Previous Article | Next Article 
Infection and Immunity, February 2004, p. 750-756, Vol. 72, No. 2
0019-9567/04/$08.00+0 DOI: 10.1128/IAI.72.2.750-756.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Immunogenicity against Human Papillomavirus Type 16 Virus-Like Particles Is Strongly Enhanced by the PhoPc Phenotype in Salmonella enterica Serovar Typhimurium
David Baud,1 Jalil Benyacoub,1 Véronique Revaz,1 Menno Kok,2 Françoise Ponci,1 Martine Bobst,1 Roy Curtiss III,3 Pierre De Grandi,1 and Denise Nardelli-Haefliger1*
Department of Gynaecology, Centre Hospitalier Universitaire Vaudois, CH-1011 Lausanne,1
Department of Genetics and Microbiology, Centre Medical Universitaire, CH-1200 Geneva, Switzerland,2
Department of Biology, Washington University, St. Louis, Missouri 631303
Received 14 August 2003/
Returned for modification 25 September 2003/
Accepted 12 November 2003

ABSTRACT
Recombinant
Salmonella strains have been widely used to deliver
heterologous antigens and induce immune responses in vaccinated
animals and humans. It remains to be established, however, how
these bacteria mount an immune response; this has prevented
the rational design of vaccines. Here we report for the first
time that a particular genetic program, PhoP
c, is necessary
for recombinant
Salmonella strains to induce an antibody response
to a heterologous antigen, the human papillomaviruses type 16
(HPV16) virus-like particle (VLP). The PhoP
c phenotype results
from a point mutation in
phoQ, the gene encoding the sensor
component of a two-component regulatory system (PhoP-PhoQ) that
controls the expression of a number of virulence factors in
Salmonellae. To demonstrate that immunogenicity of the viral
antigen expressed by the bacterial vector was dependent on the
PhoP
c phenotype, we have expressed the
phoQ mutant gene (
phoQ24)
in two differently attenuated
Salmonella enterica serovar Typhimurium
strains. Our data show extrachromosomal
phoQ24 to be dominant
over the chromosomal copy of the
phoQ gene, conferring the PhoP
c phenotype on the recipient strains. In addition, activation
of PhoPQ-regulated genes by the plasmid-encoded PhoQ24 did not
alter bacterial survival and conferred immunogenicity to the
HPV16 VLP expressed in the two
S. enterica serovar Typhimurium
backgrounds, inducing the production of HPV-specific antibodies
in mice. This strongly suggests that at least one of the PhoP-regulated
genes is necessary for mounting an efficient antibody response
to HPV16 VLP. This finding sets the stage for further development
of a
Salmonella-based vaccine against HPV infection and cervical
cancer.

INTRODUCTION
The high risk human papillomavirus (HPV) types,
most commonly type 16 (HPV16), are etiologically linked to nearly
100% of cervical cancers (
49). Cervical cancer is the second
most common cause of cancer deaths in women worldwide; this
prevalence has encouraged research into the development of a
prophylactic vaccine to prevent genital infection by these viruses.
Recombinant attenuated
Salmonella strains that are attenuated
yet invasive have been widely used as mucosal vaccine vectors
to deliver pathogen-specific protective epitopes into the mucosa-associated
lymphoid tissues. Via this route, both mucosal and systemic
immune responses to the carrier and the foreign antigens may
be obtained (
8,
41). We have shown that nasal vaccination of
mice with a
Salmonella enterica serovar Typhimurium PhoP
c strain
expressing the HPV16 major capsid protein L1, which self-assembles
into virus-like particles (VLPs), induces anti-HPV16 conformational
and neutralizing antibodies in serum and genital secretions
(
33). The PhoP
c strain is attenuated by a single point mutation
in
phoQ (
14) (designated
phoQ24), the gene encoding the sensor
component of a two-component system (
phoPQ) that is involved
in the regulation of virulence in
S. enterica serovar Typhimurium
(
12,
28,
45). Mutations in the
phoPQ operon affect the expression
of two sets of genes, the PhoP-activated genes (
pag) and the
PhoP-repressed genes (
prg). In the
phoQ24 background,
pag genes
are permanently activated whereas
prg genes remain inactive
due to constitutive activation of the PhoP regulator protein
(PhoP
c). This results in reduced survival of
S. enterica serovar
Typhimurium PhoP
c within macrophages (
11,
13,
29), impaired
invasion of epithelial cells (
4,
36), and altered resistance
to antimicrobial compounds and conditions such as defensins,
polymyxin B (PMB) and low pH (
14,
40,
46). A comparison of differently
attenuated but otherwise isogenic recombinant
S. enterica serovar
Typhimurium strains revealed that only the PhoP
c HPV16 strain
induced HPV16 VLP-specific antibody responses in mice (
5). This
suggested that the immunogenicity of recombinant
Salmonella HPV16 strains was closely related to the PhoP
c phenotype. Unfortunately,
the PhoP
c strain cannot be used in humans because of the reported
high frequency of reversion of its attenuation (
29). We therefore
set out to construct recombinants in which both the PhoP
c phenotype
and the HPV16 VLP antigen were stably expressed in otherwise
safely attenuated
S. enterica serovar Typhimurium recipient
strains (
cya,
crp, and
aro). This would allow us to confirm
the implication of
phoQ24 in immunogenicity of the
Salmonella vector and take the first step toward the construction of a
safe
Salmonella HPV vaccine. We have analyzed the behavior of
these new recombinant strains in vitro and in vivo and confirmed
the correlation between the expression of the PhoP
c phenotype
and immunogenicity against HPV16 VLPs expressed in
S. enterica serovar Typhimurium.

MATERIALS AND METHODS
Plasmid constructs and bacterial strains used.
We have deleted the
asd gene from both the PhoP
c mutant, CS022
(
29) (a kind gift from John Mekalanos, Boston, Mass.), and the
aroA mutant, SL7207 (
22) (a kind gift from Irene Corthésy-Theulaz,
Lausanne, Switzerland), by P22HTint transduction, yielding
asd derivatives denoted GL01 (
37) and GL04, respectively. Diaminopimelic
acid-requiring tetracycline-resistant transductants (
42) were
purified, and tetracycline-sensitive derivatives were obtained
from these transductants by fusaric acid selection (
27,
42).
Stable expression of HPV16 L1 and PhoQ24 was achieved in these
backgrounds with the aspartate ß-semialdehyde dehydrogenase
balanced-lethal vector-host system (
9). To this end, the
NcoI-
HindIII
fragment, encoding HPV16 L1, of plasmid pFS14nsdHPV16-L1 (
33)
was inserted downstream from the trc promoter into the
NcoI
and
HindIII sites of a medium-copy-number
asd- plasmid (pYA3342).
In the resulting plasmid, pYA3342HPV16L1, either an
XbaI fragment
carrying
phoPQ24 or an
HindIII fragment carrying the
phoQ24 open reading frame, including a Shine-Dalgarno (SD) sequence,
was inserted. These fragments were generated by PCR performed
on the DNA of
S. enterica serovar Typhimurium strain CS022 as
a template. For
phoPQ24, the following primers were used: a
26-mer located 144 nucleotides upstream from the ATG of
phoP (
45) and containing a
XbaI site (underlined), 5'-GGG
TCTAGACTGGTCGACGAACTTAA-3',
and a 66-mer containing another
XbaI site (underlined) and a
t2 terminator (in italics), 5'-GGG
TCTAGAAAAAGGCCATCCGTCAGGATGGCCTTCTATGTTAAGTATCCGCAGGCTGGTATCTGA-3'.
For the
HindIII
SDphoQ24 fragment, the primers used were as
follows: a 40-mer containing a synthetic SD sequence (in italics),
5'-GGG
AAGCTTG
AGGAAAAGCTA
ATGAATAAATTTGCTCGCC-3', and a 25-mer
including a
HindIII site (underlined), 5'-GGG
AAGCTTGA
AATGTTTATTCCTC-3'.
The initiation and stop codons are indicated in bold type. The
PCR-amplified
XbaI
phoPQ24 or
HindIII
SDphoQ24 fragments were
cloned in the
XbaI or
HindIII sites of the pYA3342HPV16L1 plasmid,
yielding plasmids pYA3342HPV16L1-PhoPQ24 and pYA3342HPV16L1-SDPhoQ24,
respectively. The different plasmid DNAs were introduced into
the attenuated
S. enterica serovar Typhimurium strains
4550 (
cya
crp
asd [
43]), GL04, and GL01 by electroporation as previously
described (
44). Strains ATCC14028 and CS015 (PhoP
- [
28]) were
a kind gift from John Mekalanos. Table
1 summarizes the different
strains and abbreviations used in this study.
Analysis of pagN promoter activity.
A
pagN::
lacZ indicator plasmid was first generated. The promoter
region of the
pagN gene was cloned and identified by cleavage
of a PCR fragment containing the
S. enterica serovar Typhimurium
ATCC 14028
pagN coding sequence (
15) and upstream sequences
with the enzyme
SspI. The resulting 310-bp fragment was inserted
into the
SmaI site of the transposon Tn
3-based vector pGMK1337
(
25), enabling activation of ß-galactosidase expression.
The plasmid pGMK1338, bearing a 310-bp
SspI
pagN promoter fragment,
and a control plasmid, pGMK1339, bearing an unregulated weak
promoter sequence located upstream of the
pagN gene, were constructed.
To facilitate the analyses, the transposable sequences were
integrated into stringently replicating plasmid R751, yielding
R751::TnP
pagN::
folA::
lacZ or R751::TnP::
folA::
lacZ. These plasmids
were introduced into the recombinant
Salmonella strains by conjugation.
The
Salmonella exconjugants were selected for resistance to
ampicillin (conferred by the conjugative plasmid) and growth
on minimal medium. Specific positive agglutination with
Salmonella O antiserum group B (Difco) was used to confirm the identity
of the exconjugants. ß-Galactosidase activity assays
were performed as described by Miller (
30). Portions (100 µl)
of the bacterial cultures were mixed with 900 µl of Z-buffer
(0.06 M Na
2HPO
4 · 7H
2O, 0.04 M NaH
2PO
4 · H
2O,
0.01 M KCl, 0.001 M MgSO
4 · 7H
2O, 0.05 M ß-mercaptoethanol
[pH 7]) containing 0.1% sodium dodecyl sulfate (SDS) and 1%
chloroform. A 200-µl volum of
o-nitrophenyl-ß-
D-galactoside
(ONPG, 4 mg/ml in Z-buffer [Sigma]) was then added as substrate,
and the optical density (OD) was recorded at both 420 and 550
nm. The light-scattering correction factor (CF = OD
420/OD
550)
was first determined for each
Salmonella strain in Luria-Bertani
(LB) broth and then the ß-galactosidase activity was
calculated using Miller's formula: Ui ß-Galactosidase
= 1,000OD
420 - (CF
x OD
550)/
t x
x OD
600, where
t is time of
the reaction in minutes and
v is the volume of the culture used
in the assay in milliliters.
PMB resistance assay.
PMB resistance was assessed by using a method modified from those of Gunn et al. (14) and Roland et al (40). Briefly, bacterial strains were grown to mid-log phase and diluted to a concentration of approximately 104 CFU/ml in tryptone saline. Cells (100 µl/well) were mixed in a microtiter plate with various concentrations of PMB (Sigma) and incubated at 37°C for 1 h. Then 100 µl of PMB-treated cells was plated on LB agar medium and the relative strain resistances (compared with untreated cells) were determined by CFU counting. The PMB resistance best-fitting sigmoid curves were drawn, and 50% inhibitory concentration were calculated with GraphPad Prism.
Nonspecific acid phosphatase (PhoN) activity assay.
PhoN activity was assessed using a method modified from that of Kier et al. (24). Briefly, Salmonella strains were grown overnight, diluted in LB broth at 1:100, and grown to an OD600 of 0.6. The bacteria were pelleted and resuspended in 1 ml of 1 M Tris (pH 8.0). The cells were mixed with 200 µl of 0.4% p-nitrophenyl phosphate (Sigma) in 1 M Tris (pH 8) and incubated at 37°C until a yellow color appeared; the reaction was then stopped by adding 200 µl of 1 M K2HPO4. The PhoN activity was measured in arbitrary units at OD420/550 by using the same equation used for the ß-galactosidase activity.
Protein analysis.
Recombinant Salmonella cells from an exponential-phase culture were lysed in 2.5% SDS. After 30 min at room temperature, the bacteria were boiled for 10 min in a final solution of 3% SDS-2 mM EDTA-50 mM Tris-HCl (pH 7.0)-8% glycerol-1% ß-mercaptoethanol-0.1% bromophenol blue. Bacterial lysates were separated on SDS-10% polyacrylamide gels. Expression of L1 in the Salmonella lysates, normalized to the OD600 of the cultures, was analyzed by Western blotting as previously described (33), using the anti-HPV16 L1 monoclonal antibody, CAMVIR-1 (Anawa).
Immunization of mice, analysis of the immune response, and recovery of S. enterica serovar Typhimurium.
Six-week-old female BALB/c mice were used in all experiments. A 20-µl volume of bacterial inoculum was administered intranasally under anesthesia as described previously (23, 33). For the inoculum, bacteria were grown to mid-log phase and diluted to ca. 107 CFU/20 µl. Sampling of blood, as well as determination of anti-lipopolysaccharide (LPS) and anti-HPV16 VLP titers by enzyme-linked immunosorbent assay were performed as previously described (23, 33). A good correlation was shown between HPV16 VLP-specific antibody titers and HPV16 neutralization (33, 34, 39). Recovery of S. enterica serovar Typhimurium was determined in organs from euthanized mice as previously described (33).
Statistics.
Comparisons of the different data were made by one-way analysis of variance and a Bonferoni post-test using GraphPad Prism.

RESULTS
Extrachromosomal expression of phoPQ24 activates the pag gene phoN in both
4550 and GL04.
The mutant
phoQ gene,
phoQ24, was inserted into plasmid pYA3342-HPV16L1,
already carrying the HPV16 L1 gene and the
asd gene but no antibiotic
resistance marker. The two plasmids constructed encode either
the complete
phoPQm operon, including the promoter-operator,
or only the
phoQ24 coding sequence, including an SD sequence.
Both constructs were introduced into the attenuated
S. enterica serovar Typhimurium strains,

4550 (
cya
crp
asd [
43]) and GL04
(
aroA
asd [Table
1]). In the resulting
S. enterica serovar Typhimurium
recombinants, plasmid-located
phoQ24 is expected to be dominant
over the chromosomal
phoQ and thus to induce the PhoP
c phenotype.
The phenotypes of strains bearing plasmid-located
phoQ24 and
those in which the full
phoPQ24 operon was present were anticipated
to be different. In the former, the global regulatory protein
PhoP will be mostly in the activated state due to unregulated
phosphorylation by PhoQ24, whereas in the latter, overphosphorylation
of PhoP is expected to be accompanied by higher expression of
the
phoPQ24 operon as a result of a positive autoregulatory
loop (
45). However, in both strains, the expression of the
pag and
prg genes is expected to be deregulated in comparison to
that in strains harboring the wild-type
phoQ.
One of the aspects of the complex PhoPc phenotype is its high phosphatase activity, which helps the identification of this strain on solid media as dark blue colonies when 5-bromo-4-chloro-3-indolylphosphate (BCIP) is added to the medium (29). Indeed, both strains
4550 and GL04 carrying the plasmid containing phoPQ24 generated dark blue colonies on BCIP-containing plates. To our surprise, however, we could not distinguish
4550 and GLO4 recombinants, harboring the plasmid containing phoQ24 from those bearing pYA3342-HPV16L1 as controls, since they all generated light blue colonies on BCIP-containing plates. Determination of the non-acid phosphatase PhoN activities (24) in all these strains further confirmed these observations (Table 2). PhoN activities were similar in the three strains harboring a wild-type phoPQ operon (33U, 31U, and 27U in ATCC14028,
4550 L1, and GL04 L1, respectively) and plasmid-located phoQ24 (22U and 25U in
4550 L1-SDQm and GL04 L1-SDQm, respectively). In contrast, PhoN activity was 5- and 8-fold higher in
4550L1-PQm and GL04L1-PQm (P < 0.05 for 146U and P < 0.001 for 214U), while even higher activation of PhoN (17-fold [p < 0.001]) was observed in the PhoPc strain compared to the wild-type strain. These data show that extrachromosomal expression of phoPQ24, but not phoQ24 activates phoN.
Activation of the pagN promoter in different phoQ24 backgrounds.
An indirect functional analysis of
phoQ24 was performed by introduction
of a plasmid (
PpagN-lacZ) in which
lacZ is expressed under the
control of the
phoPQ-regulated
pagN promoter (
15). A PhoP
c strain
bearing the
PpagN-folA::
lacZ plasmid exhibited 20-fold-higher
ß-galactosidase activity than did the same strain
bearing a plasmid constitutively expressing low levels of LacZ
(control-
lacZ) (Fig.
1); ß-galactosidase activities
in PhoP
- recombinants invariably remained low (data not shown).
When the same plasmid was introduced into

4550L1-SDQ24 or

4550L1-PQ24,
ß-galactosidase activities were 12- and 13-fold higher,
respectively, than in the control strains that expressed
lacZ from a
phoPQ-independent promoter. Most importantly, a significant
increase (five- to sevenfold [fig.
1]) in the ß-galactosidase
activity could be clearly attributed to
phoQ24 expression. Interestingly,
and in contrast to what we had observed in the regulation of
phoN, activation of
pagN was similar in

4550 L1-SDQ24 and

4550
L1-PQ24, suggesting that different threshold levels of the activated
PhoP are necessary to turn on the expression of different
pag genes.
Expression of phoQ24 or phoPQ24 in S. enterica serovar Typhimurium
4550 and GL04 confers resistance to PMB.
We next examined whether extrachromosomal expression of
phoQ24 or
phoPQ24 could influence the expression of another endogenous
PhoPQ-regulated gene. The
pmrAB locus, a
pag gene responsible
for the PMB resistance (
14), was chosen for this assay. The
50% inhibitory concentrations of PMB in different
S. enterica serovar Typhimurium strains were determined (Table
3). As expected,
the PhoP
c strain exhibited a significant increase of PMB resistance
(sevenfold) compared to the wild-type ATCC 14028 (
P < 0.001)
whereas the PhoP
- strain was more sensitive to PMB than was
the wild-type strain (
P < 0.001), which is consistent with
the inactivation of the PhoPQ regulatory system in this strain
(
11,
31). Interestingly, a significant increase in PMB resistance
was conferred on

4550 and GL04 harboring either the L1-SDQ24
or L1-PQ24 plasmid (7.5- and 17.5-fold, respectively, for

4550
and 4.4- and 6.2-fold, respectively, for GL04 [
P < 0.001]).
In addition, similar to
phoN, a higher activation of
pmrAB was
induced when
phoPQ24 was expressed in both strains

4550 and
GL04 (
P < 0.01).
Extrachromosomal expression of phoPQ24, but not phoQ24, altered the ability of
4550 and GL04 to invade and persist in the mouse.
Combinations of
cya
crp mutations (

4550) with mutations in the
phoPQ locus have not yet been evaluated in animal models, while
a double PhoP
c
aroA mutant was shown to be 100-fold more attenuated
than the single
aroA mutant (
32). It was therefore important
to determine whether expression of PhoQ24 in a strain that already
harbored attenuating mutations would not cut short the infectious
pathway in the mouse. This might result in poor antigen presentation
due to cumulative effect of attenuating mutations on mouse virulence.
For this purpose, we intranasally immunized groups of mice with
the different recombinant
Salmonella strains. The mice were
euthanized 2 weeks after immunization, and recombinant
Salmonella organisms were recovered from representative sites of bacterial
invasion and persistence, i.e., lungs, cervical lymph nodes,
Peyer's patches, and spleen (
33). While the two strains harboring
the
phoPQ24-containing plasmid showed a dramatic decrease in
survival and/or replication in all organs examined (Fig.
2),
only a slight decrease was observed in the lungs when these
strains were harboring the
phoQ24-containing plasmid, suggesting
that
phoPQ24, but not
phoQ24, had deleterious effects on invasiveness
and persistence of the
cya
crp and
aroA Salmonella strains in
vivo.
Expression of phoQ24 in both
4550 and GL04 L1-expressing strains confers immunogenicity against HPV16 L1 VLPs.
The aim of this study was to test whether the expression of
the
phoQ24 gene in
S. enterica serovar Typhimurium backgrounds
that were previously shown to be poorly immunogenic would improve
the immunogenicity of the HPV16VLP antigens. Although successfully
used to induce protective immunities against a number of other
heterologous antigens,
cya crp, and
aroA mutants yielded only
barely detectable antibody responses to the HPV16 L1 protein
(
5; J. Benyacoub, unpublished results). Strains

4550 and GL04
harbor a chromosomal deletion that eliminates the
asd gene.
This gene is essential for the growth of bacteria on unsupplemented
media, but its defect can be complemented in
trans by using
a plasmid. This creates a balanced lethal state that can be
exploited to ensure stable plasmid inheritance. Since we had
previously encountered serious problems in the maintenance of
L1-encoding plasmids in

4989 and other isogenic strains (
5),
we decided to use this system to evaluate the role of
phoQ24 in the immunogenicity of HPV16 VLPs delivered by live
Salmonella strains in the mouse. The levels of expression of HPV16L1 were
examined in all the strains to determine whether addition of
phoQ24 to the L1-encoding plasmid would alter L1 expression.
This did not turn out to be the case, as illustrated in Fig.
3. To test the immunogenicity of the VPLs produced by
S. enterica serovar Typhimurium recombinants, mice were intranasally vaccinated
twice with the L1-expressing

4550 and GL04 recombinants and
specific antibody responses were measured in serum 4 weeks after
the second immunization. As expected,

4550 L1 and GL04 L1 induced
low or barely detectable HPV16 VLP antibodies. In contrast,
expression of
phoQ24 in these backgrounds induced a significant
increase of HPV16 VLP immunoglobulin G (IgG) titers in both

4550 L1-SDQ24 and GL04 L1-SDQ24 (
P < 0.05 and
P < 0.001,
respectively [Fig.
4 ]). In contrast to this, and in agreement
with the observed penetration and survival of
Salmonella recombinants
in vivo, bacteria expressing
phoPQ24 induced only very low antibody
titers against HPV16 VLP, the heterologous antigen, and against
bacterial LPS. This supported our hypothesis that these recombinants
were overattenuated (Fig.
4). There was no statistical difference
in the anti-LPS responses induced by the other four strains
(Fig.
4B), suggesting similar infection of the mice. We confirmed
by a sandwich ELISA (
14) that in agreement with the Western
blot analysis, no difference in VLP assembly occurred whether
PhoQ24 was expressed or not (7.0 ± 1.3 and 5.1 ±
0.4 µg of VLP/10
11 CFU for

4550 L1 and

4550 L1-SDQ24,
respectively; 5.6 ± 0.3 and 7.3 ± 1.5 µg
of VLP/10
11 CFU for GL04 L1 and GL04 L1-SDQ24, respectively).
In addition, we did not find any statistical difference in the
anti-HPV16 VLP IgG titers induced by GL01, a PhoP
c
asd strain
(
37), harboring either the L1 gene or the L1-
phoQ24-carrying
plasmid (anti-HPV16 VLP IgG log
10 titers of 2.42 ± 0.34
and 2.84 ± 0.22 [mean ± standard error of the
mean] respectively). Taken together, our data demonstrate that
a relatively low expression level of PhoQ24 can be combined
with attenuations in
aro, as well as in
cya and
crp, although
to a lesser extent, to induce immunogenicity against the HPV16
VLP antigen.

DISCUSSION
Attenuated
Salmonella vaccine strains were initially developed
to produce live typhoid vaccines. Ideally, these strains had
to be safe, stably attenuated, and protective. For these purposes,
several means of attenuation have been used, including introduction
of auxotrophic mutations and mutations in regulatory genes which
render the bacteria avirulent while preserving different degrees
of invasiveness (
26). When these strains were used to carry
heterologous antigens, the specific immune responses induced
were highly variable depending on the antigen expressed, the
location of the antigen in the bacteria, the type of attenuation,
and the route of immunization (
5,
10,
20,
21,
23,
38). However,
to our knowledge this is the first time that a specific genetic
program of
Salmonella has been shown to be required to obtain
an immune response to an heterologous antigen. We have demonstrated
that the PhoP
c phenotype is essential for the induction of antibody
responses to HPV16 VLPs. This genetic program is normally activated
when the
Salmonella organisms enter the intracellular environment,
and it is thought to be triggered by reduced magnesium levels
in the phagosome (
12). Constitutive activation of PhoP, resulting
in expression of the
pag and
prg genes, has important consequences
since it is sufficient to attenuate the strain for mouse virulence
(
28). Only some of the functions of
pag and
prg genes have been
demonstrated; they include genes involved in modification of
LPS, which can affect cytokine and chemokine secretion (
18),
in antimicrobial peptide resistance (PMB [
16,
17]), in the invasion
and secretion of proteins by a type III mechanism (
36), in the
formation of spacious phagosomes (
1), and in antigen presentation
(
48,
50). One or several of these genes could influence the
immune responses in the mouse. Antigen processing and presentation
by dendritic cells might be critical in this process (
6). Interestingly,
antigen presentation by major histocompatibility complex class
II molecules on dendritic cells infected with a PhoP
c strain
expressing the model antigen Crl-OVA was reported to be less
efficient than (
48) or similarly efficient to (
35) that obtained
with the nonattenuated wild-type strain. In contrast, our preliminary
data, obtained using bone marrow-derived dendritic cells and
an HPV16 L1-specific CD4 T-cell hybridoma (
2), revealed that
antigen presentation was more efficient after infection with
the PhoP
c HPV16 strain (data not shown). We cannot exclude the
possibility that the effect of the PhoP
c phenotype is limited
to the HPV16 VLP antigen. Indeed, these VLPs are able to induce
efficient immune responses in the absence of adjuvant in both
mice and humans (
3,
19), probably due to their particulate nature
and regular surface structure. However, this contrasts with
the difficulty in obtaining antibody responses when HPV16 VLPs
are expressed by
Salmonella. Even the strain that most efficiently
induced antibody responses to the HPV16 VLPs, the PhoP
c strain,
could do so only after a double nasal immunization, while oral
immunization was inefficient (
33). This might be linked to the
low level of HPV16 VLP that can be expressed in
Salmonella (ca.
50 µg/10
11 CFU [
33] and only ca. 5 µg/10
11 CFU when
stable expression is achieved with the
asd system), most probably
because of an unfavorable codon usage. Higher levels of expression
(about 1% of the total protein content, the equivalent of approximately
150 µg antigen per 10
11 bacteria) have previously been
shown to be necessary to induce specific antibody responses
with recombinant
Salmonella strains (
7,
47). It is possible
that our finding that the PhoP
c phenotype is required to obtain
significant immunogenicity of HPV16 VLPs expressed in
Salmonella will eventually reveal some of the mechanisms behind the presentation
of antigens expressed by these bacteria.
The main objective of these studies is to develop a live recombinant Salmonella vaccine against HPV16 infection and cervical cancer. The PhoPc strain cannot be used as a vector in humans due to the high frequency of reversion of its attenuation (29). However, we had previously found that this was the only useful background for this particular antigen. In the present study, we have shown that the mutant phoQ24 gene can be introduced into safely attenuated recipient strains by using a plasmid encoding the antigen L1 and carrying the phoQ24 gene. In the resulting recombinants, the extrachromosomal phoQ24 genes induce activation of pag and repression of prg via the endogenous phosphorylated PhoP protein (14, 45), and reversion of all phoQ24 copies is highly unlikely. In these constructs, the extrachromosomal expression of phoQ24 was driven either by its own promoter or by a plasmid promoter. This resulted in strains exhibiting at least some of the features of the PhoPc phenotype, as shown by activation of three different pag genes. Interestingly, the more complete PhoPc phenotype, as judged by the expression levels of a number of PhoP-associated markers, was observed when phoPQ24 was expressed. However, these recombinants suffered from strongly reduced invasiveness and poor immunogenicity, which may be due to overattenuation. In contrast, expression of phoQ24 did not alter the ability to colonize and survive in mice and the resulting strains were immunogenic, i.e, induction of anti-HPV16 VLP antibodies was obtained. Although the titers were slightly lower than those obtained with the PhoPc HPV16 strain (ca. 104 for IgG [33]), they are similar to those obtained with the
asd derivative, GL01, probably because of the lower HPV16 VLP expression observed in these strains. Provided that the anti-HPV16 VLP titers can be induced at higher level, this strategy is a promising step toward a vaccine strain that could be tested in human volunteers.

ACKNOWLEDGMENTS
This work was supported by the Fonds de Service of the Department
of Gynecology and by grants from the Leenaards Foundation (to
D.N.-H. and M.K.) and the Swiss National Science Foundation
(631-057969.99 to D.N.-H. and 32-63021.00 to D.B.)

FOOTNOTES
* Corresponding author. Mailing address: Département de Gynécologie, c/o Institut de Microbiologie, CHUV, Bugnon 48, 1011 Lausanne, Switzerland. Phone: 021/314 40 81. Fax: 021/314 40 95. E-mail:
dnardell{at}hospvd.ch.

Editor: B. B. Finlay

REFERENCES
1 - Alpuche-Aranda, C., M., E. L. Racoosin, J. A. Swanson, and S. I. Miller. 1994. Salmonella stimulate macrophage macrophinocytosis and persist within spacious phagosomes. J. Exp. Med. 179:601-608.[Abstract/Free Full Text]
2 - Balmelli, C., S. Demotz, H. Acha-Orbea, P. De Grandi, and D. Nardelli-Haefliger. 2002. Trachea, lung, and tracheobronchial lymph nodes are the major sites where antigen-presenting cells are detected after nasal vaccination of mice with human papillomavirus type 16 virus-like particles. J. Virol. 76:12596-12602.[Abstract/Free Full Text]
3 - Balmelli, C., R. Roden, A. Potts, J. Schiller, P. De Grandi, and D. Nardelli-Haefliger. 1998. Nasal immunization of mice with human papillomavirus type 16 virus-like particles elicits neutralizing antibodies in mucosal secretions. J. Virol. 72:8220-8229.[Abstract/Free Full Text]
4 - Behlau, I., and S. I. Miller. 1993. A phoP-repressed gene promotes Salmonella typhimurium invasion of epithelial cells. J. Bacteriol. 175:4475-4484.[Abstract/Free Full Text]
5 - Benyacoub, J., S. Hopkins, A. Potts, S. Kelly, J.-P., Kraehenbuhl, R. Curtiss, P. De Grandi, and D. Nardelli-Haefliger. 1999. The nature of the attenuation of Salmonella typhimurium strains expressing human papillomavirus type 16 virus like particles determines the specific antibody responses in nasally immunized mice. Infect. Immun. 67:3674-3679.[Abstract/Free Full Text]
6 - Blanchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245-252.[CrossRef][Medline]
7 - Covone, M. G., M. Brocchi, E. Palla, W. Dias, da, Silveira, R. Rappuoli, and C. L. Galeotti. 1998. Levels of expression and immunogenicity of attenuated Salmonella enterica serovar Typhimurium strains expressing Escherichia coli mutant heat-labile enterotoxin. Infect. Immun. 66:224-231.[Abstract/Free Full Text]
8 - Curtiss, R., J. O. Hassan, J. Herr, S. M. Kelly, M. Levine, G. G. Mahairas, D. Milich, D. Peterson, F. Schödel, J. Srinivasan, C. Tacket, S. A. Tinge, and R. Wright. 1994. Nonrecombinant and recombinant avirulent Salmonella vacines, p. 340-351. In G. P. Talwar (ed.), Recombinant and synthetic vaccines. Narosa Publishing House. New Delhi, India.
9 - Curtiss, R. 1990. Attenuated Salmonella strains as live vectors for the expression of foreign antigens, p. 161-188. In G. C. Woodrow, and M. M. Levine (ed.), New generation vaccines. Marcel Dekker, Inc., New York, N.Y.
10 - Dunstan, S. J., C. P. Simmons, and R. A. Strugnell. 1998. Comparison of the abilities of different attenuated Salmonella typhimurium strains to elicit humoral immune responses against a heterologous antigen. Infect. Immun. 66:732-740.[Abstract/Free Full Text]
11 - Fields, P. I., E. A. Groisman, and F. Heffron. 1989. A Salmonella locus that controls resistance to microbiocidal proteins from phagocytic cells. Science 243:1059-1062[Abstract/Free Full Text]
12 - Garcia, V. E., F. C. Soncini, and E. A. Groisman. 1996. Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell 84:165-174.[CrossRef][Medline]
13 - Groisman, E. A., E. Chiao, C. J. Lipps, and F. Heffron. 1989. Salmonella typhimurium phoP virulence gene is a transcriptional regulator. Proc. Natl. Acad. Sci. USA 86:7077-7081.[Abstract/Free Full Text]
14 - Gunn, J. S., E. L. Hohmann, and S. I. Miller. 1996. Transcriptional regulation of Salmonella virulencea phoQ periplasmic domain mutation results in increased net phosphotransfer to PhoP. J. Bacteriol. 178:6369-6373.[Abstract/Free Full Text]
15 - Gunn, J. S., W. J. Belden, and S. I. Miller. 1998. Identification of PhoP-PhoQ activated genes within a duplicated region of the Salmonella typhimurium chromosome. Microb. Pathog. 25:77-90.[CrossRef][Medline]
16 - Gunn, J. S., K. B. Lim, J. Krueger, K. Kim, L. Guo, M. Hackett, and S. I. Miller. 1998. PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Mol. Microbiol. 27:1171-1182.[CrossRef][Medline]
17 - Gunn, J. S., S. S. Ryan, V. J. Van, R. K. Ernst, and S. I. Miller. 2000. Genetic and functional analysis of a PmrA-PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of Salmonella enterica serovar Typhimurium. Infect. Immun. 68:6139-6146.[Abstract/Free Full Text]
18 - Guo, L., K. B. Lim, J. S. Gunn, B. Bainbridge, R. P. Darveau, M. Hackett, and S. I. Miller. 1997. Regulation of lipid a modifications by Salmonella typhimurium virulence genes phoP-phoQ. Science 276:250-253.[Abstract/Free Full Text]
19 - Harro, C. D., Y. Y. Pang, R. B. Roden, A. Hildesheim, Z. Wang, M. J. Reynolds, T. C. Mast, R. Robinson, B. R. Murphy, R. A. Karron, J. Dillner, J. T. Schiller, and D. R. Lowy. 2001. Safety and immunogenicity trial in adult volunteers of a human papillomavirus 16 L1 virus-like particle vaccine. J. Natl. Cancer Inst. 93:284-292.[Abstract/Free Full Text]
20 - Hess, J., I. Gentschev, D. Miko, M. Welzel, C. Ladel, W. Goebel, and S. Kaufmann. 1996. Superior efficacy of secreted over somatic antigen display in recombinant Salmonella vaccine induced protection against listeriosis. Proc. Natl. Acad. Sci. USA 93:1458-1463.[Abstract/Free Full Text]
21 - Hohmann, E. L., C. A. Oletta, W. P. Loomis, and S. I. Miller. 1995. Macrophage-inducible expression of a model antigen in Salmonella typhimurium enhances immunogenicity. Proc. Natl. Acad. Sci. USA 92:2904-2908.[Abstract/Free Full Text]
22 - Hoiseth, S. K., and B. A. D. Stocker. 1981. Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291:238-239.[CrossRef][Medline]
23 - Hopkins, S., J.-P. Kraehenbuhel, F. Schödel, A. Potts, D. Peterson, P. De Grandi, and D. Nardelli-Haefliger. 1995. A recombinant Salmonella typhimurium vaccine induces local immunity by four different routes of immunization. Infect. Immun. 63:3279-3286.[Abstract]
24 - Kier, L. D., R. Weppelman, and B. N. Ames. 1977. Resolutions and purification of three periplasmic phosphatases of Salmonella typhimurium. J. Bacteriol. 130:399-410.[Abstract/Free Full Text]
25 - Kok, M. 1995. A new horizon for pBR322: in vivo insertion of plasmid fragments into wide host range shuttle vectors. Nucleic Acids Res. 23:5085-5086.[Free Full Text]
26 - Levine, M. M., J. Galen, E. Barry, F. Noriega, S. Chatfield, M. Sztein, G. Dougan, and C. Tacket. 1996. Attenuated Salmonella as live oral vaccines against typhoid fever and as live vectors. J. Biotechnol. 44:193-196.[CrossRef][Medline]
27 - Maloy, S., and W. Nunn. 1981. Selection for loss of tetracycline resistance by Escherichia coli. J. Bacteriol. 145:1110-1112.[Abstract/Free Full Text]
28 - Miller, S. I., A. M. Kukral, and J. J. Mekalanos. 1989. A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence. Proc. Natl. Acad. Sci. USA 86:5054-5058.[Abstract/Free Full Text]
29 - Miller, S. I., and J. J. Mekalanos. 1990. Constitutive expression of the phoP regulon attenuates Salmonella virulence and survival within macrophages. J. Bacteriol. 172:2485-2489.[Abstract/Free Full Text]
30 - Miller, J. H. 1972. Assay of ß-Galactosidase, p. 352-355. In J. H. Miller (ed.), Experiments in genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
31 - Miller, S. I., W. S. Pulkkinen, M. E. Selsted, and J. J. Mekalanos. 1990. Characterization of defensin resistance phenotypes associated with mutations in the phoP virulence regulon of Salmonella typhimurium. Infect. Immun. 58:3706-3710.[Abstract/Free Full Text]
32 - Miller, S. I., J. J. Mekalanos, and W. S. Pulkkinen. 1990. Salmonella vaccines with mutations in the phoP virulence regulon. Res. Microbiol. 141:817-821.[Medline]
33 - Nardelli-Haefliger, D., R. Roden, J. Benyacoub, R. Sahli, J. P. Kraehenbuhl, J. T. Schiller, P. Lachat, A. Potts, and P. Degrandi. 1997. Human papillomavirus type 16 virus-like particles expressed in attenuated Salmonella typhimurium elicit mucosal and systemic neutralizing antibodies in mice. Infect. Immun. 65:3328-3336.[Abstract]
34 - Nardelli-Haefliger, D., R. Roden, C. Balmelli, A. Potts, J. Schiller, and P. De Grandi. 1999. Mucosal but not parenteral immunization with purified human papillomavirus type 16 virus-like particles induces neutralizing titers of antibodies throughout the estrous cycle of mice. J. Virol. 74:9609-9613.
35 - Niedergang, F., J. C. Sirard, C. T. Blanc, and J. P. Kraehenbuhl. 2000. Entry and survival of Salmonella typhimurium in dendritic cells and presentation or recombinant antigens do not require macrophage-specific virulence factors. Proc. Natl. Acad. Sci. USA 97:14650-14655.[Abstract/Free Full Text]
36 - Pegues, D. A., M. J. Hantman, I. Behlau, and S. I. Miller. 1995. PhoP/PhoQ transcriptional repression of Salmonella typhimurium invasion genes: evidence for a role in protein secretion. Mol. Microbiol. 17:169-181.[CrossRef][Medline]
37 - Revaz, V., J. Benyacoub, W. M. Kast, J. T. Schiller, P. De Grandi, and D. Nardelli-Haefliger. 2001. Mucosal vaccination with a recombinant Salmonella typhimurium expressing human papillomavirus type 16 (HPV16) L1 virus-like-particles (VLPs) or HPV16 VLPs purified form insect cells inhibits the growth of HPV16-expressing tumor cells in mice. Virology 279:354-360.[CrossRef][Medline]
38 - Roberts, M., S. N. Chatfield, and G. Dougan. 1994. Salmonella as carriers of heterologous antigens, p. 27-58. CRC Press Inc., Boca Raton, Fla.
39 - Roden, R. B. S., H. L. Greenstone, R. Kirnabauer, J. P. Booy, J. Jessie, D. R. Lowy, and J. T. Schiller. 1996. In vitro generation and type-specific neutralization of a human papillomavirus type 16 virion pseudotype. J. Virol. 70:5875-5883.[Abstract]
40 - Roland, K. L., C. R. Esther, and J. K. Spitznagel. 1994. Isolation and characterization of a gene, pmrD, from Salmonella typhimurium that confers resistance to polymyxin when expressed in multiple copies. J. Bacteriol. 176:3589-3597.[Abstract/Free Full Text]
41 - Schödel, F. 1992. Prospects for oral vaccination using recombinant bacteria expressing viral epitopes. Adv. Virus Res. 41:409-446.[Medline]
42 - Schödel, F., S. M. Kelly, D. L. Peterson, D. R. Milich, and R. Curtiss. 1994. Hybrid hepatitis B virus core-pre-S proteins synthesized in avirulent Salmonella typhimurium and Salmonella typhi for oral vaccination. Infect. Immun. 62:1669-1776.[Abstract/Free Full Text]
43 - Schödel, F., S. M. Kelly, D. Peterson, D. Milich, J. Hughes, S. Tinge, R. Wirtz, and R. Curtiss III. 1994. Development of recombinant Salmonellae expressing hybrid hepatitis B virus core particles as candidate oral vaccines. Dev. Biol. Stand. 82:151-158.[Medline]
44 - Schödel, F., D. R. Milich, and H. Will. 1990. Hepatitis B virus nucleocapsid/pre-S2 fusion proteins expressed in attenuated Salmonella for oral vaccination. J. Immunol. 145:4317-4321.[Abstract]
45 - Soncini, F. C., G. Garcia Vescovi, and E. A. Goisman. 1995. Transcriptional autoregulation of the Salmonella typhimurium phoPQ operon. J. Bacteriol. 177:4364-4371.[Abstract/Free Full Text]
46 - Soncini, F. C., E. G. Vescovi, F. Solomon, and E. A. Groisman. 1996. Molecular basis of the magnesium deprivation response in Salmonella typhimuriumidentification of phoP-regulated genes. J. Bacteriol. 178:5092-5099.[Abstract/Free Full Text]
47 - Srinivasan, J., S. Tinge, R. Wright, J. C. Herr, and R. Curtiss. 1995. Oral immunization with attenuated Salmonella expressing human sperm antigen induces antibodies in serum and the reproductive tract. Biol. Reprod. 53:462-471.[Abstract]
48 - Svensson, M., C. Johansson, and M. J. Wick. 2000. Salmonella enterica serovar Typhimurium-induced maturation of bone marrow-derived dendritic cells. Infect. Immun. 68:6311-6320.[Abstract/Free Full Text]
49 - Walboomers, J. M., M. V. Jacobs, M. M. Manos, F. X. Bosch, J. A. Kummer, K. V. Shah, P. J. Snijders, J. Peto, C. J. Meijer, and N. Munoz. 1999. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J. Pathol. 189:12-19.[CrossRef][Medline]
50 - Wick, M. J. 1995. The phoP locus influences processing and presentation of Salmonella typhimurium antigens by activated macrophages. Mol. Microbiol. 16:465-476.[Medline]
Infection and Immunity, February 2004, p. 750-756, Vol. 72, No. 2
0019-9567/04/$08.00+0 DOI: 10.1128/IAI.72.2.750-756.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Saxena, M., Coloe, P. J., Smooker, P. M.
(2009). Influence of Promoter, Gene Copy Number, and Preexisting Immunity on Humoral and Cellular Responses to a Vectored Antigen Delivered by a Salmonella enterica Vaccine. CVI
16: 78-87
[Abstract]
[Full Text]
-
Fang, C.-M., Wang, J. Y., Chinchilla, M., Levine, M. M., Blackwelder, W. C., Galen, J. E.
(2008). Use of mchI Encoding Immunity to the Antimicrobial Peptide Microcin H47 as a Plasmid Selection Marker in Attenuated Bacterial Live Vectors. Infect. Immun.
76: 4422-4430
[Abstract]
[Full Text]
-
Baud, D., Ponci, F., Bobst, M., De Grandi, P., Nardelli-Haefliger, D.
(2004). Improved Efficiency of a Salmonella-Based Vaccine against Human Papillomavirus Type 16 Virus-Like Particles Achieved by Using a Codon-Optimized Version of L1. J. Virol.
78: 12901-12909
[Abstract]
[Full Text]
-
Arnold, H., Bumann, D., Felies, M., Gewecke, B., Sorensen, M., Gessner, J. E., Freihorst, J., von Specht, B. U., Baumann, U.
(2004). Enhanced Immunogenicity in the Murine Airway Mucosa with an Attenuated Salmonella Live Vaccine Expressing OprF-OprI from Pseudomonas aeruginosa. Infect. Immun.
72: 6546-6553
[Abstract]
[Full Text]
-
Kotton, C. N., Hohmann, E. L.
(2004). Enteric Pathogens as Vaccine Vectors for Foreign Antigen Delivery. Infect. Immun.
72: 5535-5547
[Full Text]