IAI FigSearch
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oram, D. M.
Right arrow Articles by Holmes, R. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oram, D. M.
Right arrow Articles by Holmes, R. K.

 Previous Article  |  Next Article 

Infection and Immunity, April 2004, p. 1885-1895, Vol. 72, No. 4
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.4.1885-1895.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Analysis of Genes That Encode DtxR-Like Transcriptional Regulators in Pathogenic and Saprophytic Corynebacterial Species

Diana Marra Oram, Ana Avdalovic, and Randall K. Holmes*

Department of Microbiology, University of Colorado Health Sciences Center, Denver, Colorado 80262

Received 18 June 2003/ Returned for modification 15 August 2003/ Accepted 5 January 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Metal-dependent transcriptional regulators of the diphtheria toxin repressor (DtxR) family have been identified in a wide variety of bacterial genera, where they control gene expression in response to one of two metal ions, Fe2+ or Mn2+. DtxR of Corynebacterium diphtheriae is the best characterized of these important metal-dependent regulators. The genus Corynebacterium includes many phenotypically diverse species, and the prevalence of DtxR-like regulators within the genus is unknown. We assayed chromosomal DNA from 42 different corynebacterial isolates, representing 33 different species, for the presence of a highly conserved region of the dtxR gene that encodes the DNA-binding helix-turn-helix motif and metal-binding site 1 within domains 1 and 2 of DtxR. The chromosome of all of the isolates contained this conserved region of dtxR, and DNA sequencing revealed a high level of nucleotide sequence conservation within this region in all of the corynebacterial species (ranging from 62 to 100% identity and averaging 70% identity with the dtxR prototype). The level of identity was even greater for the predicted protein sequences encoded by the dtxR-like genes, ranging from 81 to 100% identity and averaging 91% identity with DtxR. Using a DtxR-specific antiserum we confirmed the presence of a DtxR-like protein in extracts of most of the corynebacterial isolates and determined the precise amount of DtxR per cell in C. diphtheriae. The high level of identity at both DNA and protein levels suggests that all of the isolates tested encode a functional DtxR-like Fe2+-activated regulatory protein that can bind homologs of the DtxR operator and regulate gene expression in response to iron.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The genus Corynebacterium includes a heterogeneous group of 59 species of non-spore-forming, irregularly staining, gram-positive (G+), rod-shaped, aerobic or facultative bacteria (14, 45). Although the genus was originally created to accommodate the diphtheria bacillus and a few other species pathogenic in animals (1), it was more precisely defined and extended through the use of chemical analysis to include species that have cell wall chemotype IV (meso-diaminopimelic acid, arabinose, and galactose), contain corynemycolic acids (22 to 36 carbon atoms), and have cellular fatty acids of the straight-chain saturated and monounsaturated types, dehydrogenated menaquinones, and G+C contents of 46 to 74% (14, 28, 60). Even with the use of these precise chemical criteria, the heterogeneity within the genus is large. Although the inclusion of saprophytic species and both animal and plant pathogens resulted in questions as to the validity of the genus, analysis of 16S RNA gene sequences confirmed the phenotypically diverse genus Corynebacterium as a monophyletic group, including two taxon groups within the family Mycobacteriaceae (14, 36).

The best-characterized human pathogen within the genus, Corynebacterium diphtheriae, requires the production of diphtheria toxin (DT) in order to cause the severe respiratory disease diphtheria. DT is the product of the tox gene, which is encoded on some corynephages (59). The chromosomally encoded regulator DtxR controls transcription of tox in response to changes in the intracellular concentration of Fe2+ (4, 48). DtxR is the founding member of a rapidly expanding family of metal ion-dependent regulatory proteins that have been identified primarily in G+ and acid-fast bacterial genera (11). Structurally, DtxR can be divided into three domains (41, 46). Domain 1 includes amino acids 1 to 73 and contains a classic helix-turn-helix DNA-binding motif. The second domain consists of amino acids 74 to 140 and is required for dimerization and metal binding. Finally, domain 3 has topology that resembles closely the SH3 domains found in signal transduction proteins and consists of amino acids 140 to 226 (40). In C. diphtheriae, the iron-bound form of DtxR binds to operators that overlap the promoters it regulates, thereby preventing transcription under high-iron conditions (27, 49, 52). When iron is limited, iron-free DtxR is unable to bind the operators, repression is relieved, and transcription occurs.

Transcriptional regulators similar to DtxR have been identified by sequence homology in several bacterial and archaeal genera, including Archaeoglobus (25), Methanococcus (5), Methanobacterium (53), Pyrococcus (26), Deinococcus (64), and Thermotoga (30). In the genera Streptococcus (22, 24), Staphylococcus (20), Brevibacterium (33), Bacillus (42), Escherichia (37), Treponema (18), Streptomyces (17), Mycobacterium (9), and Rhodococcus (3) proteins with homology to DtxR have been both identified and at least partially characterized. The described members of the DtxR family have thus far fallen into two groups: those that respond to iron and those that respond to manganese. The relative occurrence of DtxR-like regulators that respond to manganese compared to those responsive to iron is unclear, since the metal specificity of many members of the family is yet to be fully characterized.

The occurrence of DtxR-like regulators within the genus Corynebacterium has yet to be extensively investigated. In both C. ulcerans and C. pseudotuberculosis, lysogeny by a phage containing tox results in iron-regulated DT production (29), indicating the presence of a DtxR-like regulator. In addition, a consensus-binding site for DtxR was identified in the region upstream of genes encoding an iron-uptake system in C. pseudotuberculosis (2), providing further evidence of a DtxR-like regulator in this species. Finally, genes encoding DtxR-like proteins were identified in the genome sequences of C. glutamicum (56) and C. efficiens (32). We investigated the prevalence and conservation of DtxR-like iron-dependent regulators within the genus Corynebacterium by assaying the chromosome of 42 different isolates (Table 1), comprising 33 different corynebacterial species, for the presence of DNA sequences with homology to dtxR and then confirmed the presence of DtxR-like proteins in most isolates by using a DtxR-specific antiserum. In addition, we constructed phylogenetic trees based on the dtxR-like gene sequences and the 16S RNA gene sequences of each of the 42 corynebacterial isolates. Finally, we determined the number of DtxR molecules per cell in C. diphtheriae. The pervasiveness of DtxR-like proteins in the genus Corynebacterium is indicative of the essential roles proteins in this metal-dependent gene regulator family play in cell growth and survival.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Corynebacterial isolates

 

    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Strains, media, and culture conditions. The corynebacterial isolates listed in Table 1 are all from the laboratory stocks of M. B. Coyle (Departments of Laboratory Medicine and Microbiology, Harborview Medical Center, University of Washington, Seattle) except for C. diphtheriae C7(-) (13) and C. glutamicum ATCC 13032, which was purchased directly from the American Type Culture Collection (ATCC). All media were purchased from Difco/Becton Dickinson, Sparks, Md. The corynebacterial isolates listed in Table 1 were grown aerobically at 37°C in heart infusion broth plus 0.2% Tween 80, except for isolates 16 and 40, corresponding to C. flavescens and C. variabilis, which were grown aerobically at 30°C.

Isolation of chromosomal DNA from corynebacterial strains and Southern blots. Bacterial cells were lysed mechanically by using 0.1-mm glass beads and a Bead-Beater (Biospec Products, Inc., Bartlesville, Okla.) as described by Oram et al. (34). Briefly, bacterial cultures were grown until turbid, and a 5-ml sample of each culture was pelleted in a centrifuge. The cell pellets were resuspended in 0.5 ml of solution 1 (100 mM Tris [pH 8], 10 mM EDTA, 50 mM glucose) and lysed by using an equal volume of 0.1 mm glass beads in a Bead-Beater at full speed. After centrifugation, the supernatant was extracted with phenol-chloroform (1:1) and precipitated with ethanol. The recovered DNA pellets were resuspended in water. For Southern blot detection the chromosomal DNA was digested with BamHI and run on 0.7% agarose gels. The electrophoresed DNA was transferred to nylon membranes, and the membranes were hybridized with a probe homologous to C. diphtheriae dtxR. In order to generate a probe, the primers MCS2, 5'-TTGTCGTTGTCGCCTCAG-3' and MW2, 5'-AGCATCGAGGAGCTGTGT-3' were used to amplify a 396-bp internal fragment of dtxR. The probe was labeled and Southern blots were performed by using the DIG DNA labeling and detection kit (Roche Molecular Biochemicals, Indianapolis, Ind.) according to the manufacturer's instructions. We varied the stringency conditions of the hybridization and washes in an attempt to detect a dtxR-like gene in species in which homology may have been limited.

PCR, sequencing and sequence analysis. PCR was performed by using Taq polymerase (MBI Fermentas, Amherst, N.Y.) according to the manufacturer's instructions. The sequences of the dtxR-specific primers are shown in Fig. 1. The sequences from 5' to 3' of the 16S RNA primers are AGAGTTTGATCCTGGCTGAG for 16S-fD1 and ACGGCTACCTTGTTACGACTT for 16S-rP2. The University of Colorado Cancer Center DNA Sequencing and Analysis Core Facility, Denver, performed the DNA sequencing. Vector NTI and AlignX software (Infomax, Golden, Colo.), as well as Gene Doc software (31), was used to analyze the sequence data. Phylogenetic trees were calculated and bootstrapped by using the neighbor-joining method included in CLUSTAL X and CLUSTAL W (57, 58).



View larger version (98K):
[in this window]
[in a new window]
 
FIG. 1. Primers used to detect dtxR-like sequences in PCR. The published DNA sequences of eight members of the DtxR-like regulator family were aligned. Portions of this alignment from bp 1 to 45 and from bp 296 to 345 are shown. The numbers above the alignment indicate the position of the base in C. diphtheriae dtxR. The amino acids encoded by C. diphtheriae dtxR are shown below the alignment. The nucleic acid positions at which conservation was eight of eight are shown as white text on a black background, those whose conservation was six to seven of eight are shown as white text on a gray background, and those whose conservation was less than six of eight are shown as black letters on a white background. The sequences are labeled as follows: dip, C. diphtheriae dtxR; glu, C. glutamicum dtxR; lep, M. leprae ideR, sme, M. smegmatis ideR; tub, M. tuberculosis ideR; liv, S. lividans desR; pil, S. pilosus desR; and ery, R. erythropolis ideR. The sequences of the two primers dtxRcr1 and dtxRcr2 (reversed) and the direction in which they prime in PCR are indicated.

 
Isolation of whole-cell proteins from corynebacterial strains and Western blots. Turbid cultures were concentrated 10-fold in solution 1 and lysed by using the Bead-Beater as described above. After lysis, samples were centrifuged for 5 min, and the supernatant (extract) was transferred to a new tube. An equal volume of extract was added to 2x sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (2% SDS, 125 mM Tris [pH 8.8], 20% glycerol, and 0.1% bromophenol blue) and then electrophoresed on a SDS 13.5% polyacrylamide gels. After separation on the polyacrylamide gels the proteins were either stained with Coomassie blue or transferred to nitrocellulose and probed in Western blots (21), with polyclonal rabbit antiserum generated against a DtxR-maltose-binding protein fusion (52), as well as a polyclonal rabbit antiserum generated against a two-domain version of the DtxR protein truncated after amino acid 144 (unpublished data of D. M. Oram and R. K. Holmes). The detection of reactive protein bands in the Western blots was performed by using the SuperSignal West Dura extended duration substrate from Pierce, Rockford, Ill.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of dtxR-like sequences by using Southern blots. Chromosomal DNA was extracted from each isolate listed in Table 1 and used in Southern blots. The probe used in the Southern blots was identical to an internal fragment of the C. diphtheriae dtxR gene (from bp 158 to 555), comprising the coding region for amino acid L53 to A185 in DtxR. A summary of the Southern blot results is shown in Table 1 column 4. Chromosomal DNA from C. diphtheriae C7(-) was included on every gel as a positive control, as well as chromosomal DNA isolated from Vibrio cholerae 3083-2 (12) as a negative control. No sequences with significant homology to dtxR have been identified in V. cholerae (19). Using this assay, we detected sequences with homology to dtxR in the chromosomal DNA of 15 of the 42 corynebacterial isolates tested (Table 1). The size of the band detected in each strain varied widely but, as predicted by the chromosomal sequencing project at the Wellcome Trust Sanger Institute (http://www.sanger.ac.uk) (7), dtxR in C. diphtheriae was detected on a 2.2-kb BamHI fragment. Detection of dtxR-like sequences by using this method was exquisitely sensitive to hybridization and washing conditions. Small increases in the stringency of the conditions resulted in failure to detect some sequences, while decreases in the stringency conditions resulted in multiple hybridizing bands in all lanes (data not shown). We therefore decided to confirm the presence or absence of dtxR-like sequences in these strains by using another method.

Detection of dtxR-like sequences by using PCR. Within the family of DtxR-like metal-dependent regulators domains 1 and 2, corresponding to the first 140 amino acids of DtxR, demonstrate a very high level of conservation, whereas domain 3 is quite variable (11). In fact, several Mn2+-dependent regulators in the DtxR family lack domain 3 (39, 42). With this in mind, we designed a pair of primers corresponding with very highly conserved regions of the dtxR-like genes shown in Fig. 1. The protein sequences of the eight iron-dependent regulators shown in Fig. 1 demonstrated 62% identity and 74% similarity over their entire length, but the homology increased to 79% identity and 89% similarity when only the first two domains were compared. Similarly, the DNA sequences of these eight iron-dependent regulators were more similar over the region encoding domains 1 and 2 of DtxR (73% identical) than over the entire length of the genes (64% identical). We designed primers that bind to the most conserved regions of the DNA sequences. The amino acids and base pairs are numbered according to their positions in the C. diphtheriae DtxR protein and dtxR gene, respectively. The protein sequences between D6 and Y11 were 100% conserved. In addition, the DNA sequence is highly conserved in this area in part because of a conserved methionine at position 10, for which there is only one codon. We designed one of our primers to bind in this region, dtxRcr1, for dtxR conserved region 1 (Fig. 1). We designed a reverse primer, dtxRcr2, in a region that is also very conserved, encoding W104 to D110. The primers dtxRcr1 and dtxRcr2 have 95 and 90% homology, respectively, with the C. diphtheriae dtxR sequence and have at least 85% homology with each of the seven other sequences (Fig. 1). These primers are predicted to amplify a 317-bp internal fragment of dtxR in C. diphtheriae. PCR with chromosomal DNA isolated from each of the 42 different isolates listed in Table 1 as a template and these primers yielded a product of ca. 300 bp in all samples save one: C. minutissimum (data not shown). Note that C. minutissimum did show a weak hybridizing band in the Southern blot, and we propose that our inability to generate a PCR product in this strain is likely due to differences in the DNA sequence of its dtxR-like gene that prevent binding of one or both of our primers. No PCR products were generated when DNA from either Escherichia coli DH5{alpha} (Bethesda Research Laboratories, Gaithersburg, Md.) or V. cholerae 3083-2 was used as a template (data not shown). The primers dtxRcr1 and dtxRcr2 are not homologous to the mntR genes from C. diphtheriae (47) or B. subtilis (42), which encode Mn2+-dependent regulators of the DtxR family, and they would not be predicted to amplify an mntR-like gene.

We purified all of the PCR products and determined the DNA sequences of both strands of each one with the primers used to generate them: dtxRcr1 and dtxRcr2. We compared the sequences (275 bp) to each other and to C. diphtheriae dtxR. Overall, the DNA sequences were very conserved showing an average of 71% identity to each other (Table 2). In four isolates, C. argentoratense (Table 1, sample 9), C. coyleae (Table 1, samples 12 and 13), and C. glucuronolyticum (Table 1, sample 17), the sequence of the PCR product was identical to that of the same region of C. diphtheriae dtxR. In addition the DNA sequences of C. imitans (Table 1, sample 20) and C. ulcerans (Table 1, sample 38) were identical as were those of C. afermentans (Table 1, sample 4) and C. pseudodiphtheriticum (Table 1, sample 32). An even higher level of overall conservation was observed in the predicted protein sequences, which had 89% similarity and 81% identity (Fig. 2). The high level of conservation observed in both the DNA and the predicted protein sequences suggests that DtxR-like transcriptional regulators are found in all of the strains listed in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Percent identity of dtxR-like DNA sequences

 


View larger version (184K):
[in this window]
[in a new window]
 
FIG. 2. Alignment of predicted protein sequences. The numbers on the far left correspond to the sample numbers in Table 1 and indicate the isolate from which the sequence was determined. The position of the residue in C. diphtheriae DtxR is indicated above the alignment. Amino acids that are conserved in all of the sequences are shown as white letters on a black background, conservative substitutions are shown as white text on a gray background, blocks of similar residues are shown as white text on a dark gray background, weakly similar residues are shown as black text on a gray background, and nonhomologous residues are shown as black text on a white background. The asterisks indicate amino acids involved in metal binding, and the plus signs indicate residues that interact with DNA.

 
Amplification and sequencing of the 16S RNA coding region. Many of the strains listed in Table 1 grew poorly under our standard lab conditions. To confirm that we had isolated DNA from the correct species, we amplified a region that encodes a portion of the 16S rRNA from each of the DNA samples used previously in PCR to detect a portion of a dtxR-like gene. In 1991, Weisburg et al. described several primers useful in amplifying 16S RNA sequences from a wide variety of bacterial genera (62). We based our primers on the previously described primers fD1 and rP2 because they were defined as useful in amplification of 16S RNA sequences from most eubacteria (62). We deleted the 5' restriction site containing DNA tails of both primers to construct the primers, 16S-fD1 and 16S-rP2 (see Materials and Methods). As expected, the PCR resulted in a 1.3-kb DNA product in all cases. These products were purified and sequenced. With the few exceptions described below, the determined DNA sequence matched published sequences for the chromosomal region encoding the 16S RNA of the species being tested. The 16S RNA sequence of C. amycolatum (Table 1, sample 6) was a better match to C. xerosis GenBank accession number (GB) X84446 (98% identical) sequence than to that of C. amycolatum GB X84244 (96% identical), the 16S RNA sequence of C. imitans (Table 1, sample 20) was a better match to the C. lipophiloflavum GB Y09045 (98% identical) sequence than that of C. imitans GB Y09044 (94% identical), the 16S RNA sequence of C. lipophiloflavum (Table 1, sample 23) was a better match to the C. imitans (98% identical) sequence than to that of C. lipophiloflavum (94% identical), the 16S RNA sequence of C. afermentans (Table 1, sample 3) was a better match to the C. jeikeium GB X84250 (99% identical) sequence than to that of C. afermentans GB X82054 (93% identical), the 16S RNA sequence of C. cystitidis (Table 1, sample 14) was a better match to the C. renale GB M29553 (99% identical) sequence than to that of C. cystitidis GB X84252 (92% identical), the 16S RNA sequence of C. flavescens (Table 1, sample 16) was a better match to the C. variabilis GB AJ222815 (98% identical) sequence than to that of C. flavescens GB X84441 (93% identical), and the 16S RNA sequence of C. pseudodiphtheriticum (Table 1, sample 33) was a better match to the C. pseudotuberculosis GB X84255 (97% identical) than that of C. pseudodiphtheriticum GB X81918 (92% identical). Overall, the species designation assigned to 7 of the 43 isolates on the basis of phenotypic properties could not be confirmed by the corresponding 16S RNA sequences. This was not surprising, since previous work has indicated that the sequence of the 16S RNA gene provides genus level identification but is less reliable for species level identification of coryneform bacteria (55). In addition, classification of coryneform bacteria is based primarily on complex biochemical reactions, making them notoriously difficult to type definitively (15). Significantly, the 16S RNA sequences supported assignment to the genus Corynebacterium for all of the isolates and demonstrated that it was very unlikely that we had contaminated our samples with noncoryneform bacterial DNA or C. diphtheriae DNA.

Western blots to detect a DtxR-like protein. To confirm the presence of DtxR-like regulators, we isolated whole-cell protein from all of the corynebacterial isolates listed in Table 1 and tested them in Western blots with two different polyclonal antisera. The first antiserum was generated against a DtxR-maltose-binding protein fusion ({alpha}DtxRMBP), and the second antiserum was generated against a two-domain variant of DtxR ({alpha}DtxR144) truncated after amino acid 144. We did not detect DtxR-like proteins that reacted with the {alpha}DtxRMBP antiserum in any species tested other than C. diphtheriae (data not shown). Analysis with truncated forms of DtxR from C. diphtheriae indicated that reactivity of the {alpha}DtxRMBP antiserum in Western blots requires the presence of the third domain ofDtxR (data not shown). The amino acid sequence of the third domain of DtxR is not as conserved as the sequence of the first two domains and variability of the third domain most likely explains the inability of {alpha}DtxRMBP to detect DtxR-like proteins from species of corynebacteria other than C. diphtheriae. In striking contrast, we were able to detect a cross-reacting protein in most of the samples when we used the {alpha}DtxR144 antiserum that was raised against the highly conserved domains 1 and 2 of a two-domain DtxR variant. A representative blot is shown in Fig. 3A. Protein isolated from C. diphtheriae (Table 1, sample 15) was used as a positive control (Fig. 3A, lane 9). The {alpha}DtxR144 antiserum did not react with any proteins in extracts from DH5{alpha} at the dilution (1/5,000) used in the Western blots (data not shown). We did not detect a reactive protein in three isolates, C. afermentans (l) (Table 1, sample 5), C. amycolatum (Table 1, sample 6), and C. mycetoides (Table 1, sample 29). It is possible that we did not detect any reactive protein in some samples because the protein sample itself was degraded or impure. This seems likely since all three of the nonreactive extracts appeared partially degraded on Coomassie blue-stained gels (data not shown). In addition, it is possible that some corynebacterial isolates produce a DtxR-like protein that does not react with either of our antisera. The size of some reactive proteins varied very slightly (<10%) in apparent mass on an SDS-polyacrylamide gel and appeared to be slightly larger than DtxR (Fig. 3A, lane 2, and Table 1, column 6 [+L]). In addition, a larger faintly reactive band was identified in some species (Fig. 3A, lanes 2, 3, 4, 5, and 6), and we believe this is likely to be a protein other than DtxR that reacts weakly with our antiserum. Finally, in C. mucofaciens Table 1, samples 27 and 28, a faintly hybridizing band of the expected size for DtxR was observed (Fig. 3A, lane 8).



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 3. Western blots to detect DtxR and DtxR-like proteins. (A) Detection of DtxR-like proteins in corynebacterial species. Whole-cell protein extracts were run on a 13.5% acrylamide-SDS gel, transferred to nitrocellulose, and probed with an {alpha}DtxR144 antiserum. Extracts are from the isolates indicated in Table 1: lane 1, C. amycolatum (sample 6); lane 2, C. urealyticum (sample 39); lane 3, C. afermentans subsp. lipophilium (sample 5); lane 4, C. afermentans (sample 4); lane 5, C. coyleae (sample 12); lane 6, C. coyleae (sample 13); lane 7, C. lipophiloflavum (sample 23); lane 8, C. mucofaciens (sample 28); and lane 9, C. diphtheriae (sample 15). The sizes of molecular mass markers are indicated on the left of the gel in kilodaltons. Note that a long exposure is shown to emphasize the weakly hybridizing band in lane 8. (B) Amount of DtxR in C. diphtheriae. Whole-cell protein extracts isolated from C. diphtheriae and purified DtxR were subjected to SDS-13.5% PAGE, transferred to nitrocellulose, and probed with an {alpha}DtxR144 antiserum. The gels were loaded as follows; 8, 6, 4, and 2 µl of extract from ATCC 700941 in lanes 1 to 4; 8, 6, 4, and 2 µl of extract from C7(ß) in lanes 5 to 8; and 10, 5, 2, and 1 ng of purified DtxR in lanes 9 to 12. The sizes of molecular mass markers are indicated on the left of the gel in kilodaltons.

 
Amount of DtxR of in C. diphtheriae. Next, we determined the sensitivity of the Western blot assay for detection of DtxR and the amount of immunoreactive DtxR present in C. diphtheriae. Recombinant DtxR encoded by the dtxR allele from C. diphtheriae C7(ß) was overexpressed in and purified from E. coli (50), and standardized amounts were run a 13.5% polyacrylamide gel (Fig. 3B, lanes 9 to 12). In this Western blot, the smallest amount of DtxR we detected with the {alpha}DtxR144 antiserum was 2 ng. Dilutions of whole-cell protein extracts from both C7(ß) (Fig. 3B, lanes 5 to 8), and the strain of C. diphtheriae whose genome sequence was determined at the Wellcome Trust Sanger Institute, ATCC 700971 (Fig. 3B, lanes 1 to 4) were also run on the same polyacrylamide gel. We determined the total number of viable C. diphtheriae cells used to generate the protein extracts and the number of unlysed viable C. diphtheriae cells present in the insoluble portions of the cell extracts. By subtracting the unlysed cells from the total number of cells we determined that the net cells used to make each 1.3 ml of protein extract was 1010. Next, we used the Western blot shown in Fig. 3B to estimate that 4 µl of extract contained 2 ng of DtxR. We determined the total protein concentration of each extract to be 3 µg per µl so DtxR makes up 0.017% of the total cell protein. Finally, we used the molecular mass of a monomer of DtxR (25.3 kDa) to calculate the number of DtxR dimer molecules per cell as ca. 750 in both C7(ß) and 700971.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our analysis provides evidence that each of the Corynebacterial isolates in Table 1 includes an iron-dependent member of the DtxR-like regulator family with highly conserved amino acid sequences in both the metal-binding and the DNA-binding regions (Fig. 2). DtxR-like proteins control gene expression in response to the availability of either manganese or iron. There is convincing evidence that iron-responsive members of this regulator family respond exclusively to iron under physiological conditions in vivo (10, 20, 35, 52), and evidence is growing for a comparable degree of metal selectivity in the manganese-responsive members of this regulator family (16, 39, 47).

The first structure of DtxR was published in 1995 (41) and was followed by many additional structures of both DtxR and another metal-dependent regulator in the DtxR family, Mycobacterium tuberculosis IdeR (for a review, see reference 11). Metal binding site 1 consists of residues H79, E83, and H98 from domain 2 and E170 and Q173 from domain 3, and the three residues from domain 2 are present in all of the predicted protein sequences that we determined (Fig. 2). Only one of the residues, C102, that make up metal binding site 2 of DtxR was included in the region we sequenced, and C102 is also conserved in all of the predicted DtxR-like proteins that we determined. C102 is one of the amino acids identified as being important in determining the metal specificity of regulators in the DtxR family, and a C at this position is indicative of a regulator that responds to Fe2+ (16). These corynebacterial DtxR-like proteins also show much higher overall homology to the Fe2+-responsive members of the DtxR-like regulator family than they do to those that respond to Mn2+. Over the 91 amino acids shown in Fig. 2, the DtxR-like proteins have averages of 77% identity and 86% similarity with M. tuberculosis IdeR. which responds to iron, but <40% similarity with C. diphtheriae MntR, Bacillus subtilis MntR, and Treponema pallidum TroR, all of which respond to manganese.

Crystal structures of DtxR with DNA sequences containing the DtxR operator have defined specific interactions between DtxR and the DNA duplex (38, 63). When complexed with DNA two DtxR dimers bind on opposite faces of the DNA, shifted by five bases with respect to one another. Amino acids A28 and S37, whose main chain NH groups make contacts to the DNA backbone, were conserved in our sequences (Fig. 2). Amino acids T7, R27, R29, Q36, T40, S42, R47, and R50 have side chains that make contacts with the phosphate backbone of the DNA. Among them, T7 was not included in our sequences; R27, R29, T40, R47, and R50 were conserved in all our sequences, and a conservative substitution for Q36 or S42 was found in only one sequence for each residue. The side chains of S37 and P39 interact with the methyl groups of specific thymine bases in the DtxR operator (8). S37 is found in all but one, and P39 is found in all of the sequences (Fig. 2). Q43 is the only residue that is predicted to make direct hydrogen-bonding interactions with a nucleotide base in the operator (38), and it is found in all of the predicted protein sequences (Fig. 2). These observations suggest that the proteins we identified bind DNA operators homologous to the DtxR operator site. Similarly, other members of the DtxR-like family that respond to iron, Mycobacterium IdeR, Brevibacterium DtxR, and Rhodococcus IdeR bind the DtxR operator (3, 33, 51).

We determined the number of DtxR dimer molecules per cell of C. diphtheriae, after overnight growth (stationary phase), to be ~750. Similar measurements have been made for other bacterial transcriptional regulators. Highly expressed transcriptional repressors, including Lrp and OmpR in E. coli and Fur in V. cholerae, were calculated to be present at ca. 6,000, 3,500, and 2,500 molecules per cell, respectively (6, 61, 65). The concentration of NRI was estimated to be present at 5 to 70 molecules per cell (43), and the trp repressor was estimated to be present at 50 to 300 molecules per cell (23). DtxR, therefore, appears to fall near the middle of the range of abundance for transcriptional repressors.

The high conservation of the DNA and protein sequences shown in Fig. 2 and 3 suggests that the sequences of dtxR-like genes in these strains may serve as useful phylogenetic markers, complementing the 16S RNA sequences currently used to determine organismal phylogeny. Using the neighbor-joining method included in CLUSTAL, we calculated phylogenetic trees based on the 16S RNA and dtxR-like gene sequences for each of the isolates listed in Table 1 (Fig. 4). In addition, we included sequences equivalent to the regions that we determined in the corynebacterial isolates from the published sequences of iron-dependent dtxR-like and 16S RNA genes from M. tuberculosis, M. smegmatis, M. leprae, Rhodococcus equi, and Streptomyces lividans. Finally, as an out-group we included sequences from the same regions of troR, which encodes a manganese-dependent DtxR-like protein, and the 16S RNA gene in T. pallidum.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 4. Phylogenetic trees based on dtxR-like genes and 16S RNA genes. The sequence of 275 bp of each dtxR-like gene was used to calculate the tree on the left and ~1,025 bp of each 16S RNA gene was used to calculate the tree on the right by using the neighbor-joining method in CLUSTAL W (see Materials and Methods). The numbers to the left of each node are the bootstrap values from 1,000 repetitions. The scale is indicated at the top right of each tree. Sequences from T. pallidum were used as outgroups in calculating the trees.

 
Overall, the grouping and clades of the two trees (dtxR-based and 16S-based) are similar, but there are some interesting differences. The dtxR-like gene sequences from C. pseudotuberculosis (Table 1, sample 35) and C. renale (Table 1, sample 36) are found on a branch with the M. tuberculosis ideR sequence. This grouping has high bootstrap values, indicating that these two corynebacterial isolates contain dtxR-like genes more similar to Mycobacterium ideR genes than to those other corynebacterial species. In contrast, when the 16S RNA gene sequences were used to construct the tree C. pseudotuberculosis (Table 1, sample 35) clustered with the other C. pseudotuberculosis isolate (Table 1, sample 34), as well as C. pseudodiphtheriticum (Table 1, sample 32), whereas C. renale (Table 1, sample 36) clustered with C. cystitidis (Table 1, sample 14), as expected from previously published trees (36, 54). Another interesting difference between the two trees can be seen in the C. glutamicum isolates (Table 1, samples 18 and 19). On the 16S RNA gene tree the two C. glutamicum isolates cluster closely together in a group whose closest other branch contains C. xerosis and C. amycolatum. Based on the sequence of their dtxR-like genes, the two isolates of C. glutamicum are located on different branches of the tree. The bootstrap values for the dtxR-like gene tree are not as high as those for the 16S RNA tree, but the values still suggest that the differences between the two trees are significant in many places, including the dissimilarity in the placement of the C. glutamicum isolates. The relevance of the differences between the two phylogenetic trees in determining the evolution of these bacterial species, as well as the evolution and function of metal-dependent regulators in the DtxR-like family, is difficult to determine, since the dtxR-like gene sequences we determined are only 275 bp long, introducing more error into the construction of an accurate phylogenetic tree. Still, it is tempting to theorize that dtxR-like genes may have been transferred horizontally to or from some corynebacteria from or to some other bacterial genera, resulting in a dtxR-based gene phylogeny that differs somewhat from the 16S RNA gene phylogeny. It is also possible that the dtxR-like genes we identified have varied roles in different bacterial species, resulting in diversity within the dtxR gene family that is indicative of selection for differing functions.

The corynebacterial isolates listed in Table 1 encompass several lifestyles, including species considered animal and human pathogens, those thought of as human commensals that occasionally cause disease, and those that are saprophytic and rarely if ever cause human or animal disease. The extremely high level of conservation observed in the region of the dtxR-like genes that we amplified from the chromosome of these phenotypically diverse species suggests that the iron-dependent gene regulators encoded by these genes are under strong selective constraints. In M. tuberculosis IdeR is essential for growth (44), and in C. diphtheriae a mutant that does not produce any DtxR is much more sensitive to oxidative stress and high-iron conditions than its wild-type parent (34). Taken together, the data indicate that DtxR-like iron-dependent proteins are essential for normal growth of the bacteria that express them. Iron-dependent regulators of the DtxR-like family are not unique to bacterial species that cause human or animal disease, however, and their emergence during evolution is likely to predate the development of pathogenicity among corynebacterial species.


    ACKNOWLEDGMENTS
 
We thank Marie B. Coyle for providing most of the isolates used in this study, Amy Dolinger for technical support, Norman R. Pace and J. Kirk Harris for advice on phylogenetic analysis, and Mark Oram for critical reading of the manuscript.

This study was supported in part by grant number AI 14107 from the National Institute of Allergy and Infectious Diseases, National Institutes of Health. The University of Colorado Cancer Center DNA Sequencing and Analysis Core Facility, Denver, is supported by NIH/NCI cancer support grant CA 46934.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, B-175, University of Colorado Health Sciences Center, 4200 East Ninth Ave., Denver, CO 80262. Phone: (303) 315-7903. Fax: (303) 315-6785. E-mail: randall.holmes{at}uchsc.edu. Back

Editor: J. T. Barbieri


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Barksdale, L. 1970. Corynebacterium diphtheriae and its relatives. Bacteriol. Rev. 4:378-422.
2. Billington, S. J., P. A. Esmay, J. G. Songer, and B. H. Jost. 2002. Identification and role in virulence of putative iron acquisition genes from Corynebacterium pseudotuberculosis. FEMS Microbiol. Lett. 208:41-45.[CrossRef][Medline]
3. Boland, C. A., and W. G. Meijer. 2000. The iron-dependent regulatory protein IdeR (DtxR) of Rhodococcus equi. Microbiol. FEMS Lett. 191:1-5.[CrossRef][Medline]
4. Boyd, J., M. N. Oza, and J. R. Murphy. 1990. Molecular cloning and DNA sequence analysis of a diphtheria tox iron-dependent regulatory element (dtxR) from Corynebacterium diphtheriae. Proc. Natl. Acad. Sci. USA 87:5968-5972.[Abstract/Free Full Text]
5. Bult, C. J., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. Geoghagen, and J. C. Venter. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058-1073.[Abstract]
6. Cai, S. J., and M. Inouye. 2002. EnvZ-OmpR interaction and osmoregulation in Escherichia coli. J. Biol. Chem. 277:24155-24161.[Abstract/Free Full Text]
7. Cerdeno-Tarraga, A. M., A. Efstratiou, L. G. Dover, M. T. Holden, M. Pallen, S. D. Bentley, G. S. Besra, C. Churcher, K. D. James, A. De Zoysa, T. Chillingworth, A. Cronin, L. Dowd, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Moule, M. A. Quail, E. Rabbinowitsch, K. M. Rutherford, N. R. Thomson, L. Unwin, S. Whitehead, B. G. Barrell, and J. Parkhill. 2003. The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129. Nucleic Acids Res. 31:6516-6523.[Abstract/Free Full Text]
8. Chen, C. S., A. White, J. Love, J. R. Murphy, and D. Ringe. 2000. Methyl groups of thymine bases are important for nucleic acid recognition by DtxR. Biochemistry 39:10397-10407.[CrossRef][Medline]
9. Doukhan, L., M. Predich, G. Nair, O. Dussurget, I. Mandic-Mulec, S. T. Cole, D. R. Smith, and I. Smith. 1995. Genomic organization of the mycobacterial sigma gene cluster. Gene 165:67-70.[CrossRef][Medline]
10. Dussurget, O., J. Timm, M. Gomez, B. Gold, S. Yu, S. Z. Sabol, R. K. Holmes, W. R. Jacobs, and I. Smith. 1999. Transcriptional control of the iron-responsive fxbA gene by the Mycobacterial regulator IdeR. J. Bacteriol. 181:3402-3408.[Abstract/Free Full Text]
11. Feese, M. D., E. Pohl, R. K. Holmes, and W. G. Hol. 2001. Iron-dependent regulators, p. 850-863. In K. Wieghardt (ed.), Handbook of metalloproteins. John Wiley & Sons, Ltd., Chichester, United Kingdom.
12. Finkelstein, R. A., P. Z. Sobocinski, P. Atthasampunna, and P. Charunmethee. 1966. Pathogenesis of experimental cholera: identification of choleragen (procholeragen A) by disc immunoelectrophoresis and its differentiation from cholera mucinase. J. Immunol. 97:25-33.[Abstract/Free Full Text]
13. Freeman, V. J. 1951. Studies on the virulence of bacteriophage-infected strains of Corynebacterium diphtheriae. J. Bacteriol. 61:675-688.[Free Full Text]
14. Funke, G., and K. A. Bernard. 2003. Coryneform gram-positive rods, p. 472-501. In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, and R. H. Yolken (ed.), Manual of clinical microbiology, 8th ed., vol. 1. ASM Press, Washington, D.C.
15. Funke, G., A. von Graevenitz, J. E. Clarridge III, and K. A. Bernard. 1997. Clinical microbiology of coryneform bacteria. Clin. Microbiol. Rev. 10:125-159.[Abstract]
16. Guedon, E., and J. D. Helmann. 2003. Origins of metal ion selectivity in the DtxR/MntR family of metalloregulators. Mol. Microbiol. 48:495-506.[CrossRef][Medline]
17. Gunter-Seeboth, K., and T. Schupp. 1995. Cloning and sequence analysis of the Corynebacterium diphtheriae dtxR homologue from Streptomyces lividans and S. pilosus encoding a putative iron repressor protein. Gene 166:117-119.[CrossRef][Medline]
18. Hardham, J. M., L. V. Stamm, S. F. Porcella, J. G. Frye, N. Y. Barnes, J. K. Howell, S. L. Mueller, J. D. Radolf, G. M. Weinstock, and S. J. Norris. 1997. Identification and transcriptional analysis of a Treponema pallidum operon encoding a putative ABC transport system, an iron-activated repressor protein homolog, and a glycolytic pathway enzyme homolog. Gene 197:47-64.[CrossRef][Medline]
19. Heidelberg, J. F., J. A. Eisen, W. C. Nelson, R. A. Clayton, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, L. Umayam, S. R. Gill, K. E. Nelson, T. D. Read, H. Tettelin, D. Richardson, M. D. Ermolaeva, J. Vamathevan, S. Bass, H. Qin, I. Dragoi, P. Sellers, L. McDonald, T. Utterback, R. D. Fleishmann, W. C. Nierman, and O. White. 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:477-483.[CrossRef][Medline]
20. Hill, P. J., A. Cockayne, P. Landers, J. A. Morrissey, C. M. Sims, and P. Williams. 1998. SirR, a novel iron-dependent repressor in Staphylococcus epidermidis. Infect. Immun. 66:4123-4129.[Abstract/Free Full Text]
21. Holmes, R. K., and E. M. Twiddy. 1983. Characterization of monoclonal antibodies that react with unique and cross-reacting determinants of cholera enterotoxin and its subunits. Infect. Immun. 42:914-923.[Abstract/Free Full Text]
22. Jakubovics, N. S., A. W. Smith, and H. F. Jenkinson. 2000. Expression of the virulence-related Sca (Mn2+) permease in Streptococcus gordonii is regulated by a diphtheria toxin metallorepressor-like protein ScaR. Mol. Microbiol. 38:140-153.[CrossRef][Medline]
23. Kelley, R. L., and C. Yanofsky. 1982. trp, aporepressor production is controlled by autogenous regulation and inefficient translation. Proc. Natl. Acad. Sci. USA 79:3120-3124.[Abstract/Free Full Text]
24. Kitten, T., C. L. Munro, S. M. Michalek, and F. L. Macrina. 2000. Genetic characterization of a Streptococcus mutans LraI family operon and role in virulence. Infect. Immun. 68:4441-4451.[Abstract/Free Full Text]
25. Klenk, H. P., R. A. Clayton, J. F. Tomb, O. White, K. E. Nelson, K. A. Ketchum, R. J. Dodson, M. Gwinn, E. K. Hickey, J. D. Peterson, D. L. Richardson, A. R. Kerlavage, D. E. Graham, N. C. Kyrpides, R. D. Fleischmann, J. Quackenbush, N. H. Lee, G. G. Sutton, S. Gill, E. F. Kirkness, B. A. Dougherty, K. McKenney, M. D. Adams, B. Loftus, J. C. Venter, et al. 1997. The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Nature 390:364-370.[CrossRef][Medline]
26. Lecompte, O., R. Ripp, V. Puzos-Barbe, S. Duprat, R. Heilig, J. Dietrich, J. C. Thierry, and O. Poch. 2001. Genome evolution at the genus level: comparison of three complete genomes of hyperthermophilic archaea. Genome Res. 11:981-993.[Abstract/Free Full Text]
27. Lee, J. H., T. Wang, K. Ault, J. Liu, M. P. Schmitt, and R. K. Holmes. 1997. Identification and characterization of three new promoter/operators from Corynebacterium diphtheriae that are regulated by the diphtheria toxin repressor (DtxR) and iron. Infect. Immun. 65:4273-4280.[Abstract]
28. Liebl, W. 1991. The genus Corynebacterium - nonmedical, p. 1157-1171. In A. Balows, H. G. Truper, M. Dworkin, W. Harder, and K. H. Schleifer (ed.), The prokaryotes, 2nd ed. Springer-Verlag, New York, N.Y.
29. Maximescu, P., A. Pop, A. Oprisan, and E. Potorac. 1974. Diphtheria tox+ gene expressed in Corynebacterium species other than C. diphtheriae. J. Hyg. Epidemiol. Microbiol. Immunol. 18:324-326.[Medline]
30. Nelson, K. E., R. A. Clayton, S. R. Gill, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, W. C. Nelson, K. A. Ketchum, L. McDonald, T. R. Utterback, J. A. Malek, K. D. Linher, M. M. Garrett, A. M. Stewart, M. D. Cotton, M. S. Pratt, C. A. Phillips, D. Richardson, J. Heidelberg, G. G. Sutton, R. D. Fleischmann, J. A. Eisen, C. M. Fraser, et al. 1999. Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature 399:323-329.[CrossRef][Medline]
31. Nicholas, K. B., and H. B. J. Nicholas. 1997. GeneDoc: analysis and visualization of genetic variation. EMBNEW.NEWS 4:14. [Online.] http://www.psc.edu/biomed/genedoc/.
32. Nishio, Y., Y. Nakamura, Y. Kawarabayasi, Y. Usuda, E. Kimura, S. Sugimoto, K. Matsui, A. Yamagishi, H. Kikuchi, K. Ikeo, and T. Gojobori. 2003. Comparative complete genome sequence analysis of the amino acid replacements responsible for the thermostability of Corynebacterium efficiens. Genome Res. 13:1572-1579.[Abstract/Free Full Text]
33. Oguiza, J. A., X. Tao, A. T. Marcos, J. F. Martin, and J. R. Murphy. 1995. Molecular cloning, DNA sequence analysis, and characterization of the Corynebacterium diphtheriae dtxR homolog from Brevibacterium lactofermentum. J. Bacteriol. 177:465-467.[Abstract/Free Full Text]
34. Oram, D. M., A. Avdalovic, and R. K. Holmes. 2002. Construction and characterization of transposon insertion mutations in Corynebacterium diphtheriae that affect expression of the diphtheria toxin repressor (DtxR). J. Bacteriol. 184:5723-5732.[Abstract/Free Full Text]
35. Pappenheimer, J. S., Jr. 1936. Studies on diphtheria toxin production. I. The effect of iron and copper. Br. J. Exp. Pathol. 17:335-341.
36. Pascual, C., P. A. Lawson, J. A. Farrow, M. N. Gimenez, and M. D. Collins. 1995. Phylogenetic analysis of the genus Corynebacterium based on 16S rRNA gene sequences. Int. J. Syst. Bacteriol. 45:724-728.[Abstract/Free Full Text]
37. Patzer, S. I., and K. Hantke. 2001. Dual repression by Fe2+-Fur and Mn2+-MntR of the mntH gene, encoding an NRAMP-like Mn2+ transporter in Escherichia coli. J. Bacteriol. 183:4806-4813.[Abstract/Free Full Text]
38. Pohl, E., R. K. Holmes, and W. G. Hol. 1999. Crystal structure of a cobalt-activated diphtheria toxin repressor-DNA complex reveals a metal-binding SH3-like domain. J. Mol. Biol. 292:653-667.[CrossRef][Medline]
39. Posey, J. E., J. M. Hardham, S. J. Norris, and F. C. Gherardini. 1999. Characterization of a manganese-dependent regulatory protein, TroR, from Treponema pallidum. Proc. Natl. Acad. Sci. USA 96:10887-10892.[Abstract/Free Full Text]
40. Qiu, X., E. Pohl, R. K. Holmes, and W. G. Hol. 1996. High-resolution structure of the diphtheria toxin repressor complexed with cobalt and manganese reveals an SH3-like third domain and suggests a possible role of phosphate as co-corepressor. Biochemistry 35:12292-12302.[CrossRef][Medline]
41. Qiu, X., C. L. Verlinde, S. Zhang, M. P. Schmitt, R. K. Holmes, and W. G. Hol. 1995. Three-dimensional structure of the diphtheria toxin repressor in complex with divalent cation co-repressors. Structure 3:87-100.[Medline]
42. Que, Q., and J. D. Helmann. 2000. Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol. Microbiol. 35:1454-1468.[CrossRef][Medline]
43. Reitzer, L. J., and B. Magasanik. 1983. Isolation of the nitrogen assimilation regulator NRI, the product of the glnG gene of Escherichia coli. Proc. Natl. Acad. Sci. USA 80:5554-5558.[Abstract/Free Full Text]
44. Rodriguez, G. M., M. I. Voskuil, B. Gold, G. K. Schoolnik, and I. Smith. 2002. ideR, An essential gene in Mycobacterium tuberculosis: role of IdeR in iron-dependent gene expression, iron metabolism, and oxidative stress response. Infect. Immun. 70:3371-3381.[Abstract/Free Full Text]
45. Rogosa, M., C. S. Cummins, R. A. Lelliott, and R. M. Keddie. 1974. Coryneform group of bacteria, p. 599-632. In R. E. Buchanan and N. E. Gibbons (ed.), Bergey's manual of determinative bacteriology, 8th ed. The Williams & Wilkins Co., Baltimore, Md.
46. Schiering, N., X. Tao, H. Zeng, J. R. Murphy, G. A. Petsko, and D. Ringe. 1995. Structures of the apo- and the metal ion-activated forms of the diphtheria tox repressor from Corynebacterium diphtheriae. Proc. Natl. Acad. Sci. USA 92:9843-9850.[Abstract/Free Full Text]
47. Schmitt, M. P. 2002. Analysis of a DtxR-like metalloregulatory protein, MntR, from Corynebacterium diphtheriae that controls expression of an ABC metal transporter by an Mn2+-dependent mechanism. J. Bacteriol. 184:6882-6892.[Abstract/Free Full Text]
48. Schmitt, M. P., and R. K. Holmes. 1991. Characterization of a defective diphtheria toxin repressor (dtxR) allele and analysis of dtxR transcription in wild-type and mutant strains of Corynebacterium diphtheriae. Infect. Immun. 59:3903-3908.[Abstract/Free Full Text]
49. Schmitt, M. P., and R. K. Holmes. 1994. Cloning, sequence, and footprint analysis of two promoter/operators from Corynebacterium diphtheriae that are regulated by the diphtheria toxin repressor (DtxR) and iron. J. Bacteriol. 176:1141-1149.[Abstract/Free Full Text]
50. Schmitt, M. P., and R. K. Holmes. 1991. Iron-dependent regulation of diphtheria toxin and siderophore expression by the cloned Corynebacterium diphtheriae repressor gene dtxR in C. diphtheriae C7 strains. Infect. Immun. 59:1899-1904.[Abstract/Free Full Text]
51. Schmitt, M. P., M. Predich, L. Doukhan, I. Smith, and R. K. Holmes. 1995. Characterization of an iron-dependent regulatory protein (IdeR) of Mycobacterium tuberculosis as a functional homolog of the diphtheria toxin repressor (DtxR) from Corynebacterium diphtheriae. Infect. Immun. 63:4284-4289.[Abstract]
52. Schmitt, M. P., E. M. Twiddy, and R. K. Holmes. 1992. Purification and characterization of the diphtheria toxin repressor. Proc. Natl. Acad. Sci. USA 89:7576-7580.[Abstract/Free Full Text]
53. Smith, D. R., L. A. Doucette-Stamm, C. Deloughery, H. Lee, J. Dubois, T. Aldredge, R. Bashirzadeh, D. Blakely, R. Cook, K. Gilbert, D. Harrison, L. Hoang, P. Keagle, W. Lumm, B. Pothier, D. Qiu, R. Spadafora, R. Vicaire, Y. Wang, J. Wierzbowski, R. Gibson, N. Jiwani, A. Caruso, D. Bush, J. N. Reeve, et al. 1997. Complete genome sequence of Methanobacterium thermoautotrophicum {delta}H: functional analysis and comparative genomics. J. Bacteriol. 179:7135-7155.[Abstract/Free Full Text]
54. Suzuki, K. I., M. Suzuki, J. Sasaki, Y. H. Park, and K. K. Komagata. 1999. Leifsonia gen. nov., a genus for 2,4-diaminobutyric acid-containing actinomycetes to accommodate "Corynebacterium aquaticum" Leifson 1962 and Clavibacter xyli subsp. cynodontis Davis et al. 1984. J. Gen. Appl. Microbiol. 45:253-262.
55. Tang, Y. W., A. Von Graevenitz, M. G. Waddington, M. K. Hopkins, D. H. Smith, H. Li, C. P. Kolbert, S. O. Montgomery, and D. H. Persing. 2000. Identification of coryneform bacterial isolates by ribosomal DNA sequence analysis. J. Clin. Microbiol. 38:1676-1678.[Abstract/Free Full Text]
56. Tauch, A., I. Homann, S. Mormann, S. Ruberg, A. Billault, B. Bathe, S. Brand, O. Brockmann-Gretza, C. Ruckert, N. Schischka, C. Wrenger, J. Hoheisel, B. Mockel, K. Huthmacher, W. Pfefferle, A. Puhler, and J. Kalinowski. 2002. Strategy to sequence the genome of Corynebacterium glutamicum ATCC 13032: use of a cosmid and a bacterial artificial chromosome library. J. Biotechnol. 95:25-38.[CrossRef][Medline]
57. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.[Abstract/Free Full Text]
58. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
59. Uchida, T., D. M. Gill, and A. M. Pappenheimer, Jr. 1971. Mutation in the structural gene for diphtheria toxin carried by temperate phage. Nat. New Biol. 233:8-11.[CrossRef][Medline]
60. Von Graevenitz, A., and T. Krech. 1991. The genus Corynebacterium-medical, p. 1172-1187. In A. Balows, H. G. Truper, M. Dworkin, W. Harder, and K. H. Schleifer (ed.), The prokaryotes, 2nd ed. Springer-Verlag, New York, N.Y.
61. Watnick, P. I., T. Eto, H. Takahashi, and S. B. Calderwood. 1997. Purification of Vibrio cholerae Fur and estimation of its intracellular abundance by antibody sandwich enzyme-linked immunosorbent assay. J. Bacteriol. 179:243-247.[Abstract/Free Full Text]
62. Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697-703.[Abstract/Free Full Text]
63. White, A., X. Ding, J. C. vanderSpek, J. R. Murphy, and D. Ringe. 1998. Structure of the metal-ion-activated diphtheria toxin repressor/tox operator complex. Nature 394:502-506.[CrossRef][Medline]
64. White, O., J. A. Eisen, J. F. Heidelberg, E. K. Hickey, J. D. Peterson, R. J. Dodson, D. H. Haft, M. L. Gwinn, W. C. Nelson, D. L. Richardson, K. S. Moffat, H. Qin, L. Jiang, W. Pamphile, M. Crosby, M. Shen, J. J. Vamathevan, P. Lam, L. McDonald, T. Utterback, C. Zalewski, K. S. Makarova, L. Aravind, M. J. Daly, C. M. Fraser, et al. 1999. Genome sequence of the radioresistant bacterium Deinococcus radiodurans R1. Science 286:1571-1577.[Abstract/Free Full Text]
65. Willins, D. A., C. W. Ryan, J. V. Platko, and J. M. Calvo. 1991. Characterization of Lrp, an Escherichia coli regulatory protein that mediates a global response to leucine. J. Biol. Chem. 266:10768-10774.[Abstract/Free Full Text]


Infection and Immunity, April 2004, p. 1885-1895, Vol. 72, No. 4
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.4.1885-1895.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oram, D. M.
Right arrow Articles by Holmes, R. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oram, D. M.
Right arrow Articles by Holmes, R. K.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]