W. Bokranz, and U. Römling. 2001. The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39:1452-1463.[CrossRef][Medline] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
- and ß-anomers (retention time, 13.77 and 13.95 min, respectively); 1 µg of myoinositol was used as an internal standard (retention time, 15.75 min).
