![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Department of Microbiology and Immunology,1 Division of Infectious Diseases, University of Maryland School of Medicine,3 Department of Veterans Affairs, Baltimore, Maryland,4 Department of Medical Microbiology and Immunology, University of Wisconsin—Madison, Madison, Wisconsin2
Received 11 June 2004/ Returned for modification 14 July 2004/ Accepted 29 July 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mutations have been introduced into a number of candidate virulence genes in UPEC, leading to attenuated mutants in experimental UTI. These include fim, encoding type 1 fimbria (7, 13), sat, encoding secreted autotransporter toxin (14), cnf-1, encoding cytotoxic necrotizing factor (36), tonB, involved in iron transport (40), proP, involved in osmoprotectant transport (8), and degS (35). Large-scale screens for virulence factors of UPEC have also identified factors that aid UPEC during growth in urine (38) and have implicated capsule, lipopolysaccharide, iron acquisition systems, and the PhoU regulatory system in virulence (3, 35). Molecular Koch's postulates have been satisfied for type 1 fimbriae, DegS, and TonB (9).
In this report, we have quantified the gene expression for each open reading frame (ORF) of this uropathogen from organisms isolated directly from the urine of experimentally infected CBA/J mice. We have identified multiple virulence and metabolic factors that were upregulated to aid survival in the host. We also defined specific environmental conditions that appear to confront E. coli CFT073 during experimental UTI.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CBA/J mouse model of ascending UTI. To establish a relevant source of in vivo-grown bacteria, 40 CBA/J mice were transurethrally inoculated as previously described (15, 21) with 5 x 109 CFU of E. coli CFT073. The infection was monitored daily by pooling urine from 10 mice at random and spiral plating on Luria agar to quantify CFU. Mice were reinoculated after 6 days to maintain infection at levels between 2 x 106 and 3 x 107 CFU/ml of urine, which allowed the collection of sufficient numbers of bacteria needed for RNA extraction and subsequent analysis. Urine was collected for 10 days, with the exception of the first 24 h following the inoculations. On average, 50 µl of urine was collected from each mouse every 45 min during an 8-h period. Urine was collected directly into 1.5-ml microcentrifuge tubes containing 650 µl of RNA Protect Bacterial Reagent (QIAGEN) and was pooled until the total volume reached approximately 1 ml. The RNA Protect-treated sample remained on ice until all samples had been collected for that day. A crystalline precipitate was allowed to settle before pipetting off the bacteria-containing supernatant into a 15-ml centrifuge tube for collection. Tubes were centrifuged (15 min, 2,500 x g, 4°C), the supernatant was decanted, and the bacterial pellet was frozen at –20°C until RNA extraction.
RNA isolation and cDNA synthesis. RNA from both in vitro and in vivo samples was extracted using an RNeasy Mini kit with a 1-h on-column DNase digestion (QIAGEN) according to the RNeasy Mini handbook. Multiple RNA preparations of the same sample were pooled prior to cDNA synthesis. Up to 10 µg of RNA was mixed with 750 ng of random hexamers (Invitrogen) for each cDNA synthesis reaction according to a previously described protocol (37). SuperScript II reverse transcriptase (1,500 U; Invitrogen) was added to these reactions, along with First Strand buffer, dithiothreitol, and deoxyribonucleotides at concentrations recommended by the manufacturer (Invitrogen). The reactions were incubated at 25°C for 10 min, 37°C for 60 min, 42°C for 60 min, and 70°C for 10 min. Following RNaseH (Invitrogen) and RNaseA (Ambion) digestion, cDNA was purified with a QIAquick PCR Purification kit (QIAGEN) according to the QIAquick Spin handbook.
Quantitative real-time reverse transcription-PCR (qRT-PCR).
Primers designed to amplify papA_2 of E. coli CFT073 were 5'GTGCCTGCAGAAAATGCAGAT and 5'CCCGTTTTCCACTCGAATCA, and primers for gapA were 5'CATCGTTTCCAACGCATCCT and 5'ACCTTCGATGATGCCGAAGTT (forward and reverse primers, respectively). Thirty nanograms of cDNA and 300 nM (final concentration) each primer were mixed with 12.5 µl of 2x SYBR Green PCR Master Mix (ABI). Assays were performed in triplicate with the ABI Prism model 7900 instrument. All data were normalized to the internal standard gapA (encoding glyceraldehyde 3-phosphate dehydrogenase), and melting curve analysis demonstrated that the accumulation of SYBR Green-bound DNA was gene specific. The 2–
CT method (25) was used for analysis, and the data were transformed by log2 to obtain a fold change difference between growth conditions.
Microarrays and hybridization. The E. coli CFT073-specific DNA microarray (NimbleGen Systems, Inc.) includes 5,611 ORFs and stable RNAs from version 17 of the compiled CFT073 genome sequence. Each ORF is represented on the glass slide by 17 unique probe pairs of 24-mer in situ-synthesized oligonucleotides. Each pair consists of a sequence perfectly matched to the ORF, and another adjacent sequence harbors two mismatched bases for determination of background and cross-hybridization. For each microarray, 3 to 5 µg of cDNA was fragmented using RQ1 DNaseI (Promega) partial digest and was then labeled with biotin-N6-ddATP (Perkin-Elmer Life Sciences) using terminal transferase (Roche) as described previously (37). Labeled cDNA samples were individually hybridized in triplicate to the CFT073-specific microarray according to the NimbleGen standard operating procedure. Following washes and labeling with a streptavidin-Cy3 complex according to the NimbleGen procedure, microarrays were scanned at 5-µm resolution using a GenePix 4000b scanner.
Data and statistical analysis.
For LB and in vivo microarrays, data were extracted using NimbleScan (NimbleGen) and an algorithm (courtesy of Yu Qiu, University of Wisconsin School of Medicine) applied to obtain a single measurement of signal intensity for each ORF. Data were normalized and converted to estimates of transcript abundance, using the total signal intensity to allow comparison of individual microarrays (1). A second set of LB-grown microarrays were processed along with the urine-grown microarray, where hybridization and normalization of the microarray were carried out by NimbleGen Systems, Inc. The signal intensity of an ORF was calculated by subtracting the mismatch probe intensity from the perfect match probe intensity for each of the 17 probe pairs, obtaining a mean difference value (excluding values greater than 3.0 standard deviations from the means). These urine- and LB-grown microarrays were normalized with the quantile normalization method and were analyzed with the RMA algorithm (6, 20). For all microarrays, a P value for each ORF was calculated by a two-tailed Welch's unpaired t test comparison of the three microarray replicates for each bacterial growth condition. Fold changes of an ORF between growth conditions were calculated by transformation of the following ratio: log2 [(average in vivo-grown or urine-grown signal intensity)/(average LB-grown signal intensity)]. Only fold changes of at least ±2 and P 
0.05 were considered significant and are discussed in this report. Thus, ORFs characterized as upregulated (fold change, 
2; P 0.05) or downregulated (fold change, –2; P 0.05) during growth in vivo or during growth in urine are relative to growth in LB.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Overall, 313 genes were found upregulated (Table 1 lists the 50 most upregulated), and 207 genes were downregulated during growth in vivo. To identify candidate virulence genes specific to E. coli CFT073 that may play a role during UTI, all 313 genes upregulated in vivo were evaluated for the absence or presence of a homologue in the E. coli K-12 nonpathogenic strain (Table 1). This analysis revealed 45 genes that were not found in E. coli K-12 and 41 genes encoding hypothetical proteins that were unable to be confidently categorized. Of these 45 candidate virulence genes, 25 genes previously implicated in virulence encoded iron acquisition, capsule synthesis, or microcin secretion proteins and 13 encoded hypothetical proteins.
|
|
|
Not only were type 1 fimbriae highly expressed, but they were also highly upregulated (three- to fivefold) (Fig. 2) compared to levels for the LB culture grown statically, conditions known to enhance type 1 fimbrial production (33). Both of the pap gene clusters of strain CFT073 encoding P fimbriae were downregulated two- to fourfold, and the foc/sfa gene cluster and sfaB recombinase of F1C fimbriae were also downregulated two- to fivefold. The csg genes, which encode thin aggregative curli fibers, were downregulated two- to fourfold in vivo. The flu gene, encoding antigen 43 and implicated in autoaggregation and biofilm formation, was also downregulated twofold in vivo (Fig. 2). Besides type 1 fimbriae, only one other adhesion-related gene (ydeS, encoding a hypothetical fimbria-like structural protein) was upregulated during UTI.
|
|
|
Antibiotic resistance. Genes that confer antibiotic resistance were found upregulated during bacterial growth in vivo. These include marAB (two- to three fold), encoding multiple antibiotic resistance proteins, yhjX (fivefold), encoding a putative drug resistance protein, and emrA (twofold), encoding a multidrug resistance secretion protein. Microcins are secreted antibiotic peptides that may be used to compete with surrounding bacteria. mchCDEF, encoding microcin H47, was upregulated two- to fourfold in the urinary tract.
E. coli CFT073 transcriptome as a probe for nutrient levels and conditions within the urinary tract. E. coli senses its environment and modulates gene expression to best utilize available resources. By examining the transcriptome of E. coli CFT073 isolated from the urine of infected mice, we established that these bacteria can act as sensitive bioprobes to reveal the composition of this environment.
Oxygen level. E. coli, a facultative anaerobe, can adapt to growth in various redox environments. Based on the pattern of gene expression of E. coli CFT073, the mouse urinary tract is more oxygen rich than the LB static culture. Many genes indicative of anaerobiosis were downregulated under in vivo conditions. Most interestingly, frdABCD (encoding fumarate reductase), glpABC (encoding sn-glycerol-3-phosphate dehydrogenase), and aspA (encoding aspartase), all Fnr-regulated genes downregulated during growth in the urinary tract, were all found to be upregulated in Vibrio cholerae during in vivo growth in the intestinal rabbit ileal loop model (45). tdcABC (encoding genes for anaerobic threonine usage), tdcE (encoding formate acetyltransferase), and Fnr-regulated genes ansB (encoding L-asparaginase II) and hypC (affects hydrogenase activity) were also downregulated during growth in the urinary tract. Accordingly, cyoAB and cyoE, cytochrome o genes indicative of aerobic growth, were upregulated twofold in vivo. On the other hand, the fdnGHI operon encoding anaerobic formate dehydrogenase-N was upregulated under in vivo conditions, thus implying oxygen limitation. arcA and fnr, the key regulators of respiration and indicators of oxygenation, remained unchanged between in vivo and LB growth. Thus, bacteria were growing neither strictly anaerobically nor strictly aerobically. The urinary tract is likely a combination of these conditions, as bacteria isolated from urine may have been growing in different niches of the urinary tract with different levels of oxygenation.
Nitrogen limitation.
Although nitrogen is abundant in urine (e.g., urea is present at 
0.5 M [11]), it is a limiting resource in the urinary tract for E. coli, which typically lacks the urease enzyme required to catalyze the hydrolysis of urea to ammonia and CO2. Nitrogen limitation induces nitrogen-regulated (Ntr) genes, such as glnA, which encodes glutamine synthetase. While growing in the urinary tract, glnA was upregulated fourfold. To provide an exogenous nitrogen source, glutamine importers glnP and glnQ were also upregulated threefold. gadA and gadB (encoding glutamate decarboxylases), for the conversion of L-glutamate to 
-aminobutyrate, and ybaS (encoding a probable glutaminase), for the degradation of glutamine, were downregulated 7- to 10-fold, perhaps as a coordinated response to maximize the amount of ammonia assimilated. These data indicate that E. coli CFT073 faces nitrogen limitation in the urinary tract.
Iron limitation. E. coli CFT073 faces iron limitation in the urinary tract as indicated by the uniform upregulation of iron acquisition systems as described above.
High osmolarity and osmotic stress. The cytosolic concentration of osmoprotectants is elevated under high osmolarity, as measured here with the upregulation of pro gene expression of E. coli CFT073 in the urinary tract. proP and proVWX, encoding systems for the transport of osmoprotectants proline and glycine betaine, were upregulated two- to fivefold in vivo.
Carbon utilization and starvation response. E. coli CFT073 utilized different sources of carbon depending on whether growth was in vivo or in LB. While in the urinary tract, metabolism shifted so that hexuronates and hexanates could be exploited to support growth. uxuA and uxuB, encoding mannonate dehydratase and oxidoreductase, and uxaA and uxaB, encoding altronate hydrolase and oxidoreductase, respectively, were upregulated two- to fivefold. Genes encoding glucitol and fructose uptake and catabolism were upregulated three- to fivefold. The genes encoding the uptake and catabolism of glycerol, sn-glycerol-3-phosphate, and trehalose were downregulated three- to sevenfold in vivo. Carbon sources that were used equally during in vivo and LB growth conditions include glucose, mannose, and mannitol. Genes encoding carbon starvation proteins were not consistently up- or downregulated. Thus, E. coli CFT073 was not limited for carbon sources during acute infection of the urinary tract.
Conditions unchanged between in vivo and LB growth. Groups of genes that were not differentially expressed between in vivo and LB growth conditions provide insight into the similarity between these environments. There was no measurable change in genes that normally respond to pH, oxidative stress, DNA damage, heat or cold shock, cell density dependence, sulfur availability, or phosphate availability (data not shown).
Verification of microarray. qRT-PCR was used to independently verify the levels of transcript for an example gene, papA_2, which was found downregulated during growth in vivo 3.5-fold by microarray analysis. gapA, encoding glyceraldehyde 3-phosphate dehydrogenase, was used as the normalizing internal standard. Microarray analysis demonstrated that gapA expression remained unchanged between in vivo and in vitro growth, thus confirming the validity of this standard. qRT-PCR analysis demonstrated a greater transcript level sensitivity than microarray analysis, as papA_2 was downregulated 6.24-fold ± 0.15-fold during growth in vivo relative to growth in LB.
To verify the biological reproducibility of our in vivo microarray analysis, the results presented here were compared to those of an analogous microarray of an E. coli CFT073 dsdA (D-serine deaminase) mutant isolated from the urine of infected CBA/J mice. The upregulation of specific genes encoding type 1 fimbriae, several iron acquisition systems, capsular polysaccharide, and microcin during the in vivo growth of E. coli CFT073 dsdA demonstrated the biological reproducibility of our major findings (our unpublished data). Pearson's correlation coefficient (r2) between wild-type E. coli CFT073 grown in vivo and CFT073 dsdA grown in vivo was 0.7583. By comparison, the correlation coefficient between wild-type E. coli CFT073 grown in vivo and grown in vitro in LB was 0.4059, suggesting that the wild type and dsdA mutant have similar overall gene expression patterns when grown in vivo.
Alterations in the transcriptome of E. coli CFT073 during growth in human urine. E. coli CFT073 grown to mid-exponential phase in filtered human urine partially mimics growth in the urinary tract. The transcriptome of E. coli CFT073 grown in vitro in human urine, relative to growth in LB, demonstrated the upregulation of genes encoding two iron acquisition systems (iuc and iro gene clusters), capsular sialic acid catabolism genes (nanA and nanT), and a microcin secretion gene (mchB). Overall, 54 genes were found upregulated (Table 4 lists the 50 most upregulated) and 88 genes were found downregulated during growth in human urine. Many of the most highly expressed genes in vivo are also among the most highly expressed in human urine, including ompA, ompC, and many ribosomal protein genes (Table 2). However, in sharp contrast to growth in vivo, papA_2 (encoding the major P fimbriae subunit), focA (encoding the major F1C fimbriae subunit), and fliC (encoding flagellin) were highly expressed in human urine (data not shown).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The transcriptional analysis of E. coli CFT073 during colonization of the murine urinary tract was feasible because the urinary tract is naturally sterile and because the amount of host nucleic acid contamination from exfoliated epithelial cells (12, 30) was insignificant. This allowed us to collect the urine from experimentally infected mice and directly extract CFT073-specific RNA. We experienced limited complications in isolating ample RNA, provided a sufficient volume of urine was collected from infected animals. Previous studies demonstrated that individual CBA/J mice are consistently and relatively uniformly infected with E. coli CFT073 (13). Additionally, urine from 20 mice individually cultured at the conclusion of these microarray experiments demonstrated that all mice remained infected (data not shown). Urine was sampled and pooled over a range of time (1 to 10 days) from a large collection of infected mice (n = 40). Bacteria expelled in the urine likely represent an appropriate sample of the bacteria that had recently infected the kidneys, ureters, bladder, and urethra. Therefore, we assume that the RNA used for this in vivo microarray analysis provides a representation of the responses of a uropathogen to a summation of these environmental situations encountered in the urinary tract.
Urine was not collected within the first 24 h of the experimental UTI. We desired to exclude noncolonizing bacteria that were present in the inoculum that may have washed out following transurethral challenge. Instead we focused on a bacterial population that had colonized and adapted to the murine urinary tract. Admittedly, this analysis likely excluded the transient transcription of genes encoding colonization factors and other virulence determinants required for the transition from the in vitro LB culture to growth in the urinary tract. Additionally, any gene transiently expressed during the ongoing urine collection would be diluted out in the process of pooling urine samples. Thus, our analysis emphasizes genes that are efficiently expressed throughout space and time during UTI.
Microarray data presented here are internally consistent and compatible with previous studies. There is coordinated regulation of genes within an operon, and transcript levels reflect the expected abundance. For example, the entire fimAICDFGH gene cluster of type 1 fimbriae is upregulated in vivo compared to that in LB growth (Fig. 2), and as expected there is significantly more fimA (major structural subunit gene) transcript than fimI, more fimI than fimC, more fimC than fimD, and more fimD than fimF. This is consistent with the prediction of a transcript-stabilizing stem-loop structure at the end of fimA (34) as well as in vitro expression studies of other chaperone-usher fimbrial gene clusters (2). Genes within iron acquisition operons are also uniformly upregulated (Fig. 3), consistent with a previous study of E. coli CFT073 that observed the induction of three siderophore systems during murine peritonitis (35).
We affirm the importance of several known virulence genes by reporting the upregulation of these genes in vivo, such as those encoding type 1 fimbriae, siderophores, capsule, drug resistance, and microcin. We have also identified 13 new candidate virulence genes, encoding hypothetical proteins, which were upregulated during in vivo growth and were simultaneously not found in the nonpathogenic E. coli K-12 strain. Additionally, these analyses provide valuable information on the expression of surface proteins in vivo for the purpose of vaccine-directed research.
Several other microarray analyses found that genes encoding ribosomal proteins were highly expressed when cells were exponentially growing in rich media (5, 41, 45). This suggests that the high level of in vivo expression of genes involved in translation indicates a rapid rate of exponential growth of pyelonephritogenic E. coli CFT073 in the urinary tract. This is somewhat surprising, given that urine is an incomplete and relatively poor growth medium in vitro (19, 38). Although bacteria may acquire some nutrients via contact with the urinary tract epithelium, our experiments indicate that nitrogen and iron remain limiting. In addition, bacteria are expending additional energy responding to osmotic stress and producing virulence and metabolic factors specific for survival in the host. Despite these specific nutrient deprivations and energy expenditures, rapid growth is sustained in the urinary tract. This is in contrast to observations of V. cholerae during growth in the intestine, where fewer genes for protein synthesis tended to be found among the 300 most highly expressed genes compared to that of growth in LB (45).
Microarray analysis demonstrates a strikingly high level of type 1 fimbrial expression during growth in vivo, as fimA expression was the fourth highest gene expressed overall. In addition, type 1 fimbrial genes are highly upregulated compared to that of growth in LB. These data support the findings of studies using signature-tagged mutagenesis and phase-locked mutants (3, 13). Type 1 fimbrial expression in vivo contrasts sharply with the near lack of expression of the 11 other fimbrial types previously demonstrated (4, 21) or predicted by the E. coli CFT073 genome (42). Coordinate regulation among fimbrial operons has been described previously and may provide an explanation for this observation (17, 44). P fimbriae, argued as being virulence factors during UTI (43), are found downregulated here in vivo despite the presence of P-fimbrial Gal-Gal receptors in mice (22, 32). Our microarray experiments suggest that a better way to study the importance of other adherence factors may be use of a Fim-deficient UPEC mutant.
The signals necessary for transcriptional alterations in UPEC during transition from growth in the intestine to growth in the urinary tract remain undisclosed. However, this microarray analysis of bacteria responding to the urinary tract can be compared to the two other true in vivo microarray analyses, where V. cholerae was isolated from rice-water stools of infected patients (5, 27). By using bacteria as bioprobes for their respective environments, differences in these niches are revealed by patterns of bacterial gene expression. For example, the urinary tract is nitrogen and iron limiting for E. coli, of moderate oxygenation, and of higher osmolarity and pH than the anaerobic, nitrogen-rich gastrointestinal tract.
Differences in gene expression between growth in vivo and growth in vitro in human urine may be partially due to species-specific differences in urine composition. This use of human urine as a growth medium thus examines the important relationship between in vivo murine studies and human infection. This work also suggests that in vitro growth of UPEC in human urine, rather than in LB, is a useful tool to more closely imitate growth conditions encountered during UTI. The upregulation of important virulence factors, including iron acquisition systems, capsule, and microcin, was observed. However, the most highly expressed virulence factor during UTI, type 1 fimbriae, was not induced in urine. The examination of gene expression in vivo by using the experimental murine model of ascending UTI thus remains essential.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health (NIH) grants AI43363 (H.L.T.M.), DK49720 (H.L.T.M. and M.S.D), and DK63250 (R.A.W.) and by NIH National Research Service award A0T32GM072125 (B.J.H.). Custom NimbleGen microarrays were supported by NIH SBIR grant R44-HG-02193 to NimbleGen Systems with a subcontract to the Application Development Center at the University of Wisconsin—Madison.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
| 1. | Allen, T. E., and B. O. Palsson. 2003. Sequence-based analysis of metabolic demands for protein synthesis in prokaryotes. J. Theor. Biol. 220:1-18.[CrossRef][Medline] |
| 2. | Baga, M., M. Goransson, S. Normark, and B. E. Uhlin. 1985. Transcriptional activation of a pap pilus virulence operon from uropathogenic Escherichia coli. EMBO J. 4:3887-3893.[Medline] |
| 3. | Bahrani-Mougeot, F. K., E. L. Buckles, C. V. Lockatell, J. R. Hebel, D. E. Johnson, C. M. Tang, and M. S. Donnenberg. 2002. Type 1 fimbriae and extracellular polysaccharides are preeminent uropathogenic Escherichia coli virulence determinants in the murine urinary tract. Mol. Microbiol. 45:1079-1093.[CrossRef][Medline] |
| 4. | Bahrani-Mougeot, F. K., S. Pancholi, M. Daoust, and M. S. Donnenberg. 2001. Identification of putative urovirulence genes by subtractive cloning. J. Infect. Dis. 183(Suppl. 1):S21-S23. |
| 5. | Bina, J., J. Zhu, M. Dziejman, S. Faruque, S. Calderwood, and J. Mekalanos. 2003. ToxR regulon of Vibrio cholerae and its expression in vibrios shed by cholera patients. Proc. Natl. Acad. Sci. USA 100:2801-2806. |
| 6. | Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19:185-193. |
| 7. | Connell, I., W. Agace, P. Klemm, M. Schembri, S. Marild, and C. Svanborg. 1996. Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract. Proc. Natl. Acad. Sci. USA 93:9827-9832. |
| 8. | Culham, D. E., C. Dalgado, C. L. Gyles, D. Mamelak, S. MacLellan, and J. M. Wood. 1998. Osmoregulatory transporter ProP influences colonization of the urinary tract by Escherichia coli. Microbiology 144:91-102.[Abstract] |
| 9. | Falkow, S. 1988. Molecular Koch's postulates applied to microbial pathogenicity. Rev. Infect. Dis. 10(Suppl. 2):S274—S276. |
| 10. | Green, C. P., and V. L. Thomas. 1981. Hemagglutination of human type O erythrocytes, hemolysin production, and serogrouping of Escherichia coli isolates from patients with acute pyelonephritis, cystitis, and asymptomatic bacteriuria. Infect. Immun. 31:309-315. |
| 11. | Griffith, D. P., D. M. Musher, and C. Itin. 1976. Urease. The primary cause of infection-induced urinary stones. Investig. Urol. 13:346-350.[Medline] |
| 12. | Gunther, N. W. I., V. Lockatell, D. E. Johnson, and H. L. Mobley. 2001. In vivo dynamics of type 1 fimbria regulation in uropathogenic Escherichia coli during experimental urinary tract infection. Infect. Immun. 69:2838-2846. |
| 13. | Gunther, N. W. I., J. A. Snyder, V. Lockatell, I. Blomfield, D. E. Johnson, and H. L. Mobley. 2002. Assessment of virulence of uropathogenic Escherichia coli type 1 fimbrial mutants in which the invertible element is phase-locked on or off. Infect. Immun. 70:3344-3354. |
| 14. | Guyer, D. M., S. Radulovic, F. E. Jones, and H. L. Mobley. 2002. Sat, the secreted autotransporter toxin of uropathogenic Escherichia coli, is a vacuolating cytotoxin for bladder and kidney epithelial cells. Infect. Immun. 70:4539-4546. |
| 15. | Hagberg, L., I. Engberg, R. Freter, J. Lam, S. Olling, and C. Svanborg Eden. 1983. Ascending, unobstructed urinary tract infection in mice caused by pyelonephritogenic Escherichia coli of human origin. Infect. Immun. 40:273-283. |
| 16. | Herrmann, B., and L. G. Burman. 1985. Pathogenesis of Escherichia coli cystitis and pyelonephritis: apparent lack of significance of bacterial motility and chemotaxis towards human urine. Infection 13:4-7.[CrossRef][Medline] |
| 17. | Holden, N. J., B. E. Uhlin, and D. L. Gally. 2001. PapB paralogues and their effect on the phase variation of type 1 fimbriae in Escherichia coli. Mol. Microbiol. 42:319-330.[CrossRef][Medline] |
| 18. | Horwitz, M. A., and S. C. Silverstein. 1980. Influence of the Escherichia coli capsule on complement fixation and on phagocytosis and killing by human phagocytes. J. Clin. Investig. 65:82-94. |
| 19. | Hull, R. A., and S. I. Hull. 1997. Nutritional requirements for growth of uropathogenic Escherichia coli in human urine. Infect. Immun. 65:1960-1961.[Abstract] |
| 20. | Irizarry, R. A., B. Hobbs, F. Collin, Y. D. Beazer-Barclay, K. J. Antonellis, U. Scherf, and T. P. Speed. 2003. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4:249-264.[Abstract] |
| 21. | Johnson, D. E., C. V. Lockatell, R. G. Russell, J. R. Hebel, M. D. Island, A. Stapleton, W. E. Stamm, and J. W. Warren. 1998. Comparison of Escherichia coli strains recovered from human cystitis and pyelonephritis infections in transurethrally challenged mice. Infect. Immun. 66:3059-3065. |
| 22. | Johnson, J. R., T. Berggren, D. S. Newburg, R. H. McCluer, and J. C. Manivel. 1992. Detailed histopathological examination contributes to the assessment of Escherichia coli urovirulence. J. Urol. 147:1160-1166.[Medline] |
| 23. | Johnson, J. R., and A. L. Stell. 2000. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J. Infect. Dis. 181:261-272.[CrossRef][Medline] |
| 24. | Johnson, J. R., A. L. Stell, P. Delavari, A. C. Murray, M. Kuskowski, and W. Gaastra. 2001. Phylogenetic and pathotypic similarities between Escherichia coli isolates from urinary tract infections in dogs and extraintestinal infections in humans. J. Infect. Dis. 183:897-906.[CrossRef][Medline] |
| 25. | Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402-408.[CrossRef][Medline] |
| 26. | Manges, A. R., J. R. Johnson, B. Foxman, T. T. O'Bryan, K. E. Fullerton, and L. W. Riley. 2001. Widespread distribution of urinary tract infections caused by a multidrug-resistant Escherichia coli clonal group. N. Engl. J. Med. 345:1007-1013. |
| 27. | Merrell, D. S., S. M. Butler, F. Qadri, N. A. Dolganov, A. Alam, M. B. Cohen, S. B. Calderwood, G. K. Schoolnik, and A. Camilli. 2002. Host-induced epidemic spread of the cholera bacterium. Nature 417:642-645.[CrossRef][Medline] |
| 28. | Mobley, H. L., D. M. Green, A. L. Trifillis, D. E. Johnson, G. R. Chippendale, C. V. Lockatell, B. D. Jones, and J. W. Warren. 1990. Pyelonephritogenic Escherichia coli and killing of cultured human renal proximal tubular epithelial cells: role of hemolysin in some strains. Infect. Immun. 58:1281-1289. |
| 29. | Mobley, H. L., M. D. Island, and G. Massad. 1994. Virulence determinants of uropathogenic Escherichia coli and Proteus mirabilis. Kidney Int. Suppl. 47:S129-S136.[Medline] |
| 30. | Mulvey, M. A., Y. S. Lopez-Boado, C. L. Wilson, R. Roth, W. C. Parks, J. Heuser, and S. J. Hultgren. 1998. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 282:1494-1497. |
| 31. | Neidhardt, F. C., and R. Curtiss. 1996. Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 32. | O'Hanley, P., D. Lark, S. Falkow, and G. Schoolnik. 1985. Molecular basis of Escherichia coli colonization of the upper urinary tract in BALB/c mice. Gal-Gal pili immunization prevents Escherichia coli pyelonephritis in the BALB/c mouse model of human pyelonephritis. J. Clin. Investig. 75:347-360. |
| 33. | Old, D. C., and J. P. Duguid. 1970. Selective outgrowth of fimbriate bacteria in static liquid medium. J. Bacteriol. 103:447-456. |
| 34. | Olsen, P. B., and P. Klemm. 1994. Localization of promoters in the fim gene cluster and the effect of H-NS on the transcription of fimB and fimE. FEMS Microbiol. Lett. 116:95-100.[CrossRef][Medline] |
| 35. | Redford, P., P. L. Roesch, and R. A. Welch. 2003. DegS is necessary for virulence and is among extraintestinal Escherichia coli genes induced in murine peritonitis. Infect. Immun. 71:3088-3096. |
| 36. | Rippere-Lampe, K. E., A. D. O'Brien, R. Conran, and H. A. Lockman. 2001. Mutation of the gene encoding cytotoxic necrotizing factor type 1 (cnf1) attenuates the virulence of uropathogenic Escherichia coli. Infect. Immun. 69:3954-3964. |
| 37. | Rosenow, C., R. M. Saxena, M. Durst, and T. R. Gingeras. 2001. Prokaryotic RNA preparation methods useful for high density array analysis: comparison of two approaches. Nucleic Acids Res. 29:E112. |
| 38. | Russo, T. A., S. T. Jodush, J. J. Brown, and J. R. Johnson. 1996. Identification of two previously unrecognized genes (guaA and argC) important for uropathogenesis. Mol. Microbiol. 22:217-229.[CrossRef][Medline] |
| 39. | Schappert, S. M. 1999. Ambulatory care visits to physician offices, hospital outpatient departments, and emergency departments: United States Series 13, no. 143. National Center for Health Statistics, Centers for Disease Control and Prevention, Atlanta, Ga. |
| 40. | Torres, A. G., P. Redford, R. A. Welch, and S. M. Payne. 2001. TonB-dependent systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB are required for virulence in the mouse. Infect. Immun. 69:6179-6185. |
| 41. | Wei, Y., J. M. Lee, C. Richmond, F. R. Blattner, J. A. Rafalski, and R. A. LaRossa. 2001. High-density microarray-mediated gene expression profiling of Escherichia coli. J. Bacteriol. 183:545-556. |
| 42. | Welch, R. A., V. Burland, G. Plunkett III, P. Redford, P. Roesch, D. Rasko, E. L. Buckles, S. R. Liou, A. Boutin, J. Hackett, D. Stroud, G. F. Mayhew, D. J. Rose, S. Zhou, D. C. Schwartz, N. T. Perna, H. L. Mobley, M. S. Donnenberg, and F. R. Blattner. 2002. Extensive mosaic structure revealed by the complete genome sequence of uropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 99:17020-17024. |
| 43. | Wullt, B., G. Bergsten, M. Samuelsson, N. Gebretsadik, R. Hull, and C. Svanborg. 2001. The role of P fimbriae for colonization and host response induction in the human urinary tract. J. Infect. Dis. 183(Suppl. 1):S43—S46. |
| 44. | Xia, Y., D. Gally, K. Forsman-Semb, and B. E. Uhlin. 2000. Regulatory cross-talk between adhesin operons in Escherichia coli: inhibition of type 1 fimbriae expression by the PapB protein. EMBO J. 19:1450-1457.[CrossRef][Medline] |
| 45. | Xu, Q., M. Dziejman, and J. J. Mekalanos. 2003. Determination of the transcriptome of Vibrio cholerae during intraintestinal growth and midexponential phase in vitro. Proc. Natl. Acad. Sci. USA 100:1286-1291. |
| 46. | Zielske, J. V., K. N. Lohr, R. H. Brook, and G. A. Goldberg. 1981. Conceptualization and measurement of physiologic health for adults. Urinary tract infection, vol. 16. R-2262/16-HHS. The Rand Corporation, Washington, D.C. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||
