Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Abreu, P. A. E. Articles by Nascimento, A. L. T. O. Search for Related Content PubMed PubMed Citation Articles by Abreu, P. A. E. Articles by Nascimento, A. L. T. O.

 Previous Article  |  Next Article 

Infection and Immunity, October 2004, p. 5931-5937, Vol. 72, No. 10
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.10.5931-5937.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Sm14 of Schistosoma mansoni in Fusion with Tetanus Toxin Fragment C Induces Immunoprotection against Tetanus and Schistosomiasis in Mice

Patrícia A. E. Abreu,^1,2 Patrícia A. Miyasato,¹ Mônica M. Vilar,³ Waldely O. Dias,² Paulo L. Ho,^1,2,4 Míriam Tendler,³ and Ana L. T. O. Nascimento^1,2*

Centro de Biotecnologia, Instituto Butantan,¹ Instituto de Química,² Instituto de Biociências, Universidade de São Paulo, São Paulo,⁴ Departamento de Helmintologia, Instituto Oswaldo Cruz-Fiocruz, Rio de Janeiro, Brazil³

Received 13 April 2004/ Returned for modification 10 May 2004/ Accepted 13 July 2004

Top Abstract Introduction Materials and Methods Results Discussion References

 
We have constructed vectors that permit the expression in Escherichia coli of Schistosoma mansoni fatty acid-binding protein 14 (Sm14) in fusion with the nontoxic, but highly immunogenic, tetanus toxin fragment C (TTFC). The recombinant six-His-tagged proteins were purified by nickel affinity chromatography and used in immunization and challenge assays. Animals inoculated with TTFC in fusion with or coadministered with Sm14 showed high levels of tetanus toxin antibodies, while animals inoculated with Sm14 in fusion with or coadministered with TTFC showed high levels of Sm14 antibodies. In both cases, there were no changes in the type of immune response (Th2) obtained with the fusion proteins compared to those obtained with the nonfused proteins. Mice immunized with the recombinant proteins (TTFC in fusion with or coadministered with Sm14) survived the challenge with tetanus toxin and did not show any symptoms of the disease. Control animals inoculated with either phosphate-buffered saline (PBS) or Sm14 died with severe symptoms of tetanus after 24 h. Mice immunized with the recombinant proteins (Sm14 in fusion with or coadministered with TTFC) showed a 50% reduction in worm burden when they were challenged with S. mansoni cercariae, while control animals inoculated with either PBS or TTFC were not protected. The results show that the expression of other antigens in fusion at the carboxy terminus of TTFC is feasible for the development of a multivalent recombinant vaccine.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Schistosomiasis comprises a group of severe parasitic diseases caused by trematodes of the genus Schistosoma. More than 200 million people are infected worldwide, mainly in Africa, the Middle East, South and Central America, and Southeast Asia (24). The control of the disease is based mainly on the treatment of infected individuals with schistosomicidal drugs. This strategy has reduced the prevalence and the clinical symptoms of the disease. However, this treatment generally does not affect the transmission of the infection, and the rate of reinfection is high (4). In addition, the DALY (disease-adjusted life years) analysis estimates that the impact of schistosomiasis has been underestimated, especially when its sequelae, such as anemia, growth retardation, and impaired cognitive development in school age children, are considered (2). Moreover, the development of parasite resistance to drugs has been reported (12), and the "rebound morbidity" following reinfection imposes a serious limitation on the chemotherapy-only strategy. Therefore, the development of an effective vaccine would represent a long-term solution for schistosomiasis (2).

Schistosoma mansoni fatty acid-binding protein 14 (Sm14) and the 28-kDa glutathione S-transferase from Schistosoma haematobium (Sh28-GST) are now considered by the World Health Organization to be the target molecules for an antischistosome vaccine (2, 3, 4).The recombinant protein showed a protective activity against two parasitic worm species, S. mansoni and Fasciola hepatica, inducing a 35 to 60% reduction in the number of adult S. mansoni worms and a 100% reduction in the F. hepatica worm burden (16, 17, 20, 23).

Tetanus is an often-lethal syndrome characterized by spastic paralysis, convulsions, respiratory failure, and heart collapse caused by tetanus toxin. Immunoprotection against tetanus is mediated by toxin-neutralizing antibodies (15). Tetanus toxin fragment C (TTFC), the nontoxic carboxy-terminal portion of tetanus toxin (21), is highly immunogenic and has been successfully used to immunize animals against tetanus (10). Based on these features, it has been suggested that TTFC is a good candidate to be a component of a multivalent vaccine (6, 7, 13).

In this study, we describe the construction of a rational vector that allows the directional cloning of guest DNA genetically fused with TTFC at the carboxy terminus as the first step towards developing a multivalent vaccine of defined composition. We used Sm14 antigen in order to evaluate whether TTFC is capable of increasing the immune response elicited by Sm14 itself and to assess whether the TTFC-Sm14 fusion protein would be able to protect against both tetanus and schistosomiasis. To evaluate these prospects, mice were immunized with the recombinant TTFC-Sm14 fusion protein and the percent protection was determined.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacterial strains and plasmids. The Escherichia coli DH5 and BL21-SI strains were used for all routine cloning and expression experiments. In the latter strain, the expression of T7 RNA polymerase is under the control of the osmotically inducible promoter proU (5). All DNA manipulations were carried out as previously described (19). The E. coli expression vector pAE has been previously described (1, 17). The DNA sequence coding for TTFC was amplified by PCR from pET32a-Fc (18) with the forward primer 5'CGCGGATCCAAAAATCTGGATTGTTGGGTTGAT3' and the reverse primer 5'CCCAAGCTTGCGGCCGCATCGATTCACTGCAGATCATTTGTCCATCCTTC3'. Underlined sequences indicate BamHI and HindIII restriction sites in the forward and reverse primers, respectively, which allowed the directional subcloning of the DNA insert into pAE. The resulting plasmid was designated pAE-TTFC. The DNA sequence coding for Sm14 was amplified by PCR from pAE-Sm14 (17) with the forward primer 5'AAACTGCAGACGCGTTCTAGTTTCTTGGGAAAGTGGAAACTT3' and the reverse primer 5'TTTCTTTTTGCGGCCGCACGCGTGAATTCGAGGCGTTAGGATAGTCGTT3'. Underlined sequences indicate PstI and NotI restriction sites in the forward and reverse primers, respectively. This sequence codified the native isoform of Sm14 that possesses threonine at position 20 (Sm14-T20) (17). The DNA insert was then subcloned into the plasmid pAE-TTFC at the PstI and NotI restriction sites, resulting in the pAE-TTFC/Sm14 plasmid, which allowed the expression of TTFC in fusion with protein Sm14. The PCR was carried out as previously described (19) in a GeneAmp 9600 PCR system (PerkinElmer, Fremont, Calif.). The amplified products were purified by agarose gel electrophoresis and recovered by using a commercial extraction system (In Concert gel extraction system; Life Technologies, Rockville, Md.). All constructions were confirmed by DNA sequencing with an ABI 377 automatic sequencer (PE Applied Biosystems, Foster City, Calif.).

Expression and purification of recombinant proteins. The E. coli BL21-SI cells transformed with pAE-TTFC, pAE-Sm14, or pAE-TTFC/Sm14 were grown overnight at 30°C in 50 ml of LBON (Luria-Bertani medium without NaCl) plus ampicillin. Culture was grown until an optical density at 600 nm of 0.6 was observed, and NaCl (0.3 M) was added. After 3 h of incubation, the cells were harvested by centrifugation, and the bacterial cell pellet was resuspended in a solution containing 20 mM Tris-HCl (pH 8.0), 0.3 M NaCl, and 5 mM imidazole and lysed in a French pressure cell. Aliquots of total cellular extracts were collected and analyzed by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-12% PAGE). Inclusion bodies were collected by centrifugation, solubilized with 20 mM Tris-HCl (pH 8.0)-0.5 M NaCl-8 M urea-5 mM imidazole, and incubated for 3 h at room temperature. The suspension was loaded onto a Ni²⁺-charged chelating Sepharose fast flow column (Amersham Pharmacia Biotech). Contaminants were washed away with 10 column volumes of a solution containing 20 mM Tris-HCl (pH 8.0), 500 mM NaCl, 6 M urea, 2 mM ß-mercaptoethanol, and 20 mM imidazole. This procedure was followed by two more washes with 10 column volumes of the same buffer containing 4 M urea and 40 mM imidazole in the first wash and 3 M urea and 60 mM imidazole in the second wash. The recombinant protein was then eluted with 1 M imidazole in the last wash buffer (20 mM Tris-HCl [pH 8.0] buffer containing 500 mM NaCl and 3 M urea). Protein refolding was achieved by multistep dialysis against a solution containing 20 mM Tris-HCl (pH 8.0) and 0.5 M NaCl, with a gradual decrease in the urea concentration (from 3 to 0 M). The refolded protein was extensively dialyzed against phosphate-buffered saline (PBS) at 4°C for 48 h. Purified protein samples were analyzed by SDS-12% PAGE.

Immunization of BALB/c mice and tetanus toxin challenge. The recombinant proteins were adsorbed onto 10% (vol/vol) Alhydrogel [2% Al(OH)₃; Biosector, Frederikssund, Denmark]. At this concentration, the protein adsorption capacity of the adjuvant is 2.3 ± 0.5 mg per ml, which is within the range of the protein concentration used. The adjuvant was provided by the Vaccine Quality Control Section of Instituto Butantan (São Paulo, Brazil), and we essentially followed the procedures routinely used in the Section. Recombinant proteins were adsorbed to solid particles of aluminum hydroxide for 2 h at 4°C before use. Protection assays against tetanus toxin were evaluated as described previously (9) with some minor modifications. Ten female BALB/c mice (4 to 6 weeks old; Instituto Butantan) were immunized subcutaneously with 10 µg of recombinant proteins and given a booster 14 days later with the same antigen preparation. Negative- and positive-control mice were injected with PBS and 2 µg of tetanus toxoid (Instituto Butantan), respectively. On the 27th day after the first immunization, the mice were bled from the retro-orbital plexus, and the pooled sera were analyzed by enzyme-linked immunosorbent assay (ELISA). On the 28th day, animals were challenged by subcutaneous inoculation with 10 times the minimal lethal dose (MLD) of tetanus toxin (Instituto Butantan) in PBS. Mice surviving after 96 h were considered protected. The percentage of protection was calculated by dividing the number of protected mice by the total number of challenged mice. The MLD was determined as described in the Manual for the Production and Control of Vaccines (25).

Parasites. Snail intermediate hosts (Biomphalaria glabrata) were infected with S. mansoni strain BH in the Laboratory of Parasitology (Instituto Butantan). Cercariae were allowed to shed from infected snails for 2 h under a halogen lamp. Cercarial counts and viability were determined via light microscopy (20).

Immunization of Swiss mice and S. mansoni cercaria challenge. The immunoprotection conferred by the recombinant proteins against S. mansoni cercariae was evaluated as described by Tendler et al. (20). Ten female Swiss mice (4 to 6 weeks old; Instituto Butantan) were footpad immunized with three doses of 10 µg of recombinant protein adsorbed to aluminum hydroxide as an adjuvant at intervals of 7 days. Control mice were injected with PBS or TTFC plus adjuvant. One group was not immunized (control of infection). On the 72nd day after the first immunization, all mice were bled from the retro-orbital plexus, and the pooled sera were analyzed by ELISA. The animals were further challenged subcutaneously with 100 cercariae/mouse 60 days after the last immunization dose and perfused 45 days later. Percent protection was calculated by the equation [(C –V)/C] x 100, where C is the average number of worms in control animals and V is the average number of worms in vaccinated animals. Statistical analysis was done with Student's t test (P < 0.05), based on three independent immunization and challenge experiments. The results were expressed as means ± standard errors of the means.

ELISA. Serum antibody responses after immunization with recombinant proteins and controls were quantified by an ELISA as described previously (18). Incubation with horseradish peroxidase (HRP)-conjugated goat anti-mouse immunoglobulin G (IgG) (dilution, 1:10,000; Sigma) in PBS-1% nonfat dry milk was done at 37°C for 1 h. The HRP substrate, o-phenylenediamine (0.04%) in citrate phosphate buffer (pH 5) plus 0.01% H₂O₂, was added, and the reaction was interrupted by the addition of 50 µl of 8 M H₂SO₄. Detection of antibody subclasses was performed using goat anti-mouse IgG1, IgG2a (dilution, 1:2,000; Sigma), and HRP-conjugated anti-goat antibodies (dilution, 1:10,000; Sigma) in PBS-1% nonfat dry milk at 37°C for 1 h. All samples were assayed in triplicate. The reciprocal titer was considered to be the last dilution of serum that registered an optical density of 0.10.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Expression and purification of recombinant proteins. The expected recombinant protein bands of TTFC, Sm14, and the fusion protein (at 53 and 22, 16 and 28, and 68 and 17 kDa, respectively) were observed in the bacterial cell lysates from noninduced and induced cultures by SDS-12% PAGE (Fig. 1, compare lanes 1 and 2).

View larger version (32K): [in this window] [in a new window]

FIG. 1. Analysis of the recombinant expressed protein from NaCl-induced E. coli BL21-SI by SDS-12% PAGE. Protein bands were visualized by Coomassie blue staining. Lane M, molecular weight protein markers; lane 1, noninduced culture; lane 2, induced culture; lanes 3 and 4, inclusion body pellet and supernatant after bacterial cell lysis and centrifugation, respectively; lane 5, purified protein eluted from Ni2+-charged chelating Sepharose column with 1 M imidazole.

The majority of the proteins were present in the pellet of the bacterial cell lysates in an insoluble form, as examined by SDS-12% PAGE (Fig. 1, compare lanes 3 and 4). The inclusion bodies were isolated and purified under denaturing conditions by chromatography on Ni⁺²-charged beads. The eluted proteins were refolded by employing a gradual decrease in the urea concentration. The highly homogenous protein bands corresponding to TTFC, Sm14, and the fusion were visualized by SDS-12% PAGE (Fig. 1, lane 5). The total yield of purified proteins was approximately 20 mg per liter of induced culture for TTFC and for the fusion protein and 50 mg per liter of induced culture for Sm14.

Antibody response and protection against tetanus toxin challenge in mice immunized with the recombinant antigens. BALB/c mice were immunized subcutaneously with two doses of purified recombinant proteins (TTFC, TTFC in fusion, or TTFC plus Sm14) or tetanus toxoid adsorbed to aluminum hydroxide. Negative-control mice were injected with purified Sm14 or PBS in adjuvant. Sera were analyzed by ELISA using tetanus toxin as the coating antigen. All the experimental groups showed high titers of anti-tetanus toxin antibodies. There was no difference between the level of antibodies induced by TTFC, TTFC in fusion, or TTFC coadministered with Sm14 and the level induced in the positive-control group immunized with tetanus toxoid, which is a component of the conventional tetanus vaccine (Fig. 2A).

View larger version (20K): [in this window] [in a new window]

FIG. 2. Antibody response induced by recombinant proteins. BALB/c mice were immunized subcutaneously at an interval of 14 days with two doses of purified recombinant proteins (TTFC, TTFC-Sm14 fusion protein, TTFC plus Sm14, or Sm14), tetanus toxoid, or PBS adsorbed to aluminum hydroxide. On the 27th day after the first immunization, mice were bled and pooled sera were analyzed by ELISA. (A) Microdilution plates were coated with tetanus toxin and incubated with a serial dilution of serum from the immunized mice for IgG measurements. The standard error did not exceed 10% of the mean values (data not shown). (B) Sera (1/320 dilution) from immunized mice were subjected to anti-tetanus toxins IgG1 and IgG2a.

Isotyping of the tetanus toxin-specific IgGs produced by immunized mice showed that TTFC, the fusion protein, and TTFC coadministered with Sm14 induced predominantly IgG1 and lower levels of IgG2a (Fig. 2B). Animals challenged with 10 times the MLD of tetanus toxin were observed for 96 h. Mice immunized with TTFC, TTFC in fusion with Sm14, TTFC coadministered with Sm14, or tetanus toxoid survived the challenge with tetanus toxin and did not show any symptoms of the disease. Animals inoculated with PBS or Sm14 died with severe symptoms of tetanus after 24 h (Table 1).

View this table: [in this window] [in a new window]

TABLE 1. Protection of BALB/c mice immunized with recombinant proteins and then challenged with tetanus toxin

Antibody response and protection against challenge with S. mansoni cercariae in mice immunized with the recombinant antigens. Swiss mice were footpad immunized with three doses of purified recombinant proteins (Sm14, Sm14 in fusion with TTFC, or Sm14 plus TTFC). Sera from the animals were analyzed by ELISA using recombinant Sm14 as the coating antigen. No differences were observed in the levels of antibodies induced by Sm14, Sm14 in fusion with TTFC, or Sm14 coadministered with TTFC (Fig. 3A). Isotyping of the Sm14-specific IgGs produced by the immunized mice showed that Sm14, Sm14 in fusion with TTFC, and Sm14 coadministered with TTFC induced predominantly IgG1, IgG2b and lower levels of IgG2a (Fig. 3B).

View larger version (17K): [in this window] [in a new window]

FIG. 3. Antibody responses induced by recombinant proteins. Swiss mice were immunized at intervals of 7 days with three doses of purified recombinant proteins (Sm14, TTFC-Sm14 fusion protein, Sm14 plus TTFC, or TTFC) or PBS adsorbed to aluminum hydroxide. On the 72nd day after the first immunization, mice were bled and pooled sera were analyzed by ELISA. (A) Microdilution plates were coated with Sm14 and incubated with a serial dilution of serum from immunized mice for IgG measurements. The standard error did not exceed 10% of the mean values (data not shown). (B) Sera (1/160 dilution) from immunized mice were subjected to anti-Sm14 IgG1 and IgG2a.

Animals were challenged with S. mansoni cercariae, and the level of protection was calculated by comparing the number of adult worms recovered from the experimental group to the number from the noninjected control group. Mice immunized with Sm14 or Sm14 in fusion with TTFC showed the highest levels of protection (50.6 or 51.2%, respectively), while the mice immunized with the same proteins coadministered showed a 34.9% level of protection (Fig. 4). However, this difference in experimental groups has no statistical significance. On the other hand, the difference between animal protection data obtained from the experimental group and from the control group was statistically significant. Animals inoculated with PBS or TTFC showed no protection, and the number of worms recovered from them was similar to that recovered from the control group.

View larger version (12K): [in this window] [in a new window]

FIG. 4. Protection of mice against challenge with S. mansoni cercariae. Swiss mice were immunized with three doses of 10 µg of recombinant proteins adsorbed to aluminum hydroxide at intervals of 7 days. Two of the control groups were immunized with PBS plus alum or TTFC plus alum, and one group, the control of the infection, was not immunized. All mice were challenged subcutaneously 60 days after the last immunization with 100 cercariae/mouse and perfused 45 days later. The mean worm burden was calculated using results from three experiments. Percent protection in the three independent experiments was calculated by comparing their results with the results obtained from the control groups. Statistical analysis was done with Student's t test. Results are expressed as means ± standard errors. P was <0.05 compared with results from the control group.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The results presented here indicate that the expression of recombinant antigens in fusion at the carboxy terminus of TTFC deserves consideration as a strategy for the development of a new, well-defined vaccine. Due to its ability to trigger a protective immune response against tetanus toxin challenge, TTFC has been considered to be a suitable alternative for the current vaccine but mostly has been considered to be a candidate component of multivalent vaccines (6, 7, 8, 11, 13, 14). The rational design of the constructed vector allows for the expression of genetically fused foreign antigens at the carboxy end of TTFC. In addition, the presence of a histidine tag at the amino terminus of the recombinant fused protein allows for very fast purification through one-step affinity chromatography on nickel-charged beads.

The choice of Sm14 was motivated by the global importance of schistosomiasis (2, 4, 22) and by the fact that the protein itself is one of the few vaccine candidates that consistently induces 50% protection against S. mansoni cercariae in experimental animal models (16, 17, 20, 23). In addition, Sm14 affords 100% protection against F. hepatica, a recognized agricultural problem (23).

The recombinant fused protein was expressed as insoluble inclusion bodies. We were able to recover the protein successfully from the inclusion bodies by using urea and to obtain the refolded protein, without precipitation, by a gradual multistep dialysis.

Antibodies (IgGs) produced by mice immunized with the recombinant proteins were predominantly IgG1 and IgG2b, which suggests that the mice had a Th2 response. However, the fact that alum was used in all immunization experiments may account for this type of response.

The fusion protein (TTFC-Sm14) was immunogenic and capable of eliciting immunoprotective responses in mice against lethal doses of tetanus toxin and S. mansoni cercaria infection. Other studies showed that the pertussis toxin S1 subunit in fusion with TTFC was capable of inducing neutralizing antibodies against the agents of pertussis and tetanus (6). Moreover, fusion with TTFC has also been shown to increase the immunogenicity of other antigens. For example, expression in Salmonella enterica of the 28-kDa S. mansoni GST (Sm28-GST) or Sh28-GST in fusion with TTFC was shown to increase the levels of antibodies in mice (13, 14). However, in the case of Sm28-GST or Sh28-GST expressed as a fusion to TTFC, no challenge/protection experiments were performed against either antigen (13, 14).

Although TTFC was not shown by our study to be capable of increasing the immunogenicity elicited by the Sm14 antigen, our data clearly show that the recombinant Sm14 protein expressed in fusion with TTFC retained the immunogenic characteristics of Sm14 and conferred the same level of protection against S. mansoni cercaria infection. To our knowledge, this is the first time that mice immunized with Sm14 expressed as a fusion protein with TTFC have been protected against challenges with the antigens, tetanus toxin, and S. mansoni cercariae.

Previous work with a recombinant pertussis toxin-TTFC fusion protein has shown that a heterologous antigen can be fused at the amino terminus of TTFC without hampering its receptor-binding activity or its ability to elicit protective immunity (6). Our protection experiments against tetanus toxin challenge showed that the presence of Sm14 fused at the carboxy terminus of TTFC did not eliminate the immunogenic properties of the protein, indicating that foreign antigens can be fused at both ends of TTFC. Moreover, this genetic construction allows the production of both antigens in the same fermentation process and precludes the need for purification of individual protein antigens. The approach presented in this investigation increases the feasibility of using TTFC genetically fused with a guest antigen and indicates that the production of a multivalent vaccine is possible.

 
We express our deep gratitude to Frank H. Quina (Instituto de Química, Universidade de São Paulo) for a critical reading of the manuscript and to Celso R. R. Ramos for providing the pAE-Sm14 plasmid.

This research was supported by FAPESP, CNPq, PADCT-FINEP, and the Fundação Butantan.

 
* Corresponding author. Mailing address: Centro de Biotecnologia, Instituto Butantan, Av. Vital Brasil, 1500, CEP 05503-900 São Paulo, SP, Brazil. Phone: 55(11)-3726-7222, ext. 2083. Fax: 55(11)-3726-1505. E-mail: tabet{at}butantan.gov.br.

Editor: J. D. Clements

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Areas, A. P. M., M. L. S. Oliveira, C. R. R. Ramos, M. E. Sbrogio-Almeida, I. Raw, and P. L. Ho. 2002. Synthesis of cholera toxin B subunit gene: cloning and expression of a functional 6XHis-tagged protein in Escherichia coli. Protein Expr. Purif. 25:481-487.[CrossRef][Medline]
2
2. Bergquist, N. R. February 2004, posting date. Prospects for schistosomiasis vaccine development. WHO TDRnews 71. [Online.] http://who.int/tdr/publication/tdrnews/news71/schisto.html.
3
3. Bergquist, N. R., and D. G. Colley. 1998. Schistosomiasis vaccines: research to development. Parasitol. Today 14:99-104.
4
4. Bergquist, P., M. Al-Sherbiny, R. Barakat, and R. Olds. 2002. Blueprint for schistosomiasis vaccine development. Acta Trop. 82:183-192.[CrossRef][Medline]
5
5. Bhandari, P., and J. Gowrishankar. 1997. An Escherichia coli host strain useful for efficient overproduction of cloned gene products with NaCl as the inducer. J. Bacteriol. 179:4403-4406.[Abstract/Free Full Text]
6
6. Boucher, P., H. Sato, Y. Sato, and C. Locht. 1994. Neutralizing antibodies and immunoprotection against pertussis and tetanus obtained by use of recombinant pertussis toxin-tetanus toxin fusion protein. Infect. Immun. 62:449-456.[Abstract/Free Full Text]
7
7. Chabalgoity, J. A., C. M. A. Khan, A. A. Nash, and C. E. Hormaeche. 1996. A Salmonella enterica serovar Typhimurium htrA live vaccine expressing multiple copies of a peptide comprising amino acids 8-23 of herpes simplex virus glycoprotein D as a genetic fusion to tetanus toxin fragment C protects mice from herpes simplex virus infection. Mol. Microbiol. 19:791-801.[CrossRef][Medline]
8
8. Chabalgoity, J. A., J. A. Harrison, A. Esteves, R. D. de Hormaeche, R. Ehrlich, C. M. A. Khan, and C. E. Hormaeche. 1997. Expression and immunogenicity of an Echinococcus granulosus fatty acid-binding protein in live attenuated Salmonella vaccine strains. Infect. Immun. 65:2402-2412.[Abstract]
9
9. Fairweather, N. F., V. A. Lyness, and D. J. Maskell. 1987. Immunization of mice against tetanus with fragments of tetanus toxin synthesized in Escherichia coli. Infect. Immun. 55:2541-2545.[Abstract/Free Full Text]
10
10. Figueiredo, D., C. Turcotte, G. Frankel, Y. Li, O. Dolly, G. Wilkin, D. Marriot, N. Fairweather, and G. Dougan. 1995. Characterization of recombinant tetanus toxin derivatives suitable for vaccine development. Infect. Immun. 63:3218-3221.[Abstract]
11
11. Gómez-Duarte, O. G., J. Galen, S. N. Chatfield, R. Rappuoli, L. Eidels, and M. M. Levine. 1995. Expression of fragment C of tetanus toxin fused to a carboxyl-terminal fragment of diphtheria toxin in Salmonella typhi CVD 908 vaccine strain. Vaccine 13:1596-1602.[CrossRef][Medline]
12
12. Ismail, M., S. Botros, A. Metwally, S. William, A. Farghally, L. F. Tao, T. A. Day, and J. L. Bennett. 1999. Resistance to praziquantel: direct evidence from Schistosoma mansoni isolated from Egyptian villagers. Am. J. Trop. Med. Hyg. 60:932-935.[Abstract]
13
13. Khan, C. M. A., B. Villareal-Ramos, R. J. Pierce, G. Riveau, R. de Hormaeche, H. McNeill, T. Ali, N. Fairweather, S. Chatfield, A. Capron, G. Dougan, and C. E. Hormaeche. 1994. Construction, expression, and immunogenicity of the Schistosoma mansoni P28 glutathione S-transferase as a genetic fusion to tetanus toxin fragment C in a live Aro attenuated vaccine strain of Salmonella. Proc. Natl. Acad. Sci. USA 91:11261-11265.[Abstract/Free Full Text]
14
14. Lee, J. J., K. A. Sinha, J. A. Harrison, R. D. de Hormaeche, G. Riveau, R. J. Pierce, A. Capron, R. A. Wilson, and C. M. A. Khan. 2000. Tetanus toxin fragment C expressed in live Salmonella vaccines enhances antibody responses to its fusion partner Schistosoma haematobium glutathione S-transferase. Infect. Immun. 68:2503-2512.[Abstract/Free Full Text]
15
15. Montecucco, C., and G. Schiavo. 1995. Structure and function of tetanus and botulinum neurotoxins. Q. Rev. Biophys. 28:423-472.[Medline]
16
16. Ramos, C. R., M. M. Vilar, A. L. Nascimento, P. L. Ho, N. Thaumaturgo, R. Edelenyi, M. Almeida, W. O. Dias, C. M. Diogo, and M. Tendler. 2001. r-Sm14—pRSETA efficacy in experimental animals. Mem. Inst. Oswaldo Cruz 96:131-135.
17
17. Ramos, C. R. R., R. C. R. Figueiredo, T. A. Perttinhez, M. M. Vilar, A. L. T. O. Nascimento, M. Tendler, I. Raw, A. Spisni, and P. L. Ho. 2003. Gene structure and M20T polymorphism of the Schistosoma mansoni Sm14 fatty acid-binding protein. J. Biol. Chem. 278:12745-12751.[Abstract/Free Full Text]
18
18. Ribas, A. V., P. L. Ho, M. M. Tanizaki, I. Raw, and A. L. T. O. Nascimento. 2000. High-level expression of tetanus toxin fragment C-thioredoxin fusion in Escherichia coli. Biotechnol. Appl. Biochem. 31:91-94.
19
19. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
20
20. Tendler, M., C. A. Brito, M. V. Vilar, N. Serra-Freire, C. M. Diogo, M. S. Almeida, A. C. B. Delbem, J. F. da Silva, W. Savino, R. C. Garrati, N. Katz, and A. J. Simpson. 1996. A Schistosoma mansoni fatty acid-binding protein, Sm14, is the potential basis of a dual-purpose antihelminth vaccine. Proc. Natl. Acad. Sci. USA 93:269-273.[Abstract/Free Full Text]
21
21. Turton, K., J. A. Chaddock, and R. Archarya. 2002. Botulinum and tetanus neurotoxins: structure, function and therapeutic utility. Trends Biochem. Sci. 27:552-558.[CrossRef][Medline]
22
22. Verjovski-Almeida, S., R. DeMarco, E. A. Martins, P. E. Guimaraes, E. P. Ojopi, A. C. Paquola, J. P. Piazza, M. Y. Nishiyama, Jr., J. P. Kitajima, R. E. Adamson, P. D. Ashton, M. F. Bonaldo, P. S. Coulson, G. P. Dillon, L. P. Farias, S. P. Gregorio, P. L. Ho, R. A. Leite, L. C. Malaquias, R. C. Marques, P. A. Miyasato, A. L. Nascimento, F. P. Ohlweiler, E. M. Reis, M. A. Ribeiro, R. G. Sa, G. C. Stukart, M. B. Soares, C. Gargioni, T. Kawano, V. Rodrigues, A. M. Madeira, R. A. Wilson, C. F. Menck, J. C. Setubal, L. C. Leite, and E. Dias-Neto. 2003. Transcriptome analysis of the acoelomate human parasite Schistosoma mansoni. Nat. Genet. 35:148-157.[CrossRef][Medline]
23
23. Vilar, M. M., F. B. Barrientos, M. Almeida, N. Thaumaturgo, A. Simpson, R. Garratt, and M. Tendler. 2003. An experimental bivalent peptide vaccine against schistosomiasis and fascioliasis. Vaccine 22:137-144.[CrossRef][Medline]
24
24. World Health Organization. 2002. The prevention and control of schistosomiasis and soil-transmitted helminthiasis. Report of the Joint WHO Expert Committees. World Health Organization, Geneva, Switzerland.
25
25. World Health Organization. 1977. Manual for the production and control of vaccines. BLG/UNDP/72.2 Rev. 1, 79. WHO, Geneva, Switzerland.

---

Infection and Immunity, October 2004, p. 5931-5937, Vol. 72, No. 10
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.10.5931-5937.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• McManus, D. P., Loukas, A. (2008). Current Status of Vaccines for Schistosomiasis. Clin. Microbiol. Rev. 21: 225-242 [Abstract] [Full Text]  
• Abd El Ghany, M., Jansen, A., Clare, S., Hall, L., Pickard, D., Kingsley, R. A., Dougan, G. (2007). Candidate Live, Attenuated Salmonella enterica Serotype Typhimurium Vaccines with Reduced Fecal Shedding Are Immunogenic and Effective Oral Vaccines. Infect. Immun. 75: 1835-1842 [Abstract] [Full Text]  
• Barbosa, A. S., Abreu, P. A. E., Neves, F. O., Atzingen, M. V., Watanabe, M. M., Vieira, M. L., Morais, Z. M., Vasconcellos, S. A., Nascimento, A. L. T. O. (2006). A Newly Identified Leptospiral Adhesin Mediates Attachment to Laminin. Infect. Immun. 74: 6356-6364 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Abreu, P. A. E. Articles by Nascimento, A. L. T. O. Search for Related Content PubMed PubMed Citation Articles by Abreu, P. A. E. Articles by Nascimento, A. L. T. O.