Previous Article | Next Article ![]()
Infection and Immunity, November 2004, p. 6197-6205, Vol. 72, No. 11
0019-9567/04/$08.00+0 DOI: 10.1128/IAI.72.11.6197-6205.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Biotechnology, University of Ulm, Ulm, Germany,1 Department of Biochemistry, University of Pavia, Pavia, Italy,2 InterCell AG, Vienna, Austria3
Received 25 March 2004/ Returned for modification 21 May 2004/ Accepted 22 July 2004
|
|
|---|
|
|
|---|
Numerous pathogenic bacteria adhere to host cells by surface proteins, termed adhesins, that bind to components of the extracellular matrix (ECM). The ECM of mammalian tissues consists of glycoproteins, including collagen, laminin, fibronectin, and fibrinogen, which form a macromolecular structure underlying epithelial and endothelial cells (20). Several studies have described interactions of S. agalactiae with the ECM proteins laminin, fibronectin, and fibrinogen (22, 38, 42). For each of these binding functions, corresponding bacterial receptors have been identified. In S. agalactiae, the C5a peptidase was shown to play a role in fibronectin binding (4), the Lmb protein mediates binding to human laminin (38), and the proteins FbsA and FbsB are involved in fibrinogen binding (18, 35). On the amino acid level, the fibrinogen-binding proteins FbsA and FbsB are unrelated to each other, but both have a surface-exposed localization in the cell wall of the bacteria. The FbsB protein was shown to bind to human fibrinogen by its N-terminal 388 amino acids (18), whereas the FbsA protein interacts with fibrinogen by repetitive units, each 16 amino acids in length (35). Even a single repeat of FbsA was demonstrated to bind to human fibrinogen (35). Epidemiological studies revealed significant variation in the number of repeats in the FbsA protein between various S. agalactiae strains. Thus, FbsA variants ranging from 3 to 30 repeats have been described for different clinical isolates. The FbsA protein was shown to protect the bacteria from opsonophagocytosis, indicating a role of this protein in the virulence of S. agalactiae.
The present study investigated the importance of FbsA in the adherence and invasion of epithelial cells by S. agalactiae. Defined fbsA deletion mutants were constructed and tested for their interaction with host cells. The effect of plasmid-mediated fbsA expression on bacterial cell adherence and invasion was tested both in S. agalactiae and in Lactococcus lactis. Furthermore, flow cytometry and latex bead experiments were performed to analyze the interaction of FbsA with the surface of epithelial cells. Finally, we tested the influence of the FbsA protein and of FbsA-specific monoclonal antibodies (MAbs) on host cell adherence and invasion by S. agalactiae.
|
|
|---|
was used for cloning purposes, and E. coli BL21 served as the host for the production of FbsA fusion protein. L. lactis subsp. cremoris MG1363 was used for heterologous expression of the fbsA gene. S. agalactiae was cultivated at 37°C in Todd-Hewitt yeast broth (THY) containing 1% yeast extract. S. agalactiae strains carrying the plasmid pOri23 or pOrifbsA were grown in the presence of erythromycin (5 µg/ml). E. coli was grown at 37°C in Luria broth, and clones carrying pOri23 or pET28 derivatives (35) or the plasmid pG+
fbsA (35) were selected in the presence of erythromycin (300 µg/ml), kanamycin (50 µg/ml), or ampicillin (100 µg/ml). L. lactis was grown at 30°C in M17 medium (Oxoid) supplemented with 0.5% glucose, and strains carrying pOri23 or pOrifbsA were selected with erythromycin (5 µg/ml). |
View this table: [in a new window] |
TABLE 1. Bacterial strains used in this study
|
Construction of fbsA deletion mutants of S. agalactiae.
The fbsA gene was deleted in S. agalactiae strains O90R, 706 S2, O176 H4A, and SS1169 according to the procedure described by Schubert et al. (35). Briefly, the thermosensitive plasmid pG+
fbsA was transformed into the S. agalactiae strains by electroporation, and transformants were selected by growth on erythromycin agar at 30°C. Cells in which pG+
fbsA had integrated into the chromosome were selected by growth of the transformants at 37°C with erythromycin selection as described previously (24). Integrant strains were serially passaged for 5 days in liquid medium at 30°C without erythromycin selection to facilitate the excision of plasmid pG+
fbsA, leaving the desired fbsA deletion in the chromosome. Dilutions of the serially passaged cultures were plated onto agar, and single colonies were tested for erythromycin sensitivity to identify pG+
fbsA excisants. Chromosomal DNA of erythromycin-sensitive S. agalactiae excisants was tested by Southern blotting after HindIII digestion by using a digoxigenin-labeled fbsA flanking fragment as described previously (35).
Plasmid-mediated expression of fbsA in S. agalactiae and L. lactis.
The fbsA structural gene, including its ribosomal binding site, was amplified from chromosomal S. agalactiae 6313 DNA by PCR with primers 5'GTTTAGTGGATCCGAAGTAAGGAGAAAATTAATTGTTC and 5'ATCCCATATAATGACCTC, and the PCR product was directly ligated into the TA cloning vector pDrive (Qiagen). The fbsA gene was subsequently isolated by BamHI digestion and ligated into the BamHI-digested E. coli-Streptococcus expression vector pOri23 (31). Plasmid pOri23 possesses the strong promoter P23 from L. lactis (45), which is silent in E. coli but allows a constitutive, high-level expression of heterologously expressed genes in different gram-positive bacteria (31). After cloning of the fbsA gene in pOri23, its orientation was determined by HindIII digestion, and the resulting plasmid was termed pOrifbsA. Vector pOri23 and plasmid pOrifbsA were transformed by electroporation into S. agalactiae and L. lactis with subsequent erythromycin selection. L. lactis cells were made competent and transformed as described elsewhere (47). Sequencing of the insert of pOrifbsA revealed in the fbsA gene two A
G transitions, which result in amino acid exchanges in the FbsA protein. A mutation at bp 328 in the structural fbsA gene results in an exchange of N110 to S110 which does not affect the fibrinogen binding of the respective repeat unit (35). However, a mutation at bp 881 leads to an exchange of D310 to G310, which significantly reduces the fibrinogen-binding capability of the respective repeat unit (35). Thus, pOrifbsA-mediated fbsA expression results in the synthesis of an FbsA protein with 18 instead of 19 functional fibrinogen-binding repeats.
Antibodies and human proteins. Affinity-purified polyclonal rabbit antifibrinogen antibodies were obtained from Dako Biochemicals. Fibrinogen, fibronectin, and polyclonal rabbit antifibronectin antibodies were purchased from Sigma-Aldrich. Fibrinogen was passed through a gelatin-Sepharose column to remove residual contaminating fibronectin in the preparation. The purity of the fibrinogen preparation was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Coomassie blue staining and by Western blotting with antifibronectin antibodies. The generation and characterization of the anti-FbsA MAbs 5H2 and 2B1 are described elsewhere (30).
Binding of soluble 125I-labeled fibrinogen to S. agalactiae.
Purified human fibrinogen was radiolabeled with 125I, using the chloramine T method (21). Binding of labeled fibrinogen to S. agalactiae was performed as described previously (35). Statistical analysis was performed with a Student's paired t test, and differences were considered significant at a P value of
0.05.
Preparation of hexahistidyl-tagged fusion proteins. The FbsA fusion protein originates from S. agalactiae 6313 and possesses 19 repeats, each 16 amino acids in length (35). The Bsp protein is a surface protein from S. agalactiae that plays a role in the morphogenesis of the bacteria (32) and served as a control in the present study. The fusion proteins were synthesized in recombinant E. coli BL21 by the addition of 1 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) after the culture had reached an optical density at 600 nm of 1.0. The cells were disrupted with a French pressure cell, and purification of the fusion protein was performed according to the instructions of Qiagen by Ni2+ affinity chromatography.
Adherence and invasion assays. Adherence of S. agalactiae or L. lactis to epithelial cells and internalization into epithelial cells were assayed as described previously (17). Briefly, A549 cells were transferred to 24-well tissue culture plates at approximately 4 x 105 cells per well and cultivated overnight in RPMI tissue culture medium supplemented with 10% fetal calf serum. After replacement of the medium with 1 ml of fresh medium, the cells were infected with S. agalactiae or L. lactis at a multiplicity of infection of 10:1 and incubated at 37°C for 2 h. The infected cells were subsequently washed three times with phosphate-buffered saline (PBS). The number of cell-adherent bacteria was determined by lysis of the eukaryotic cells with distilled water and subsequent determination of CFU by plating appropriate dilutions of the lysates on THY agar. Intracellular bacteria were determined after a further incubation of the infected cells for 2 h with RPMI medium containing penicillin G (10 U) and streptomycin (0.01 mg) to kill extracellular bacteria. After three washes with PBS, the epithelial cells were lysed in distilled water and the amount of intracellular bacteria was quantitated by plating serial dilutions of the lysate onto THY agar plates. All samples were tested in triplicate, and experiments were repeated at least three times.
To assess the effect of FbsA, Bsp, polyclonal antifibrinogen, or polyclonal antifibronectin antibodies on the adherence and invasion of S. agalactiae, the adherence and invasion assays were performed as described above, with the following modifications. A549 cells in tissue culture wells were incubated for 15 min in 100 µl of PBS with different amounts of purified proteins or antibodies as described elsewhere (25). Bacterial cells were then added in tissue culture medium, and the wells were incubated at 37°C for 2 h. To analyze the effect of fibrinogen, fibronectin, or anti-FbsA MAbs on the bacterial adherence and invasion, S. agalactiae 6313 was incubated for 15 min in 500 µl of RPMI medium containing different amounts of fibrinogen, fibronectin, or the MAbs. Subsequently, the bacteria were used to infect A549 cells, and the remainder of the experiment was carried out as described above.
Fluorescence-activated cell sorter analysis. Binding of purified FbsA protein to A549 cells was performed essentially as described by Taschner et al. (43). In brief, 5 x 106 A549 cells were pelleted by centrifugation at 4°C and washed with 10% bovine serum albumin (BSA) in PBS. Subsequently, the cells were incubated for 45 min on ice with 5 µg of Fc fragments (Dianova) and washed two times with 10% BSA in PBS. The cells were incubated on ice for 1 h with different concentrations of FbsA fusion protein or with 25 µg of a His-tagged S. pyogenes surface protein (Spy0416) as a negative control. Subsequently, the cells were washed two times with 10% BSA in PBS and incubated for 1 h on ice with an anti-His tag MAb (1:100) (Qiagen). After two washings with 10% BSA in PBS, fluorescein isothiocyanate (FITC)-labeled anti-mouse immunoglobulin G (1:500) (Dako) was added and the suspension was incubated for 1 h on ice. The cells were again washed two times with 10% BSA in PBS and fixed for 30 min with 1% paraformaldehyde in PBS. The fluorescence of 104 cells was quantitated in a FACSCalibur flow cytometer (Becton Dickinson), using a laser at 488 nm and the FL1 PMT (530/30 nm). The data were analyzed with the WinMDI software, displaying the fluorescence intensity on the x axis and the number of events on the y axis. The geometric mean value was calculated with the MinMDI software as n root(a1 x a2 x a3... .an). The geometric mean takes into account the weighting of the data distribution.
Scanning electron microscopy of FbsA-coated latex beads. Approximately 109 latex beads (3-µm diameter) (Sigma) were washed three times in PBS. One half was resuspended in 1.0 ml of PBS containing FbsA fusion protein (500 µg/ml), and the remaining half was resuspended in 1.0 ml of PBS with BSA (10 mg/ml). The beads were incubated overnight at 4°C with end-over-end rotation. After pelleting of the beads by centrifugation, the amount of remaining protein in the supernatant was determined with a Bradford protein assay kit (Bio-Rad). The beads were washed once with PBS and blocked for 2 h with BSA (10 mg/ml) in PBS at room temperature. The beads were washed twice with PBS and once with RPMI plus 10% FCS and resuspended in RPMI plus 10% FCS. Confluent A549 cells in 24-well plates were inoculated with 2 x 108 beads per well in a total volume of 1.0 ml for 2 h at 37°C in a 5% CO2 atmosphere. The cells were washed five times with PBS and fixed with 3% paraformaldehyde and 4% glutaraldehyde in 100 mM phosphate buffer (pH 7.4) for scanning electron microscopy. Scanning electron microscopy was performed with a Zeiss DSM 962 microscope.
|
|
|---|
![]() View larger version (17K): [in a new window] |
FIG. 1. Binding of radiolabeled fibrinogen (A) and host cell adherence and invasion (B) by different S. agalactiae strains and their fbsA deletion mutants. Binding of 125I-labeled fibrinogen was quantitated by incubating a defined number of bacteria with a defined amount of radiolabeled fibrinogen and relating the amount of fibrinogen bound to bacteria to the total amount of fibrinogen added. To determine the adherence and invasiveness of the different strains with the lung epithelial cell line A549, equal numbers of each streptococcal strain were used to infect A549 cells, and the numbers of cell-adherent and internalized bacteria were related to the number of input bacteria. The values represent the means ± standard errors of the means from three independent experiments, each performed in triplicate. The values for the mutant strains are statistically significant compared to those for the parental strains, with a P value of 0.05.
|
Plasmid-mediated expression of fbsA partially restores host cell adherence to and invasion of S. agalactiae 6313
fbsA.
To complement the fbsA deficiency of mutant 6313
fbsA, we attempted to clone from strain 6313 the entire fbsA gene, including its promoter region, into the E. coli-Streptococcus shuttle vector pAT28. Despite several attempts, we repeatedly failed to clone the fbsA gene into this vector. As the promoter of the fbsA gene is very active in both E. coli and S. agalactiae (reference 17 and unpublished results), we hypothesized that overexpression of fbsA by its own promoter might be toxic to E. coli and S. agalactiae. We therefore cloned the fbsA gene, devoid of its promoter region, into the E. coli-Streptococcus expression vector pOri23 (31), resulting in plasmid pOrifbsA. After transformation of the plasmids pOri23 and pOrifbsA into S. agalactiae 6313 and 6313
fbsA, respectively, strain 6313
fbsA(pOrifbsA) showed about 80% fibrinogen binding compared to strain 6313(pOri23) (30). The recombinant strains were subsequently examined for their capacities for adhesion to and invasion of A549 cells (Fig. 2). S. agalactiae strains 6313(pOri23) and 6313
fbsA(pOri23) showed adherence and invasion rates comparable to those of their plasmid-free parental strains, demonstrating that the vector pOri23 does not influence the adherence and invasion properties of these strains. In contrast, plasmid-mediated expression of fbsA in strain 6313
fbsA(pOrifbsA) significantly increased its adherence to and invasion of A549 cells compared to strain 6313
fbsA(pOri23). Our findings therefore demonstrate that the reduced adherence to and invasion of A549 cells by mutant 6313
fbsA are due to its fbsA deficiency and not to unrelated mutations in its chromosome. However, the adhesive and invasive efficiencies of 6313
fbsA(pOrifbsA) were significantly lower than those of 6313(pOri23), indicating that pOri23-driven expression of fbsA does not fully complement the fbsA deficiency of mutant 6313
fbsA.
![]() View larger version (21K): [in a new window] |
FIG. 2. Adherence to and invasion of the lung epithelial cell line A549 by S. agalactiae strains 6313(pOri23), 6313 fbsA(pOri23), and 6313 fbsA(pOrifbsA) and by L. lactis(pOri23) and L. lactis(pOrifbsA), respectively. The epithelial cell line A549 was infected with equal amounts of bacteria of each strain, and the numbers of cell-adherent and internalized bacteria were related to the number of input bacteria. The dotted line separates the results obtained with S. agalactiae and L. lactis from each other. Each experiment was performed at least three times in triplicate. Error bars indicate standard errors of the means.
|
fbsA(pOrifbsA) (30). Both L. lactis strains were tested in tissue culture experiments for their adhesive and invasive capacities with A549 cells (Fig. 2). L. lactis(pOri23) exhibited no adherence to and invasion of A549 cells, whereas L. lactis(pOrifbsA) showed significant adherence to A549 cells but only little invasion into this cell line. Of note is that host cell adherence of L. lactis(pOrifbsA) was of the same order of magnitude as that of the complemented S. agalactiae strain 6313
fbsA(pOrifbsA) (Fig. 2). These findings demonstrate that FbsA does not require an S. agalactiae coreceptor for host cell adherence. Our results also suggest that FbsA promotes bacterial adherence to but not invasion into host cells. The FbsA protein binds directly to A549 cells. Flow cytometry and latex bead experiments were performed to investigate the interaction of FbsA with A549 cells in more detail. In flow cytometry experiments, a dose-dependent binding of the FbsA fusion protein to A549 cells was observed (Fig. 3), suggesting that FbsA binds directly to host cells. To further investigate the interaction of FbsA with epithelial cells, latex beads were coated with the FbsA fusion protein and tested for their interaction with human A549 cells. As a control, BSA-coated latex beads were analyzed for their binding to A549 cells. By scanning electron microscopy, BSA-coated latex beads were rarely found associated with A549 cells (Fig. 4A), while FbsA-coated beads bound in high numbers to A549 cells (Fig. 4B). Attachment of the FbsA-coated beads to the plasma membrane of A549 cells was characterized by contact with microvilli and structures that resembled early pseudopods (Fig. 4C). In a few cases, the pseudopod appeared to surround the surface of the bead, indicating that the bead was finally internalized (Fig. 4D). Taken together, the results from our flow cytometry and latex bead experiments indicate a direct interaction of FbsA with structures on the surface of A549 cells.
![]() View larger version (30K): [in a new window] |
FIG. 3. Detection of FbsA binding to the surface of A549 cells by flow cytometry. A549 cells were incubated with different amounts of purified FbsA fusion protein as described in Materials and Methods and tested with mouse anti-His tag antibodies and FITC-coupled anti-mouse antibodies for the interaction of FbsA with the host cell surface. The fluorescence intensity is given on the x axis, and the number of events (cells) is given on the y axis. The graphs show an increased fluorescence intensity of the cells upon binding of the FITC-coupled antibody-FbsA protein complex, demonstrating a concentration-dependent binding of FbsA to A549 cells. Gmean represents the geometric mean, which takes into account the weighting of the data distribution.
|
![]() View larger version (164K): [in a new window] |
FIG. 4. Binding of FbsA-coated latex beads to human A549 cells. Latex beads were coated with either BSA (A) or FbsA fusion protein (B to D), and the interaction of the coated beads with the lung epithelial cell line A549 was analyzed by scanning electron microscopy.
|
A MAb against the fibrinogen-binding site of FbsA blocks the bacterial adherence. To better understand the interaction of FbsA with the host cell surface at the molecular level, we used MAbs directed against different epitopes of the FbsA protein (30). MAb 5H2 binds to the repeat region of FbsA, thereby blocking the fibrinogen binding of the FbsA protein. In contrast, MAb 2B1 binds to the repeat region of FbsA without interfering with the binding of FbsA to human fibrinogen. After preincubation of S. agalactiae 6313 with either of the two MAbs, the streptococcal host cell adherence and invasion were quantitated in tissue culture experiments. As depicted in Fig. 5, increasing concentrations of MAb 5H2 caused a dose-dependent inhibition of the bacterial adherence and invasiveness. Preincubation of strain 6313 with 1.5 µg of MAb 5H2 per ml almost completely blocked the streptococcal adherence to and invasion of A549 cells. In contrast, preincubation of strain 6313 with up to 10 µg of MAb 2B1 per ml did not influence its host cell adherence or invasion (data not shown).
![]() View larger version (19K): [in a new window] |
FIG. 5. Competitive inhibition of streptococcal adherence and invasion by MAb 5H2, which specifically blocks the binding of FbsA to human fibrinogen. Tissue culture experiments were performed after pretreatment of S. agalactiae 6313 with different amounts of MAb 5H2. Each experiment was performed at least three times in triplicate. Error bars indicate standard errors of the means.
|
|
|
|---|
Previously, the fbsA gene was found to be widely distributed in different S. agalactiae strains and to be essential for the fibrinogen binding of S. agalactiae 6313 (35). However, the relevance of FbsA for the fibrinogen binding of other clinical S. agalactiae isolates remained unclear. Here, we provide evidence that various S. agalactiae strains, belonging to different serotypes, require FbsA for an efficient interaction with human fibrinogen. Interestingly, the fbsB gene, encoding the second fibrinogen-binding protein in S. agalactiae, was found not to influence the fibrinogen binding of the bacteria (18). Our results therefore suggest that FbsA is of general importance for the fibrinogen binding of S. agalactiae.
It is noteworthy that the S. agalactiae strains investigated in the present study showed significant differences in their ability to interact with human fibrinogen. Recently, the internal repeats of the highly repetitive FbsA protein were shown to mediate fibrinogen binding, and even a single repeat of FbsA was demonstrated to interact with fibrinogen (35). The FbsA proteins of S. agalactiae 6313, O90R, 706 S2, 176 H4A, and SS1169 differ from each other in that they possess 19, 10, 17, 3, and 30 internal repeats, respectively. Interestingly, strain SS1169 showed only weak fibrinogen binding, although its FbsA protein carries 30 internal repeats. Similarly, strain O90R, possessing an FbsA protein with 10 internal repeats, bound larger amounts of fibrinogen than strain 706 S2, whose FbsA protein carries 17 repetitive units. However, the capacity of FbsA for fibrinogen binding was previously shown to correlate with its number of repeats (35). It can thus be speculated that the fibrinogen binding of a given strain is to only some extent controlled by the repeat numbers of its FbsA protein. Possibly the analyzed strains differ with respect to their fbsA expression, the transport of the FbsA protein across the cytoplasmic membrane, or the anchoring of FbsA to the cell wall. Alternatively, the capsules of the different strains may influence their fibrinogen-binding properties. In a report by Chhatwal et al. (8), the capsule of S. agalactiae was demonstrated to interfere with the bacterial binding to fibrinogen. Studies are therefore under way to investigate the expression of the fbsA gene in the various strains and the importance of the capsule for fibrinogen binding.
Plasmid-mediated expression of fbsA only partially restored the adherence and invasion capabilities of the complemented strain 6313
fbsA(pOrifbsA). However, this strain exhibits about 80% fibrinogen binding compared to the parental strain 6313 (30). Furthermore, enzyme-linked immunosorbent assay experiments with whole bacteria and MAb 5H2 revealed equal amounts of FbsA on the surfaces of S. agalactiae 6313 and 6313
fbsA(pOrifbsA) (data not shown). Our findings therefore indicate similar expression levels of the fbsA promoter (PfbsA) and of promoter P23 in plasmid pOri23 during growth in complex media. However, P23 expression is constitutive in gram-positive bacteria (31), while that of PfbsA is highly regulated (17, 34). The differences in bacterial adherence and invasion between 6313 and 6313
fbsA(pOrifbsA) may thus be explained by different fbsA expression levels in tissue culture experiments. Although it is highly speculative, one could hypothesize that tissue culture conditions might significantly upregulate PfbsA-driven fbsA expression in strain 6313. This would result in increased synthesis of FbsA protein, thereby allowing enhanced host cell adherence of S. agalactiae 6313 compared to strain 6313
fbsA(pOrifbsA).
The adherence of S. agalactiae to epithelial surfaces is a process that requires specific interactions between bacterial adhesins and host receptors. In various in vitro models, S. agalactiae was shown to adhere to different epithelial cells (7, 40, 41, 44, 48), but the molecular basis of this interaction is currently only poorly understood. The laminin-binding protein Lmb has been speculated to play a role in the colonization of epithelial surfaces (37), but this hypothesis has not been experimentally tested. The transcriptional regulator RogB and the oligopeptide permease Opp from S. agalactiae were recently shown to control both the expression of the fbsA gene and the bacterial adherence to epithelial cells (17, 34). These findings indicated a link between the fibrinogen receptor FbsA and the adherence of S. agalactiae to epithelial cells. In the present study, different experimental approaches unambiguously demonstrate that the FbsA protein alone is sufficient to promote the adherence of S. agalactiae to epithelial cells. Thus, FbsA represents the first adhesin identified in these bacteria. As the adherence of S. agalactiae to epithelial surfaces is the initial event in the colonization of host surfaces, FbsA may thus play an important role in the development of a vaccine against these bacteria.
Competition experiments and the analysis of fbsA deletion mutants indicated that FbsA might also play a role in the invasion of epithelial cells by S. agalactiae. However, adherence is frequently a prerequisite for the successful invasion of host cells (12). In line with this, the adherence of the fbsA deletion mutants was reduced by the same order of magnitude as was their host cell invasion. Similar results were obtained in the competition experiments with purified FbsA protein or MAb 5H2. Furthermore, FbsA-coated latex beads bound in high number to epithelial cells but were only rarely seen in the process of internalization by host cells. Finally, plasmid-mediated fbsA expression allowed L. lactis to adhere to but not to enter epithelial cells. Thus, our findings suggest that FbsA does not promote the invasion of S. agalactiae into epithelial cells. Interestingly, the fibrinogen-binding protein FbsB was recently shown to mediate the invasion of S. agalactiae into epithelial cells (18). Thus, fibrinogen-binding proteins obviously play a prominent role in both host cell adherence and invasion by S. agalactiae. The FbsB protein, however, is not the only invasin in S. agalactiae. The C5a peptidase (7), the hemolysin CylE (10), the alpha C protein (3, 5), and protein Spb1 (1), which is unique to serotype III-3, also have been shown to play a role in the entry of S. agalactiae into host cells. This indicates that after FbsA-mediated adherence, different proteins are involved in the entry of S. agalactiae into host cells.
Although the present study and previous studies convincingly demonstrate the binding of FbsA to human fibrinogen (35), the eukaryotic molecules that allow FbsA-mediated adherence to host cells remain to be determined. Externally added fibrinogen significantly inhibited the adherence of S. agalactiae to epithelial cells; however, it also caused a dose-dependent clumping of the bacteria (18). Thus, the inhibition of streptococcal adherence may be caused by the clumping of the bacteria. Host cell adherence was also unaffected by the addition of polyclonal antifibrinogen antibodies. However, these antibodies also did not block the binding of the bacteria to fibrinogen, suggesting that FbsA binds to a highly conserved region within human fibrinogen, which does not allow the production of antibodies. In an approach to define those sites in FbsA that are involved in host cell adherence, we made use of MAbs 5H2 and 2B1. Both antibodies bind to FbsA in its repeat region; however, MAb 5H2 blocks the binding of FbsA to fibrinogen, while MAb 2B1 does not interfere with this interaction (30). Interestingly, we found that MAb 5H2 competitively blocked the adherence of S. agalactiae to epithelial cells, while MAb 2B1 had no effect on the streptococcal adherence. This result indicates that fibrinogen-binding epitopes in the repeat region of FbsA are involved in the adherence of S. agalactiae to epithelial cells. As fibrinogen was already detected on the surface of A549 cells (16), fibrinogen might thus play a role in FbsA-mediated adherence of S. agalactiae. Alternatively, FbsA may bind to a different ligand on A549 cells. Interestingly, the fibrinogen-binding protein ClfB from Staphylococcus aureus was recently shown to interact with cytokeratin 10 on the surface of eukaryotic cells (29). Moreover, the fibrinogen-binding protein ClfA from S. aureus was found to interact with a platelet membrane protein that is distinct from fibrinogen (36). These findings demonstrate that bacterial fibrinogen-binding proteins may interact with distinct ligands on the host cell surface.
Several pathogenic bacteria possess fibrinogen-binding proteins that also interact with human fibronectin, and it is the fibronectin-binding activity which mediates the bacterial adherence and invasion of host cells (9, 25, 39). Moreover, commercially available fibrinogen preparations are frequently contaminated with fibronectin. Thus, one might argue that FbsA-mediated cell adherence is brought about by binding of FbsA to human fibronectin on the surface of A549 cells. However, FbsA was previously demonstrated not to interact with human fibronectin (35). In addition, neither preincubation of S. agalactiae 6313 with fibronectin nor pretreatment of A549 cells with antifibronectin antibodies had an effect of the bacterial adherence and invasion (data not shown). These results demonstrate that fibronectin is obviously not involved in FbsA-mediated adherence of S. agalactiae to host cells. Currently, studies to identify the nature of the ligand(s) to which FbsA binds during the course of host cell adherence by S. agalactiae are under way.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»