IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sebbane, F.
Right arrow Articles by Hinnebusch, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sebbane, F.
Right arrow Articles by Hinnebusch, B. J.

 Previous Article  |  Next Article 

Infection and Immunity, December 2004, p. 7334-7337, Vol. 72, No. 12
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.12.7334-7337.2004

Evaluation of the Role of Constitutive Isocitrate Lyase Activity in Yersinia pestis Infection of the Flea Vector and Mammalian Host

Florent Sebbane, Clayton O. Jarrett, Jan R. Linkenhoker, and B. Joseph Hinnebusch*

Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton, Montana

Received 3 May 2004/ Returned for modification 3 June 2004/ Accepted 13 August 2004


    ABSTRACT
 Top
 Abstract
 Text
 References
 
Yersinia pestis, unlike the closely related Yersinia pseudotuberculosis, constitutively produces isocitrate lyase (ICL). Here we show that the Y. pestis aceA homologue encodes ICL and is required for growth on acetate but not for flea infection or virulence in mice. Thus, deregulation of the glyoxylate pathway does not underlie the recent adaptation of Y. pestis to arthropod-borne transmission.


    TEXT
 Top
 Abstract
 Text
 References
 
The glyoxylate pathway is an anapleurotic cycle that bypasses the two CO2-generating steps of the tricarboxylic acid (TCA) cycle to preserve carbon and so enables bacteria to use acetate or fatty acids as a sole energy and carbon source (4, 16). The glyoxylate cycle includes five TCA cycle enzymes and two specific enzymes: isocitrate lyase (ICL) and malate synthase (MDH) (16). In Escherichia coli, the glyoxylate bypass enzymes are encoded by the aceBAK operon which contains the genes for MDH (aceB), ICL (aceA), and the isocitrate dehydrogenase (ICD) kinase/phosphatase (aceK) (3, 15). The aceBAK operon is negatively regulated by the IclR repressor when carbon sources other than acetate and fatty acids are present and is derepressed by integration host factor when only acetate or fatty acid is available (32). Expression of the glyoxylate pathway is also controlled by the FruR and FadR transcriptional regulators and the small RNA-binding protein CsrA, and it is posttranscriptionally controlled by the phosphorylation of ICD (8, 17, 18, 21, 27, 35).

Yersinia pestis, the agent of plague, is unusual among Enterobacteriaceae because it constitutively produces the glyoxylate bypass enzymes (9, 10). Genome sequencing of Y. pestis revealed the presence of the potential aceBAK and iclR homologues, which are separated by 119 bp and are transcribed in the opposite direction (5, 25). The Y. pestis aceA gene is predicted to encode a protein of 345 amino acids with 54.4 to 84.4% identity and 68.3 to 89.4% similarity to ICL proteins of gram-positive and gram-negative bacteria (F. Sebbane, unpublished data). All the amino acids defined as essential for ICL activity in other bacteria (H184, H197, H356, K194, C195, S319, and S321) were conserved in Y. pestis (4). The Y. pestis gene iclR appeared to be a pseudogene due to a frame shift (5, 25). In contrast, the iclR homologue of the closely related Yersinia pseudotuberculosis (which, like other Enterobacteriaceae, has inducible ICL activity) is intact (1a, 10), suggesting that iclR mutation and constitutive expression of ICL provide a selective advantage important for the Y. pestis life cycle. Mutation of iclR appeared to be the only reason why Y. pestis constitutively produces ICL, because the upstream promoter region of the Y. pestis aceBAK homologue operon is identical to that of Y. pseudotuberculosis and contains predicted binding sites for IclR, FruR, and integration host factor.

Characterization of Y. pestis aceA mutants. To determine whether the Y. pestis aceA homologue encoded ICL, a Y. pestis aceA mutant was constructed by in-frame deletion. The Y. pestis aceA gene and upstream and downstream flanking regions were PCR amplified by using primer set A1 (5'GAACCTTGTTCTGGCGAG3')-A2 (5'CACTGAGATCCCCTTTAGG3') and cloned into pCRII to create pCJ1 (Table 1). Inverse PCR of pCJ1 was performed using primer set A3 (5'CTCGGCCTTATAGCGCCGAAGATGTCATCAAGCTGCGTG3')-A4 (5'CCGCCAGCGTAATAAACTGGTATTTGTAGCCCATGGCGGAGA3') to delete a 909-bp internal fragment of aceA, and the PCR product was ligated to generate pCJ2. A 1.5-kb XbaI-SacI fragment of pCJ2 containing the mutated aceA was subcloned into the suicide plasmid pCVD442 (6) to yield pCJ3, which was introduced by electroporation into E. coli S17-1{lambda}pir. The aceA deletion was introduced into the Y. pestis strains KIM6+ and 195/P by allelic exchange (6); the resulting mutants were named Y. pestis MacK and MacP, respectively. The 909-bp deletion in the two strains was verified by PCR analysis using primer sets that hybridized to sequences external (A1-A2) or internal (A5 [5'TTTGAAGACCAATTGGCCGC3']-A6 [5'CGGTCAGATTCTTCTTCCAG3']) to the deleted region (Table 1, Fig. 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Strains and plasmids used in this study

 


View larger version (33K):
[in this window]
[in a new window]
 
FIG. 1. Genetic organization of the chromosomal aceBAK operon and genetic analysis of the aceA mutant from Y. pestis. (A) Map of the aceBAK operon from wild-type Y. pestis and the isogenic mutants. (B) Agarose gel electrophoresis of amplicons obtained by PCR of wild-type and MacP DNA using primer sets A5-A6 (lanes 1 and 2) and A1-A2 (lanes 3 and 4). The results for the Y. pestis MacK mutant were identical.

 
Loss of ICL activity in the aceA deletion strains was confirmed by enzymatic assay as previously described (26). No ICL activity was detected in the aceA mutants, in contrast to the wild type (Table 2). These results demonstrate that the Y. pestis aceA homologue encodes an ICL enzyme and imply that the aceB and aceK homologues encode the MDH and ICD enzymes.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Comparison of wild-type and {Delta}aceA Y. pestis

 
It has been suggested that the constitutive glyoxylate pathway may compensate for TCA cycle or anapleurotic enzyme deficiencies in Y. pestis (1). To test these hypotheses, the ability to use glucose, pyruvate, and acetate as sole carbon and energy sources was investigated. Y. pestis KIM6+, but not the isogenic aceA mutant, was able to grow at 28°C on minimal media (25 mM HEPES [pH 7]; 2.5 mM K2HPO4, 10 mM NH4Cl, 0.1 mM FeCl2, 0.01 mM MnCl2, 20 mM MgCl2, 2.5 mM CaCl2, and 2.5 mM Na2SO3; 0.04 mM thiamine, 0.04 mM calcium pantothenate, and 0.04 mM biotine; 1 mM L-isoleucine, 1 mM L-valine, 1 mM L-phenylalanine, 1 mM L-methionine, and 5 mM L-glycine; and 1.5% agar) containing 0.2% acetate as a unique carbon source (Table 2). In contrast, both wild-type and mutant strains grew at comparable rates on minimal-medium plates containing 0.2% glucose or pyruvate. These results showed that ICL was required for use of the C2 compound acetate but not the C3 compound pyruvate, suggesting that Y. pestis has a fully functional TCA cycle; this conclusion is consistent with previous chemical and genetic analyses (7, 9, 25).

Effect of aceA mutation in a mouse infection model. ICL has been shown to be required by the intracellular pathogen Mycobacterium tuberculosis and the extracellular pathogen Candida albicans to survive in macrophages and establish infection in mammals (20, 22). Because Y. pestis is believed to be transiently phagocytized by macrophages or dendritic cells in the dermis after transmission (33), constitutive aceA expression could be important for pathogenesis. The impact of ICL loss was assessed by using a mouse experimental model of plague to test this hypothesis. The 50% lethal doses (LD50s) (28) of Y. pestis 195/P and MacP were <10 CFU following intravenous inoculation and 46 and 32 CFU, respectively, following intradermal inoculation. Moreover, no difference in time to disease onset was observed for animals inoculated with ICL-positive or -negative Y. pestis (Fig. 2).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. Incidence of plague in mice injected intradermally with 96 CFU of Y. pestis 195/P (filled circles) or 150 CFU of the isogenic aceA mutant Y. pestis MacP (open circles).

 
Effect of aceA mutation in a flea experimental model. Y. pestis forms aggregates that resemble a biofilm in the flea midgut, which can involve the proventriculus and cause blockage, a crucial step for the bacterial transmission from fleas to mammals (13). In contrast, Y. pseudotuberculosis does not block the proventriculi of fleas (12). Because use of fatty acids, a major component of the flea's blood meal (19), requires the glyoxylate pathway, we tested whether the Y. pestis growth phenotype in the flea depends on ICL. Xenopsylla cheopis rat fleas were infected using a previously established flea model of infection (11). During the 4-week period after the infectious blood meal, 26% ± 5.6% of fleas infected with Y. pestis KIM6+ and 27% ± 2.1% of fleas infected with Y. pestis MacK developed proventricular blockage (Fig. 3A). No difference in the time to blockage was observed; fleas infected with either strain became blocked 2 to 4 weeks after infection. In addition, the infection rate and bacterial load achieved in the flea midgut were comparable (Fig. 3B). These results are in concordance with previous results showing that 22 to 38% of fleas infected with wild-type Y. pestis become blocked, that blockage appears 2 weeks after infection, and that infected fleas contain an average of 3 x 104, 1.8 x 105, and 5.2 x 105 bacteria at 0, 1, and 4 weeks after infection, respectively (12).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 3. Infection of X. cheopis fleas with aceA+/ Y. pestis. (A) Percentage of fleas infected and blocked. (B) Number of bacteria per infected flea during a 4-week period after a single infectious blood meal containing Y. pestis KIM6+ (gray bars) or the isogenic aceA mutant MacK (black bars). The averages and standard deviations of results from two independent experiments are shown, which included 198 fleas infected with KIM6+ and 194 fleas infected with MacK. Sample sizes of 8 to 20 infected fleas were used to determine the average bacterial loads shown in panel B.

 
Conclusion. In mice Y. pestis virulence, unlike that of other pathogens, did not depend on ICL activity (20, 22), and ICL was not required to infect and block the flea vector either. Therefore, Y. pestis does not depend on fatty acids or acetate as an essential carbon source in the insect or mammalian host. In contrast to Y. pseudotuberculosis, none of more than 1,600 Y. pestis clones isolated from different animals and continents had a normally regulated glyoxylate cycle (10). Why does Y. pestis have a constitutive glyoxylate pathway, unlike its recent ancestor Y. pseudotuberculosis? Our results suggest that this deregulation is neither a burden nor an advantage. It has been proposed that Y. pestis is at an early stage of genome decay (36). Therefore, genes which are no longer required, like aceBAK, may remain as an inheritance from Y. pseudotuberculosis, and mutation of the Y. pestis iclR negative regulator may be an evolutionary accident with a neutral effect. However, it cannot be excluded that loss of iclR changes the regulation of genes other than aceBAK that are important for the Y. pestis flea-mammal cycle. Alternatively, constitutive ICL activity may be useful during saprophytic life, since Y. pestis has the capacity of long-term survival in soil (14, 23).

Two previous studies showed that genes which are intact in Y. pseudotuberculosis but are pseudogenes in Y. pestis (genes responsible for production of a smooth lipopolysaccharide and ureolytic activity) were not responsible for virulence differences between Y. pestis and Y. pseudotuberculosis (24, 29). In addition to these two examples of functional gene loss, our results show that loss of regulation of a biochemical pathway does not account for differences in pathogenesis between these two species.


    ACKNOWLEDGMENTS
 
We thank Gregory Somerville, David Erickson, Roberto Rebeil, Christopher Burlak, and Michel Simonet for critical reading of the manuscript.

This work was supported in part by a New Scholars Award in Global Infectious Diseases to B.J.H. from the Ellison Medical Foundation.


    FOOTNOTES
 
* Corresponding author. Mailing address: Rocky Mountain Laboratories, NIAID, NIH, 903 S. 4th St., Hamilton, MT 59840. Phone: (406) 363-9260. Fax: (406) 363-9394. E-mail: jhinnebusch{at}niaid.nih.gov. Back

Editor: J. B. Bliska


    REFERENCES
 Top
 Abstract
 Text
 References
 
1. Brubaker, R. R. 8 September 2000, posting date. Yersinia pestis and bubonic plague. In M. Dworkin, S. Falkow, E. Rosenberg, K. H. Schleifer, and E. Stackebrandt (ed.), The prokaryotes, an evolving electronic resource for the microbiological community. [Online.] http://et.springer-ny.com:8080/prokPUB/index.htm.
1. Chain, P. S. G., E. Carniel, F. W. Larimer, J. Lamerdin, P. O. Stroutland, W. M. Regala, A. M. Georgescu, L. M. Vergez, M. L. Land, V. L. Motin, R. R. Brubaker, J. Fowler, J. Hinnebusch, M. Marceau, C. Medigue, M. Simonet, V. Chenal-Francisque, B. Souza, D. Dacheux, J. M. Elliott, A. Derbise, and E. Garcia. 2004. Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. USA 101:13826-13831.[Abstract/Free Full Text]
2. Chen, T. H., L. E. Foster, and K. F. Meyer. 1961. Experimental comparison of the immunogenicity of antigens in the residue of ultrasonated avirulent Pasteurella pestis with the vaccine prepared with the killed virulent whole organisms. J. Immunol. 87:64-71.
3. Chung, T., D. J. Klumpp, and D. C. LaPorte. 1988. Glyoxylate bypass operon of Escherichia coli: cloning and determination of the functional map. J. Bacteriol. 170:386-392.[Abstract/Free Full Text]
4. Cozzone, A. J. 1998. Regulation of acetate metabolism by protein phosphorylation in enteric bacteria. Annu. Rev. Microbiol. 52:127-164.[CrossRef][Medline]
5. Deng, W., V. Burland, G. Plunkett III, A. Boutin, G. F. Mayhew, P. Liss, N. T. Perna, D. J. Rose, B. Mau, S. Zhou, D. C. Schwartz, J. D. Fetherston, L. E. Lindler, R. R. Brubaker, G. V. Plano, S. C. Straley, K. A. McDonough, M. L. Nilles, J. S. Matson, F. R. Blattner, and R. D. Perry. 2002. Genome sequence of Yersinia pestis KIM. J. Bacteriol. 184:4601-4611.[Abstract/Free Full Text]
6. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59:4310-4317.[Abstract/Free Full Text]
7. Englesberg, E., and J. B. Levy. 1955. Induced synthesis of tricarboxylic acid cycle enzymes as correlated with the oxidation of acetate and glucose by Pasteurella pestis. J. Bacteriol. 69:418-431.[Free Full Text]
8. Gui, L., A. Sunnarborg, and D. C. LaPorte. 1996. Regulated expression of a repressor protein: FadR activates iclR. J. Bacteriol. 178:4704-4709.[Abstract/Free Full Text]
9. Hillier, S., and W. T. Charnetzky. 1981. Glyoxylate bypass enzymes in Yersinia species and multiple forms of isocitrate lyase in Yersinia pestis. J. Bacteriol. 145:452-458.[Abstract/Free Full Text]
10. Hillier, S. L., and W. T. Charnetzky. 1981. Rapid diagnostic test that uses isocitrate lyase activity for identification of Yersinia pestis. J. Clin. Microbiol. 13:661-665.[Abstract/Free Full Text]
11. Hinnebusch, B. J., E. R. Fischer, and T. G. Schwan. 1998. Evaluation of the role of the Yersinia pestis plasminogen activator and other plasmid-encoded factors in temperature-dependent blockage of the flea. J. Infect. Dis. 178:1406-1415.[CrossRef][Medline]
12. Hinnebusch, B. J., A. E. Rudolph, P. Cherepanov, J. E. Dixon, T. G. Schwan, and A. Forsberg. 2002. Role of Yersinia murine toxin in survival of Yersinia pestis in the midgut of the flea vector. Science 296:733-735.[Abstract/Free Full Text]
13. Jarrett, C. O., E. Deak, K. E. Isherwood, P. C. Oyston, E. R. Fischer, A. R. Whitney, S. D. Kobayashi, F. R. DeLeo, and B. J. Hinnebusch. 2004. Transmission of Yersinia pestis from an infectious biofilm in the flea vector. J. Infect. Dis. 190:783-792.[CrossRef][Medline]
14. Karimi, Y. 1963. Conservation naturelle de la peste dans le sol. Bull. Soc. Pathol. Exot. Filiales 56:1183-1186.[Medline]
15. Klumpp, D. J., D. W. Plank, L. J. Bowdin, C. S. Stueland, T. Chung, and D. C. LaPorte. 1988. Nucleotide sequence of aceK, the gene encoding isocitrate dehydrogenase kinase/phosphatase. J. Bacteriol. 170:2763-2769.[Abstract/Free Full Text]
16. Kornberg, H. L. 1966. The role and control of the glyoxylate cycle in Escherichia coli. Biochem. J. 99:1-11.[Medline]
17. LaPorte, D. C., and D. E. Koshland, Jr. 1983. Phosphorylation of isocitrate dehydrogenase as a demonstration of enhanced sensitivity in covalent regulation. Nature 305:286-290.[CrossRef][Medline]
18. LaPorte, D. C., P. E. Thorsness, and D. E. Koshland, Jr. 1985. Compensatory phosphorylation of isocitrate dehydrogenase. A mechanism for adaptation to the intracellular environment. J. Biol. Chem. 260:10563-10568.[Abstract/Free Full Text]
19. Lentner, C. 1984. Blood, p. 65-200. In C. Lentner (ed.), Geigy scientific tables, vol. 3. Physical chemistry composition of blood hematology somatometric data. Ciba Pharmaceutical Co., Basel, Switzerland.
20. Lorenz, M. C., and G. R. Fink. 2001. The glyoxylate cycle is required for fungal virulence. Nature 412:83-86.[CrossRef][Medline]
21. Maloy, S. R., and W. D. Nunn. 1982. Genetic regulation of the glyoxylate shunt in Escherichia coli K-12. J. Bacteriol. 149:173-180.[Abstract/Free Full Text]
22. McKinney, J. D., K. Honer zu Bentrup, E. J. Munoz-Elias, A. Miczak, B. Chen, W. T. Chan, D. Swenson, J. C. Sacchettini, W. R. Jacobs, Jr., and D. G. Russell. 2000. Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase. Nature 406:735-738.[CrossRef][Medline]
23. Mollaret, H. H. 1963. Conservation expérimentale de la peste dans le sol. Bull. Soc. Pathol. Exot. Filiales 56:1168-1182.[Medline]
24. Oyston, P. C., J. L. Prior, S. Kiljunen, M. Skurnik, J. Hill, and R. W. Titball. 2003. Expression of heterologous O-antigen in Yersinia pestis KIM does not affect virulence by the intravenous route. J. Med. Microbiol. 52:289-294.[Abstract/Free Full Text]
25. Parkhill, J., B. W. Wren, N. R. Thomson, R. W. Titball, M. T. Holden, M. B. Prentice, M. Sebaihia, K. D. James, C. Churcher, K. L. Mungall, S. Baker, D. Basham, S. D. Bentley, K. Brooks, A. M. Cerdeno-Tarraga, T. Chillingworth, A. Cronin, R. M. Davies, P. Davis, G. Dougan, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, A. V. Karlyshev, S. Leather, S. Moule, P. C. Oyston, M. Quail, K. Rutherford, M. Simmonds, J. Skelton, K. Stevens, S. Whitehead, and B. G. Barrell. 2001. Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413:523-537.[CrossRef][Medline]
26. Quan, T. J., J. J. Vanderlinden, and K. R. Tsuchiya. 1982. Evaluation of a qualitative isocitrate lyase assay for rapid presumptive identification of Yersinia pestis cultures. J. Clin. Microbiol. 15:1178-1179.[Abstract/Free Full Text]
27. Ramseier, T. M., D. Negre, J. C. Cortay, M. Scarabel, A. J. Cozzone, and M. H. Saier, Jr. 1993. In vitro binding of the pleiotropic transcriptional regulatory protein, FruR, to the fru, pps, ace, pts and icd operons of Escherichia coli and Salmonella typhimurium. J. Mol. Biol. 234:28-44.[CrossRef][Medline]
28. Reed, L. J., and H. A. Muench. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27:493-497.
29. Sebbane, F., A. Devalckenaere, J. Foulon, E. Carniel, and M. Simonet. 2001. Silencing and reactivation of urease in Yersinia pestis is determined by one G residue at a specific position in the ureD gene. Infect. Immun. 69:170-176.[Abstract/Free Full Text]
30. Sikkema, D. J., and R. R. Brubaker. 1987. Resistance to pesticin, storage of iron, and invasion of HeLa cells by yersiniae. Infect. Immun. 55:572-578.[Abstract/Free Full Text]
31. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering in gram negative bacteria. Bio/Technology 1:784-791.[CrossRef]
32. Sunnarborg, A., D. Klumpp, T. Chung, and D. C. LaPorte. 1990. Regulation of the glyoxylate bypass operon: cloning and characterization of iclR. J. Bacteriol. 172:2642-2649.[Abstract/Free Full Text]
33. Titball, R. W., J. Hill, D. G. Lawton, and K. A. Brown. 2003. Yersinia pestis and plague. Biochem. Soc. Trans. 31:104-107.[Medline]
34. Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268.[CrossRef][Medline]
35. Wei, B., S. Shin, D. LaPorte, A. J. Wolfe, and T. Romeo. 2000. Global regulatory mutations in csrA and rpoS cause severe central carbon stress in Escherichia coli in the presence of acetate. J. Bacteriol. 182:1632-1640.[Abstract/Free Full Text]
36. Wren, B. W. 2003. The yersiniae—a model genus to study the rapid evolution of bacterial pathogens. Nat. Rev. Microbiol. 1:55-64.[CrossRef][Medline]


Infection and Immunity, December 2004, p. 7334-7337, Vol. 72, No. 12
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.12.7334-7337.2004




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sebbane, F.
Right arrow Articles by Hinnebusch, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sebbane, F.
Right arrow Articles by Hinnebusch, B. J.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals