This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bungiro, R. D.
Right arrow Articles by Cappello, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bungiro, R. D., Jr.
Right arrow Articles by Cappello, M.

 Previous Article  |  Next Article 

Infection and Immunity, April 2004, p. 2203-2213, Vol. 72, No. 4
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.4.2203-2213.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Purification and Molecular Cloning of and Immunization with Ancylostoma ceylanicum Excretory-Secretory Protein 2, an Immunoreactive Protein Produced by Adult Hookworms

Richard D. Bungiro Jr.,* Carolina V. Solis, Lisa M. Harrison, and Michael Cappello

Child Health Research Center, Departments of Pediatrics and Epidemiology & Public Health, Yale University School of Medicine, New Haven, Connecticut 06520-8081

Received 26 November 2003/ Returned for modification 15 December 2003/ Accepted 24 December 2003


arrow
ABSTRACT
 
Hookworms remain major agents of global morbidity, and vaccination against these bloodfeeding parasites may be an attractive complement to conventional control methods. Here we describe the cloning of Ancylostoma ceylanicum excretory-secretory protein 2 (AceES-2), a novel immunoreactive protein produced by adult worms. Native AceES-2 was purified from excretory-secretory (ES) products by reverse-phase high-pressure liquid chromatography, subjected to amino-terminal sequencing, and cloned from adult worm RNA by using reverse transcription-PCR. The translated AceES-2 cDNA predicts that the mature protein consists of 102 amino acids and has a molecular mass of 11.66 kDa. Western immunoblot and enzyme-linked immunosorbent assay analyses demonstrated that recombinant AceES-2 (rAceES-2) reacted strongly with antibodies from A. ceylanicum-infected hamsters. Immunization of hamsters with native ES products adsorbed to alum induced antibodies that recognized rAceES-2, while rAceES-2-alum vaccination resulted in antibodies that reacted with a single protein band in ES products that closely approximated the size predicted for the native molecule. Infected hamsters that were passively immunized with hyperimmune rabbit anti-rAceES-2 serum exhibited more rapid and complete recovery from anemia than controls that received normal serum. Oral immunization with rAceES-2 was associated with significantly reduced anemia upon challenge, an outcome similar to the outcome observed in hamsters that were orally vaccinated with soluble hookworm extract (the latter animals were also resistant to weight loss). These data suggest that AceES-2 plays an important role in the host-parasite interaction and that vaccination against this protein may represent a useful strategy for controlling hookworm anemia.


arrow
INTRODUCTION
 
As was true at the turn of the previous century, hundreds of millions of persons worldwide continue to suffer from disease caused by hookworms (3, 21, 23). Humans are permissive hosts for three hookworm species: Necator americanus, Ancylostoma duodenale, and Ancylostoma ceylanicum (28, 35). These bloodfeeding parasites are a major cause of iron deficiency anemia and rank among the foremost agents of global morbidity (67), extorting a particularly heavy pathological price from children and pregnant women (24, 55, 56, 58, 60, 66). Furthermore, hookworm infection may enhance susceptibility to and exacerbate the clinical sequelae of other infectious diseases, such as tuberculosis and human immunodeficiency virus (8, 9). Although effective chemotherapeutic agents against hookworm are available (1), rapid reinfection (2, 53) and drug resistance (26, 54) may complicate conventional control strategies. Consequently, novel approaches to contain hookworm disease, such as vaccines, may provide a welcome adjunct to currently available options. Currently, there is much interest in identifying candidate hookworm antigens that may be employed as vaccine molecules (16, 36).

Upon attachment to the host intestine, adult hookworms secrete numerous proteins that have been proposed to function as virulence factors (16). Hookworms have been known to produce inhibitors of thrombosis since the early 20th century (40), and in the past decade inhibitors of coagulation factor Xa (15, 17, 18), the VIIa/tissue factor complex (59), and platelet function (20, 27) have been isolated and cloned from the dog hookworm Ancylostoma caninum, a close relative of the anthrophilic species. Additional putative disease-promoting factors cloned from adult hookworms include cysteine proteases (33, 45), aspartic proteases (32, 65), and a metalloendopeptidase (37). Adult worms also produce molecules that may antagonize the function of host proteases, such as a Kunitz-type inhibitor with demonstrated activity against chymotrypsin, pancreatic elastase, neutrophil elastase, and trypsin (47), as well as a tissue inhibitor of metalloprotease (69). Furthermore, adult hookworms produce inhibitors of neutrophil function (48), a calreticulin-like molecule (51) that has been shown to inhibit the complement component C1q (38), a C-type lectin (41), and a protein that binds fatty acids and retinol (4). Although no definitive pathogenic role for any of these proteins has yet been established, it is likely that the adult parasite employs such secreted factors as part of an integrated strategy to facilitate bloodfeeding, digest blood and tissue, and prevent damage by host factors. As such, these probable virulence factors may provide attractive targets for vaccination strategies aimed at reducing hookworm disease (16).

The techniques that were employed to identify and clone the putative hookworm virulence factors described above include activity-based assays, screening of cDNA libraries with nucleotide probes corresponding to consensus sequences, immunoscreening of expression libraries, reverse transcription-PCR with consensus primers, and mining of expressed sequence tag (EST) databases for homologous sequences. An alternative method has recently been described (12), in which reverse-phase high-pressure liquid chromatography (rpHPLC) is used to separate excretory-secretory (ES) products into individual proteins and then amino-terminal sequencing is performed. This approach led to cloning of A. ceylanicum ES protein 1 (AceES-1), a novel 12.9-kDa protein. In this study, we used the rpHPLC-based method to clone a second novel A. ceylanicum ES protein, which we designated AceES-2. Based on the observation that recombinant AceES-2 (rAceES-2) is strongly recognized by antibodies from A. ceylanicum-infected hamsters, we hypothesized that native AceES-2 plays an important role in the host-parasite interaction and may thus be targeted as part of a strategy to mitigate hookworm disease. Accordingly, in this paper we describe studies designed to evaluate the protective efficacy of rAceES-2 by using subcutaneous vaccination, oral vaccination, and passive immunization.


arrow
MATERIALS AND METHODS
 
Hookworms and parasite antigen preparations. The A. ceylanicum life cycle was maintained as previously described (29). For recovery of adult worms 3- to 4-week-old male Syrian hamsters of the Lak:LVG(SYR)BR outbred strain were obtained from Charles River Laboratories and infected with 150 to 200 third-stage larvae (L3) by oral gavage. Upon development of adult worms (at least 21 days postinfection) the animals were euthanized, and parasites were manually harvested from the intestinal mucosa. Hookworms were rinsed with phosphate-buffered saline (PBS) and used to prepare soluble hookworm extract (HEX) and ES products. HEX was prepared by homogenizing parasites in 50 mM Tris-HCl (pH 7.5) with a glass homogenizer (15). The homogenates were briefly sonicated and then centrifuged for 30 min at 12,000 x g and 4°C. The supernatant (HEX) was removed, and its protein content was determined by using a bicinchoninic acid protein assay system (Pierce Chemical Co., Rockford, Ill.) with a bovine serum albumin standard curve. ES products were prepared by incubating live adult hookworms in sterile PBS (10 worms per ml) for 6 h at 37°C. The worms were removed, and the raw ES products were centrifuged at 3,300 x g for 15 min to remove particulates. The ES products were then concentrated by using a spin concentrator with a 5-kDa cutoff (Millipore Corp., Bedford, Mass.). The protein content of the concentrated ES products was determined as described above. HEX and ES product aliquots were stored at -80°C until they were used. The animal research protocols employed in this study were approved by the Yale University Animal Care and Use Committee and complied with all relevant federal guidelines.

rpHPLC, mass spectroscopy, and protein sequencing. ES products were applied to a C18 rpHPLC column (Grace Vydac, Hesperia, Calif.) and eluted with a linear acetonitrile gradient as previously described (12). The molecular mass of rpHPLC protein peak 15 was determined by the Keck Foundation Laboratory at Yale University by using matrix-assisted laser desorption ionization mass spectroscopy performed with a VG TOFspec SE instrument (64), and this was followed by NH2-terminal amino acid sequencing with an Applied Biosystems sequencer equipped with an on-line HPLC system (61). The sequence obtained was analyzed to determine its homology to other known proteins and EST sequences by using the BLAST algorithm available through the National Center for Biotechnology Information (NCBI) (www.ncbi.nlm.nih.gov/BLAST/) and the NemaBLAST algorithm available at Nematode.net (www.nematode.net/BLAST/).

Western immunoblotting. Approximately 10% of rpHPLC peak 15 was lyophilized, resuspended in 15 µl of Tricine sample buffer (Bio-Rad Laboratories, Hercules, Calif.), and subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) by using a 10% acrylamide Tricine-buffered gel. Unfractionated ES products and recombinant proteins were also subjected to SDS-PAGE. Proteins were blotted onto nitrocellulose membranes, and the membranes were blocked overnight at 4°C with 5% milk in PBS-0.05% Tween 20 (PBS-T). The membranes were probed at room temperature for 2 h with hamster serum diluted 1:1,000, and this was followed by 1 h of incubation at room temperature with horseradish peroxidase-conjugated goat anti-hamster immunoglobulin G (IgG) secondary antibody (MP Biomedicals, Inc., Irvine, Calif.) diluted 1:5,000. All sera and antibodies were diluted in 5% milk in PBS-T, and the blots were washed three times after each incubation step for 10 min with PBS-T. Bound horseradish peroxidase-conjugated antibodies were detected by addition of West-Pico chemiluminescent substrate (Pierce Biotechnology, Inc., Rockford, Ill.). Chemiluminescence was detected by exposing blots to BioMax MR autoradiography film (Eastman Kodak Co., Rochester, N.Y.).

Cloning of the AceES-2 cDNA. The techniques employed to clone A. ceylanicum ES product cDNAs have been described in detail elsewhere (12, 47). Briefly, total RNA was isolated from adult hookworms and used to generate cDNA by using the 3'TTTT primer (GGCCACGCGTCGACTACTTTTTTTTTTTTTTTT). The entire first-strand cDNA mixture was then used as the template for PCR amplification with the 5'AceES-2 primer (CTCGCGTACACTGAGTATTGTCCA) and the 3'TTTT primer. The PCR was performed for 40 cycles (denaturation at 94°C for 15 s, annealing at 50°C for 10 s, and extension at 72°C for 30 s, with a 2-min final extension step at 72°C), and a sample of the reaction mixture was subjected to agarose electrophoresis. The amplified product was then ligated into the pCR2.1 TA cloning vector (Invitrogen Corp., Carlsbad, Calif.). Escherichia coli INV{alpha}F' cells (Invitrogen) were transformed with the ligation products by using the manufacturer's protocol and were plated onto Luria-Bertani medium (LB)-kanamycin agar plates containing 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal). Colonies that appeared to be white were screened for the appropriate-size insert by PCR and were sequenced by using vector-specific primers.

Expression and purification of rAceES-2. In order to express rAceES-2, the AceES-2 cDNA was amplified from pCR 2.1 by PCR by using the 5'AceES-2 Bam (GGAGAAGTAGGATCCGAGTATTGTCCAAAA) and 3'AceES-2 Xho (GGATCTGACTCGAGTTATTCCTTCAGCAG) primers. The PCR product was digested with BamHI and XhoI and ligated into BamHI/XhoI-digested expression vector pET-32a (Invitrogen). The ligated plasmid was used to transform E. coli Max Efficiency DH5{alpha} (Invitrogen), and the cells were plated on LB-ampicillin agar plates. Miniprep DNA from the resulting colonies was screened by PCR and sequencing and was used to transform E. coli Origami DE3 (Novagen, Inc., Madison, Wis.) by using the manufacturer's protocol. Transformants were plated onto LB plates containing carbenicillin, kanamycin, and tetracycline. A single colony was grown in liquid LB containing carbenicillin, kanamycin, and tetracycline to an optical density at 630 nm of approximately 0.6 and then induced for 3 h by addition of isopropyl-ß-D-thiogalactopyranoside (IPTG) to a concentration of 1 mM. rAceES-2 expression in bacterial lysates was confirmed by SDS-PAGE and immunoblotting by employing antibodies to the vector-encoded polyhistidine tag and infected hamster serum as described above. To purify rAceES-2, a 400-ml culture was grown and induced as described above. The cells were harvested, resuspended in 20 ml of binding buffer (5 mM imidazole, 50 mM NaCl, 20 mM Tris-HCl; pH 7.9), sonicated briefly, and centrifuged at 27,000 x g for 15 min at 4°C. The supernatant was filtered and applied to an Ni2SO4-charged Hi-Trap chelating Sepharose column (Amersham Biosciences Corp., Piscataway, N.J.), and the rAceES-2 was eluted with 0.5 M imidazole. The eluted rAceES-2 was dialyzed into 50 mM Tris-HCl (pH 7.5) and concentrated with a centrifugal filter device, and the protein content was determined with the BCA system as described above.

Analysis of antibody responses by ELISA. Immulon-2 microtiter plates (Dynex, Chantilly, Va.) were coated with rAceES-2 and with ES products diluted in sterile PBS to concentrations of 5 and 1 µg/ml, respectively, and an enzyme-linked immunosorbent assay (ELISA) was performed as previously described (13) by using pooled hamster serum. Following substrate addition the A405 was recorded at 10 min (for rAceES-2) or at 30 min (for ES products) by using a microplate reader.

Immunization and challenge infection of hamsters. For subcutaneous immunization, rAceES-2 or ES products were diluted in filter-sterilized 0.15 M NaCl and mixed with an equal volume of room temperature Rehsorptar 2% aluminum hydroxide gel (alum; Intergen Co., Purchase, N.Y.). Hamsters were immunized subcutaneously in the scruff of the neck with 0.2 ml (total volume). Animals were initially vaccinated with 100 µg of rAceES-2 or 50 µg of ES products and subsequently boosted twice at 21-day intervals with 50 µg of rAceEs-2 or 25 µg of ES, respectively. Control animals received 0.15 M NaCl mixed with alum. One week after the second boost the animals were challenged by oral gavage with 100 L3. For oral immunization, 200 µg of rAceES-2 or 1 mg of HEX was diluted in filter-sterilized 0.15 M NaCl, and hamsters were given a single oral dose in 0.5 ml. Fifteen days later the animals were challenged orally with 75 L3. For passive immunization, hamsters were infected with 75 L3 on day 0, and each hamster was given 1 ml of hyperimmune rabbit anti-rAceES-2 serum or normal rabbit serum subcutaneously in the scruff of the neck on days 0, 11, and 21. The antiserum was prepared by subcutaneously immunizing a New Zealand White rabbit with 500 µg of rAceES-2 emulsified in complete Freund's adjuvant, followed by three booster doses of 100 µg of rAceES-2 emulsified in incomplete Freund's adjuvant administered at 3-week intervals. The rabbit immunizations were conducted by Veterinary Clinical Services, Section of Comparative Medicine, Yale University School of Medicine. In each immunization trial normalized postinfection weights were determined by calculating the percentage of the day 0 value for each animal.

Hemoglobin assay. Blood was collected from the orbital plexus of hamsters and mice in heparinized capillary tubes (Fisher Scientific, Pittsburgh, Pa.) and was assayed within 4 h of collection. Hemoglobin levels were measured by using a Total Hemoglobin assay kit (Sigma) as previously described (14).

Statistical analysis of data. Data are expressed below as means ± standard errors. Significance testing was conducted by using the StatView 4.51 statistical analysis software package (Abacus Concepts, Inc., Berkeley, Calif.). For multiple-group comparisons analysis of variance was performed, followed by Fisher's protected least-significant difference test as a posttest. P values of <0.05 were considered significant.


arrow
RESULTS
 
Purification and cloning of AceES-2. We previously employed a rpHPLC-based strategy to separate ES products from A. ceylanicum into at least 25 distinct protein peaks (12). Amino-terminal sequencing of one of the most prominent peaks (peak 14) yielded sufficient residues to allow cloning of AceES-1 (12). Analysis of an adjacent peak, peak 15, by mass spectroscopy (Fig. 1) revealed a major 11.53-kDa species and a minor 12.73-kDa species (the latter species closely approximated native AceES-1 [12]). Western immunoblot analysis of peak 15 (Fig. 1, inset) with serum from A. ceylanicum-infected hamsters (14) revealed strong immunoreactivity in the 11- to 12-kDa range, similar to that observed for unfractionated ES products. Amino-terminal sequencing of peak 15 yielded 19 unambiguous residues (EYCPKMLSEIRQEXINDVXXXAY) of the protein which we designated AceES-2. A BLAST search of the AceES-2 amino-terminal sequence with the NCBI database revealed no significant matches with any other species; however, a query of a parasitic nematode EST database available at Nematode.net (J. McCarter, S. Clifton, B. Chiapelli, D. Pape, J. Martin, T. Wylie, M. Dante, M. Marra, L. Hillier, T. Kucaba, B. Theising, Y. Bowers, M. Gibbons, E. Ritter, J. Bennett, C. Franklin, R. Tsagareishvili, I. Ronko, S. Kennedy, L. Maguire, C. Beck, K. Underwood, M. Steptoe, M. Allen, B. Person, T. Swaller, N. Harvey, R. Schurk, S. Kohn, T. Shin, Y. Jackson, M. Cardenas, R. McCann, R. Waterston, and R. Wilson, unpublished data) yielded an exact match with several adult A. ceylanicum EST clones whose functions are unknown. These EST clones had almost identical sequences, suggesting that they were derived from a single gene. Based on the sequence of one of these clones (pj08c08.y1), we designed the 5'AceES-2 primer, which is comprised of nucleotides encoding the four terminal codons of the EST-derived putative signal sequence (LAYT) predicted by the SignalP algorithm (49) followed by the first four amino-terminal codons of the native AceES-2 sequence (EYCP). Reverse transcription-PCR of adult worm RNA performed with the 5'AceES-2 and 3'TTTT primers resulted in cloning of the 342-nucleotide cDNA shown in Fig. 2. The cloned AceES-2 cDNA contains an open reading frame consisting of 306 nucleotides plus a stop codon, which predicts a mature protein having 102 amino acids, a pI of 4.92, and a molecular mass of 11.66 kDa. The identity of the AceES-2 cDNA was confirmed by the presence of codons downstream from the 5'AceES-2 primer that corresponded to the 15 other known amino-terminal residues in the native protein sequence, as well as by a predicted molecular mass which closely approximated that of native AceES-2 (11.53 kDa) (Fig. 1). The AceES-2 cDNA was also 100% identical at the predicted amino acid level and 98% identical at the nucleotide level to the EST clone used to design the 5'AceES-2 primer. The full-length AceES-2 cDNA was subjected to an NCBI BLAST search. As was the case with the amino-terminal sequence, no significant matches were identified, confirming that AceES-2 is a novel adult hookworm ES product. Notably, a pairwise comparison of AceES-2 with AceES-1 (itself a novel protein [12]) also revealed no significant homology.



View larger version (60K):
[in this window]
[in a new window]
  		FIG. 1. Mass spectroscopy of ES product rpHPLC peak 15. (Inset) Western immunoblot of peak 15 (10% of the peak volume) and unfractionated ES products (1 µg of total protein) probed with pooled hamster serum prepared 102 days after A. ceylanicum infection (14). The positions of molecular mass markers (in kilodaltons) are indicated on the right.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 2. Nucleotide sequence of the AceES-2 cDNA and deduced amino acid sequence of mature AceES-2. The italicized amino acids are the 23 residues obtained from amino-terminal sequencing of native AceES-2, and the 19 unambiguous residues are indicated by boldface type.

rAceES-2 is highly immunoreactive. In order to express rAceES-2, the cDNA was subcloned into the prokaryotic pET-32 expression vector. E. coli was transformed with the plasmid and grown on selective media, and positive colonies were confirmed by PCR followed by nucleotide sequencing. Cultures were induced, and whole-cell lysates were subjected to SDS-PAGE analysis, which confirmed that a protein of the size predicted for the AceES-2-pET-32 fusion protein (29.4 kDa) was present in the induced cultures (data not shown). rAceES-2 was then expressed in milligram quantities and was purified by using nickel affinity chromatography; the product was used in subsequent studies. An immunoblot analysis performed with serum from A. ceylanicum-infected hamsters revealed that there was a high degree of reactivity against rAceES-2, whereas there was no reactivity in naïve serum (Fig. 3A). As shown in Fig. 3B, pooled antibodies from infected hamsters reacted strongly with rAceES-2 in an ELISA, which was concordant with the immunoblot data. Furthermore, the anti-rAceES-2 responses were still greater in animals exposed to a second A. ceylanicum infection 108 days after the first exposure (14). A lack of immunoreactivity against the pET-32 protein expressed alone (data not shown) indicated that the reactivity present in the infected hamster sera was directed solely at the AceES-2-derived sequence of the AceES-2-pET-32 fusion protein. Immunization with ES product or HEX preparations in alum as previously described (14) also induced rAceES-2-specific responses; the magnitude of these responses was considerably greater in the ES product-vaccinated hamsters (Fig. 3B).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 3. Analysis of humoral immune responses to recombinant hookworm proteins. (A) Western immunoblot of rAceES-2 probed with pooled infected hamster serum or naïve serum. The positions of molecular mass markers (in kilodaltons) are indicated on the right. (B) ELISA of rAceES-2 probed with pooled sera from hamsters that were infected once or twice (Once inf. and Twice inf., respectively) (14) or with pooled sera from hamsters that were immunized three times with HEX (HEX-vacc.) (14) or ES products in alum (ES-vacc.). All data points are means for duplicate samples; the error bars do not extend beyond the boundaries of the symbols.

Subcutaneous vaccination with rAceES-2. In order to evaluate the potential of rAceES-2 as a vaccine against hookworm disease, hamsters were immunized three times subcutaneously with the recombinant antigen or ES products adsorbed in alum as described in Materials and Methods. Analysis of the humoral immune responses by ELISA (Fig. 4A) demonstrated that rAceES-2 was highly immunogenic, generating specific antibody responses whose magnitude was comparable to that observed in infected hamsters (Fig. 3B). Antibodies from rAceES-2-immunized animals also reacted with whole ES products (Fig. 4B); immunoblot analysis revealed that the reactivity was largely confined to a single ES protein whose molecular mass was very similar to the molecular mass of native AceES-2 (11.5 kDa) (Fig. 4C). The assays whose results are shown in Fig. 4 also confirmed our initial observation (Fig. 3) that immunization with ES products induced antibodies that cross-reacted with rAceES-2.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4. Analysis of prechallenge humoral immune responses in vaccinated hamsters. (A and B) ELISA of rAceES-2 (A) or ES products (B) probed with pooled serum from hamsters immunized subcutaneously with alum only, with ES products plus alum, or with rAceES-2 plus alum as described in Materials and Methods. All data points are means for duplicate samples; the error bars do not extend beyond the boundaries of the symbols. (C) Western immunoblot of ES products (1 µg per well) or rAceES-2 (100 ng per well) probed with pooled serum from immunized hamsters. The positions of molecular mass markers (in kilodaltons) are indicated on the right.

To determine whether the subcutaneous immunization protocol with rAceES-2 or ES products in alum described above conferred protection against hookworm-associated pathology, hamsters were challenged with 100 L3 1 week after the third immunization and observed for 40 days. As shown in Fig. 5A and B, by 11 days after challenge infection the blood hemoglobin levels began to drop steadily in alum-treated control animals, declining approximately 25% by day 28 and remaining depressed for the remainder of the observation period. The hemoglobin levels also dropped in rAceES-2-vaccinated hamsters (Fig. 5A); compared to the decline in the alum-treated controls this decline occurred more rapidly, and at its nadir (day 22) the level was significantly lower. rAceES-2-vaccinated hamsters also lost more weight upon challenge than the alum-treated controls (Fig. 5C), although in this case the difference was not statistically significant. Conversely, vaccination with ES products was shown to provide partial protection against weight loss (Fig. 5D) in a manner similar to the manner previously observed for HEX-vaccinated animals (14). The hemoglobin levels were also generally higher in ES product-vaccinated hamsters than in alum-treated controls (Fig. 5B). The parasites in the small intestine were counted on day 40, and while the mean burdens (alum-treated animals, 8.8 ± 3.4 parasites; ES product-vaccinated animals, 6.0 ± 1.1 parasites; rAceES-2-vaccinated animals, 15.0 ± 6.0 parasites) were found to be in general agreement with the levels of pathology observed (Fig. 5), the differences in worm burdens between groups were not statistically significant.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 5. Blood hemoglobin levels (A and B) and weights (C and D) for hamsters vaccinated subcutaneously with alum only (n = 4), ES products plus alum (n = 5), or rAceES-2 plus alum (n = 5) as described in Materials and Methods. Uninfected controls (n = 3) were vaccinated with alum only. Hamsters were challenged with 100 A. ceylanicum L3 on day 0 and were monitored for 40 days. All values are means ± standard errors of the means. An asterisk indicates that there is a statistically significant difference (P < 0.05) between a value and the value for the alum control group.

Passive immunization against rAceES-2. It has been shown previously that passive transfer of immune serum could reduce disease severity in A. ceylanicum-infected hamsters (14). Accordingly, although active subcutaneous immunization with rAceES-2 had no protective effect against hookworm-associated pathology (Fig. 5), we hypothesized that higher-titer antibodies to rAceES-2 could have a positive effect on hookworm disease when they are passively administered to infected hamsters. To evaluate this hypothesis, a rabbit was hyperimmunized with rAceES-2, and the rabbit serum was subcutaneously injected into hamsters on days 0, 11, and 21 following A. ceylanicum infection (corresponding to initial larval exposure, the onset of bloodfeeding by preadult worms [29], and the approximate nadir of severe disease, respectively). As shown in Fig. 6A, both groups of infected hamsters had developed anemia by day 24, and the levels of severity were comparable at this time. Anemia remained pronounced in the hamsters treated with normal rabbit serum until day 32, and then a partial recovery (commonly observed in this model [14]) commenced. This recovery was more rapid and complete in animals given anti-rAceES-2, and the hemoglobin levels in such hamsters were statistically equivalent to the levels in uninfected controls by day 49 (Fig. 6A). Postchallenge weights were also generally higher for hamsters treated with anti-rAceES-2 than for hamsters given normal serum (Fig. 6B), although the difference was not statistically significant. We observed that parasite yields in this model are generally low after day 40 (unpublished data); consequently, worm burdens were not evaluated in this study.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 6. Blood hemoglobin levels (A) and weights (B) for hamsters passively immunized with normal rabbit serum (n = 6) or anti-rAceES-2 serum (n = 6) on days 0, 11, and 21 as described in Materials and Methods. Uninfected controls (n = 3) were immunized with normal rabbit serum. Hamsters were challenged with 75 A. ceylanicum L3 on day 0 and were monitored for 70 days. All values are means ± standard errors of the means. An asterisk indicates that there is a statistically significant difference (P < 0.05) between a value and the value for the normal rabbit serum group.

Oral vaccination with rAceES-2. In an effort to more closely mimic the natural exposure route for hookworm proteins in the mammalian host, an oral vaccination protocol was used to evaluate the protective efficacy of rAceES-2. Hamsters were immunized with a single oral dose consisting of 200 µg of rAceES-2 or 1 mg of HEX in normal saline 15 days prior to challenge infection. HEX was employed in this study as a positive control since milligram quantities of ES products were not available. Figure 7A shows that compared to saline-only controls, hamsters immunized with rAceES-2 exhibited significantly less severe anemia upon challenge. This reduced pathology was comparable to that observed in HEX-vaccinated animals (Fig. 7B). HEX vaccination also significantly mitigated postchallenge weight loss (Fig. 7D), an effect which was not observed in rAceES-2-vaccinated animals (Fig. 7C). Due to the extended observation period worm burdens were not evaluated in this study.



View larger version (43K):
[in this window]
[in a new window]
  		FIG. 7. Blood hemoglobin levels (A and B) and weights (C and D) for hamsters vaccinated orally with saline only (n = 6), HEX in saline (n = 6), or rAceES-2 in saline (n = 6) as described in Materials and Methods. Uninfected controls (n = 3) were also treated with saline. Hamsters were challenged with 75 A. ceylanicum L3 on day 0 and were monitored for 50 days. All values are means ± standard errors of the means. An asterisk indicates that there is a statistically significant difference (P < 0.05) between a value and the value for the saline control group.


arrow
DISCUSSION
 
Despite over a century's worth of efforts to eradicate them, bloodfeeding hookworms remain major agents of global morbidity (3, 21, 23) for which vaccination may represent an attractive alternative means of control (16, 36). As part of an effort to identify candidate antigens that may be exploited in this manner, we purified and cloned AceES-2, a novel immunoreactive ES molecule produced by adult A. ceylanicum hookworms. Studies described here in which a previously described hamster model of A. ceylanicum infection, disease, and vaccination (14) was used suggested that AceES-2 plays an important role in the host-parasite interaction and that targeting this molecule by immunization may be a useful strategy for mitigating hookworm-associated pathology. Of note, this paper appears to be the first report of the use of nonliving oral vaccines against an anthrophilic hookworm species.

As described here, AceES-2 was identified in A. ceylanicum ES products by using an rpHPLC-based method. Because it requires no a priori knowledge of biological activity and does not depend on the presence of consensus sequences, this method has proven to be particularly useful for identification of novel proteins whose functions are unknown, such as the previously described AceES-1 protein (12). As such, it is an excellent complement to the activity-based techniques that have been employed previously to purify and clone secreted hookworm anticoagulants (17, 18) and the putative platelet inhibitor (20, 27). Furthermore, because it requires that proteins be present in detectable quantities, the rpHPLC-based method may be more likely to identify biologically relevant molecules than genome-based approaches (7, 25).

It has previously been reported that hamsters which have resolved anemia following a single A. ceylanicum infection are resistant to severe disease when there is a second challenge infection (14). Pooled serum from such singly infected hamsters apparently recognizes native AceES-2 (Fig. 1, inset) and also reacts strongly with rAceES-2 (Fig. 3). Moreover, the levels of immunoreactivity against rAceES-2 were found to be still higher in serum from hamsters that had been infected twice (Fig. 3B); such a serum has previously been shown to transfer partial resistance to hookworm disease (14). Whether the relative resistance of previously infected hamsters to severe disease following a second infection can be attributed in part to AceES-2-specific antibodies is unknown at this time. Humans infected with hookworms typically produce parasite-specific humoral and cellular immune responses of the Th2 type (reviewed in reference 42). In contrast to the protective immunity in hamsters (as described above) and dogs (19, 46), however, there is relatively little definitive evidence that natural protective immunity against hookworms develops in humans (6, 42). Nevertheless, given that certain individuals appear to be predisposed to particular infection intensities (52, 57), it would be interesting to examine AceES-2-specific immune responses in humans living in A. ceylanicum-endemic areas to determine if there is any correlation with infection prevalence and/or intensity.

Analysis of the humoral responses of rAceES-2- and ES product-vaccinated hamsters (Fig. 4) suggested that rAceES-2 accurately reproduces one or more B-cell epitopes found on the native molecule, an important consideration for vaccine development (36). Nevertheless, despite inducing high-titer IgG responses that are cross-reactive with the native molecule, immunization of hamsters with rAceES-2 in alum failed to protect the animals against anemia (Fig. 5A) or weight loss (Fig. 5C) upon challenge infection and in fact appeared to exacerbate the disease. This is in contrast to the results obtained for animals immunized with whole ES products in alum, which were found to be partially protected from weight loss (Fig. 5D) in a manner similar to the manner previously observed after HEX-alum vaccination (14). The failure of high-titer anti-AceES-2 responses to protect rAceES-2-alum-immunized hamsters is noteworthy given that hookworm-specific antibodies have been proposed to play a protective role in hamsters vaccinated against A. ceylanicum (14, 39) or in mice vaccinated against A. caninum (31). However, it is possible that rAceES-2-alum vaccination raised antibodies of a nonprotective isotype or antibodies with inappropriate epitope specificity compared to natural infection.

Adoptive transfer of immune serum has been shown to reduce lung L3 burdens in mice infected with A. caninum (31), and it has previously been reported that transfer of pooled serum from twice-infected hamsters to animals undergoing a primary infection was associated with improved growth and hemoglobin status (14). Passive immunization with hyperimmune rabbit serum against rAceES-2 was also associated with significantly improved hemoglobin status following the nadir of anemia (Fig. 6A). Rabbit anti-rAceES-2 may have acted by neutralizing the native molecule as it was secreted by the adult worm, thereby interfering with continued bloodfeeding in the host gut and accelerating the resolution of anemia, which typically begins after day 35 in the hamster model (14). An explanation for the disparate pathological outcomes for passively immunized hamsters and for the active subcutaneous immunization trial has not been determined yet. However, a higher-titer anti-rAceES-2 response in the immunized serum donor rabbit, differences in epitope recognition between the two species, and/or dissimilar immunoglobulin isotype distributions may provide some explanation for these findings.

Adult hookworms reside in the intestinal mucosa, where they presumably expose the host's mucosal immune system to a continuous stream of antigens. Accordingly, in an attempt to more closely mimic the probable natural exposure route of AceES-2, an oral vaccination study was conducted. As shown in Fig. 7, hamsters given a single oral dose of rAceES-2 or HEX without adjuvant were found to have reduced anemia after a challenge infection. Presumably because HEX contains other protective antigens, oral HEX vaccination was also associated with partial protection against hookworm-induced weight loss (Fig. 7D). Interestingly, no rAceES-2- or HEX-specific humoral immune responses were detected in the serum of orally vaccinated hamsters prior to challenge (data not shown). This suggests that while parasite-specific serum IgG may have a role in natural resistance and parenterally induced protective immunity (14, 39), such responses are not absolutely required for the expression of protection in the oral vaccine model. The mechanism of protection in this model has not been characterized yet, although stimulation of secretory IgA responses that neutralize the activity of parasite proteins seems likely (10, 34) and locally secreted IgG (11) may also play a role. Oral immunization may also have primed cellular responses, leading to accelerated mucosal mastocytosis upon challenge infection; such responses are known to occur after secondary challenge in hamsters (5, 30).

Although successful oral vaccination with attenuated larvae has been reported for A. ceylanicum in hamsters (44) and for A. caninum in mice (68), to our knowledge this is the first report of oral immunization against an anthrophilic hookworm in which either a nonliving parasite extract or a defined recombinant antigen was employed. The rather simple oral immunization protocol employed in this study was chosen because a similar approach was shown to confer protection against Nippostrongylus brasiliensis in rats (50). However, it is possible that vaccine efficacy may be improved by the use of other oral dosage regimens, as well as mucosal adjuvants (34). Mucosal vaccination by the nasal route has shown promise against the intestinal helminths Trichinella spiralis (43) and Ascaris suum (62, 63); similar protocols may be adapted for use against hookworms. Given that any hookworm vaccine for human use would be employed primarily in the developing world, the optimization of mucosal immunization protocols would be very useful as such protocols would allow rapid, safe, and efficient vaccine delivery.

As described here, passive and oral vaccination of hamsters against rAceES-2 was associated with improved hemoglobin status but had no significant effect on weight gain. This is in contrast to natural infection, as well as vaccination with the ES or HEX antigen preparations, which have generally been associated with improvements in both disease parameters upon challenge. However, infection and vaccination with antigen preparations expose the immune system to multiple hookworm proteins that have different functions and are therefore likely to have different individual protective efficacies. For example, if AceES-2 is a virulence factor that has a role in bloodfeeding, neutralization of its function might be expected to have a greater effect on anemia than on weight loss (assuming that the worms continue to survive with reduced feeding efficiency). Conversely, it has recently been demonstrated that vaccination with the Kunitz inhibitor AceKI leads to improved weight gain but has little effect on anemia (22), which is consistent with the demonstrated activity of this protein against host digestive enzymes (47). Together, these results suggest that the pathogenesis of hookworm anemia and growth delay are due to distinct molecular mechanisms and that vaccination against specific virulence factors may allow these disease parameters to be experimentally decoupled.

In conclusion, the studies described here provided compelling preliminary evidence which suggests that AceES-2 plays an important role in the host-parasite interaction. Of particular interest for future work is whether AceES-2 homologues are produced by other hookworm species and whether rAceES-2 is recognized by hookworm-infected humans. Elucidation of the circumstances under which AceES proteins mitigate or exacerbate pathology may provide new insights into the nature of protective immunity against hookworms and the role of AceES-2 in pathogenesis. Vaccination against this molecule, perhaps in cocktail form with other putative virulence factors, may ultimately be employed as a strategy to reduce the burden of hookworm disease in humans.


arrow
ACKNOWLEDGMENTS
 
This research was supported by NIH grants F32 AI51042 (to R.D.B.) and R01 AI47929 (to M.C.) and by a Hellman Family Fellowship from the Office of the President of Yale University (to M.C.). C.V.S. received stipend support from the Yale University Science Technology and Research Scholars Program.

We thank the members of the Yale Child Health Research Center for their advice and support during the course of this work.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Pediatrics, Yale University School of Medicine, P.O. Box 208081, New Haven, CT 06520-8081. Phone: (203) 737-4063. Fax: (203) 737-5972. E-mail: richard.bungiro{at}yale.edu. Back

Editor: W. A. Petri, Jr.


arrow
REFERENCES
 
    1
  1. Albonico, M., D. W. Crompton, and L. Savioli. 1999. Control strategies for human intestinal nematode infections. Adv. Parasitol. 42:277-341.[Medline]
    2. 2
  2. Albonico, M., P. G. Smith, E. Ercole, A. Hall, H. M. Chwaya, K. S. Alawi, and L. Savioli. 1995. Rate of reinfection with intestinal nematodes after treatment of children with mebendazole or albendazole in a highly endemic area. Trans. R. Soc. Trop. Med. Hyg. 89:538-541.[CrossRef][Medline]
    3. 3
  3. Awasthi, S., D. A. Bundy, and L. Savioli. 2003. Helminthic infections. Br. Med. J. 327:431-433.[Free Full Text]
    4. 4
  4. Basavaraju, S., B. Zhan, M. W. Kennedy, Y. Liu, J. Hawdon, and P. J. Hotez. 2003. Ac-FAR-1, a 20 kDa fatty acid- and retinol-binding protein secreted by adult Ancylostoma caninum hookworms: gene transcription pattern, ligand binding properties and structural characterisation. Mol. Biochem. Parasitol. 126:63-71.[CrossRef][Medline]
    5. 5
  5. Behnke, J. M., J. Guest, and R. Rose. 1997. Expression of acquired immunity to the hookworm Ancylostoma ceylanicum in hamsters. Parasite Immunol. 19:309-318.
    6. 6
  6. Behnke, J. M. 1987. Do hookworms elicit protective immunity in man? Parasitol. Today 3:200-206.
    7. 7
  7. Blaxter, M. 2000. Genes and genomes of Necator americanus and related hookworms. Int. J. Parasitol. 30:347-355.[CrossRef][Medline]
    8. 8
  8. Borkow, G., Q. Leng, Z. Weisman, M. Stein, N. Galai, A. Kalinkovich, and Z. Bentwich. 2000. Chronic immune activation associated with intestinal helminth infections results in impaired signal transduction and anergy. J. Clin. Investig. 106:1053-1060.[Medline]
    9. 9
  9. Borkow, G., Z. Weisman, Q. Leng, M. Stein, A. Kalinkovich, D. Wolday, and Z. Bentwich. 2001. Helminths, human immunodeficiency virus and tuberculosis. Scand. J. Infect. Dis. 33:568-571.[CrossRef][Medline]
    10. 10
  10. Bouvet, J. P., N. Decroix, and P. Pamonsinlapatham. 2002. Stimulation of local antibody production: parenteral or mucosal vaccination? Trends Immunol. 23:209-213.[CrossRef][Medline]
    11. 11
  11. Bouvet, J. P., and V. A. Fischetti. 1999. Diversity of antibody-mediated immunity at the mucosal barrier. Infect. Immun. 67:2687-2691.[Free Full Text]
    12. 12
  12. Bungiro, R. D., L. M. Harrison, and M. Cappello. 2002. Ancylostoma ceylanicum excretory/secretory protein 1: purification and molecular cloning of a major secretory protein from adult hookworms. Mol. Biochem. Parasitol. 119:147-151.[CrossRef][Medline]
    13. 13
  13. Bungiro, R. D., Jr., B. R. Anderson, and M. Cappello. 2003. Oral transfer of adult Ancylostoma ceylanicum hookworms into permissive and nonpermissive host species. Infect. Immun. 71:1880-1886.[Abstract/Free Full Text]
    14. 14
  14. Bungiro, R. D., Jr., J. Greene, E. Kruglov, and M. Cappello. 2001. Mitigation of hookworm disease by immunization with soluble extracts of Ancylostoma ceylanicum. J. Infect. Dis. 183:1380-1387.[CrossRef][Medline]
    15. 15
  15. Cappello, M., L. P. Clyne, P. McPhedran, and P. J. Hotez. 1993. Ancylostoma factor Xa inhibitor: partial purification and its identification as a major hookworm-derived anticoagulant in vitro. J. Infect. Dis. 167:1474-1477.[Medline]
    16. 16
  16. Cappello, M., L. M. Harrison, R. D. Bungiro, Jr., R. C. Chadderdon, A. Milstone, A. Nerlinger, and P. Kuzmic. 2003. Molecular pathogenesis of hookworm anemia: prospects for a disease-based vaccine. J. Parasitol. 89:S158-S164.
    17. 17
  17. Cappello, M., J. M. Hawdon, B. F. Jones, W. P. Kennedy, and P. J. Hotez. 1996. Ancylostoma caninum anticoagulant peptide: cloning by PCR and expression of soluble, active protein in E. coli. Mol. Biochem. Parasitol. 80:113-117.
    18. 18
  18. Cappello, M., G. P. Vlasuk, P. W. Bergum, S. Huang, and P. J. Hotez. 1995. Ancylostoma caninum anticoagulant peptide: a hookworm-derived inhibitor of human coagulation factor Xa. Proc. Natl. Acad. Sci. 92:6152-6156.[Abstract/Free Full Text]
    19. 19
  19. Carroll, S. M., and D. I. Grove. 1986. Response of dogs to challenge with Ancylostoma ceylanicum during the tenure of a primary hookworm infection. Trans. R. Soc. Trop. Med. Hyg. 80:406-411.[CrossRef][Medline]
    20. 20
  20. Chadderdon, R. C., and M. Cappello. 1999. The hookworm platelet inhibitor: functional blockade of integrins GPIIb/IIIa (alphaIIbbeta3) and GPIa/IIa (alpha2beta1) inhibits platelet aggregation and adhesion in vitro. J. Infect. Dis. 179:1235-1241.[CrossRef][Medline]
    21. 21
  21. Chan, M. S., G. F. Medley, D. Jamison, and D. A. Bundy. 1994. The evaluation of potential global morbidity attributable to intestinal nematode infections. Parasitology 109:373-387.
    22. 22
  22. Chu, D., R. D. Bungiro, Jr., M. Ibanez, L. M. Harrison, E. Campodonico, B. F. Jones, J. Mieszczanek, P. Kuzmic, and M. Cappello. 2004. Molecular characterization of Ancylostoma ceylanicum Kunitz-type serine protease inhibitor: evidence for a role in hookworm-associated growth delay. Infect. Immun. 72:2214-2221.
    23. 23
  23. Crompton, D. W. 1999. How much human helminthiasis is there in the world? J. Parasitol. 85:397-403.[CrossRef][Medline]
    24. 24
  24. Crompton, D. W., and M. C. Nesheim. 2002. Nutritional impact of intestinal helminthiasis during the human life cycle. Annu. Rev. Nutr. 22:35-59.[CrossRef][Medline]
    25. 25
  25. Daub, J., A. Loukas, D. I. Pritchard, and M. Blaxter. 2000. A survey of genes expressed in adults of the human hookworm, Necator americanus. Parasitology 120:171-184.
    26. 26
  26. De Clercq, D., M. Sacko, J. Behnke, F. Gilbert, P. Dorny, and J. Vercruysse. 1997. Failure of mebendazole in treatment of human hookworm infections in the southern region of Mali. Am. J. Trop. Med. Hyg. 57:25-30.
    27. 27
  27. Del Valle, A., B. F. Jones, L. M. Harrison, R. C. Chadderdon, and M. Cappello. 2003. Isolation and molecular cloning of a secreted hookworm platelet inhibitor from adult Ancylostoma caninum. Mol. Biochem. Parasitol. 129:167-177.[CrossRef][Medline]
    28. 28
  28. Despommier, D. D., R. W. Gwadz, P. J. Hotez, and C. A. Knirsch. 2000. Parasitic diseases, 4th ed., p. 111-118. Apple Trees Productions, LLC, New York, N.Y.
    29. 29
  29. Garside, P., and J. M. Behnke. 1989. Ancylostoma ceylanicum in the hamster: observations on the host-parasite relationship during primary infection. Parasitology 98:283-289.
    30. 30
  30. Garside, P., J. M. Behnke, and R. A. Rose. 1990. Acquired immunity to Ancylostoma ceylanicum in hamsters. Parasite Immunol. 12:247-258.[Medline]
    31. 31
  31. Ghosh, K., and P. J. Hotez. 1999. Antibody-dependent reductions in mouse hookworm burden after vaccination with Ancylostoma caninum secreted protein 1. J. Infect. Dis. 180:1674-1681.[CrossRef][Medline]
    32. 32
  32. Harrop, S. A., P. Prociv, and P. J. Brindley. 1996. Acasp, a gene encoding a cathepsin D-like aspartic protease from the hookworm Ancylostoma caninum. Biochem. Biophys. Res. Commun. 227:294-302.[CrossRef][Medline]
    33. 33
  33. Harrop, S. A., N. Sawangjaroen, P. Prociv, and P. J. Brindley. 1995. Characterization and localization of cathepsin B proteinases expressed by adult Ancylostoma caninum hookworms. Mol. Biochem. Parasitol. 71:163-171.[CrossRef][Medline]
    34. 34
  34. Holmgren, J., C. Czerkinsky, K. Eriksson, and A. Mharandi. 2003. Mucosal immunisation and adjuvants: a brief overview of recent advances and challenges. Vaccine 21(Suppl. 2):S89-S95.
    35. 35
  35. Hotez, P. J., and D. I. Pritchard. 1995. Hookworm infection. Sci. Am. 272:68-74.[Medline]
    36. 36
  36. Hotez, P. J., B. Zhan, J. M. Bethony, A. Loukas, A. Williamson, G. N. Goud, J. M. Hawdon, A. Dobardzic, R. Dobardzic, K. Ghosh, M. E. Bottazzi, S. Mendez, B. Zook, Y. Wang, S. Liu, I. Essiet-Gibson, S. Chung-Debose, S. Xiao, D. Knox, M. Meagher, M. Inan, R. Correa-Oliveira, P. Vilk, H. R. Shepherd, W. Brandt, and P. K. Russell. 2003. Progress in the development of a recombinant vaccine for human hookworm disease: The Human Hookworm Vaccine Initiative. Int. J. Parasitol. 33:1245-1258.[CrossRef][Medline]
    37. 37
  37. Jones, B. F., and P. J. Hotez. 2002. Molecular cloning and characterization of Ac-mep-1, a developmentally regulated gut luminal metalloendopeptidase from adult Ancylostoma caninum hookworms. Mol. Biochem. Parasitol. 119:107-116.[CrossRef][Medline]
    38. 38
  38. Kasper, G., A. Brown, M. Eberl, L. Vallar, N. Kieffer, C. Berry, K. Girdwood, P. Eggleton, R. Quinnell, and D. I. Pritchard. 2001. A calreticulin-like molecule from the human hookworm Necator americanus interacts with C1q and the cytoplasmic signalling domains of some integrins. Parasite Immunol. 23:141-152.[CrossRef][Medline]
    39. 39
  39. Khan, A. M., S. Gupta, J. C. Katiyar, and V. K. Srivastava. 1996. Correlation between degree of protection and humoral antibody response in hamsters immunized with somatic and excretory secretory antigens of Ancylostoma ceylanicum. Indian J. Exp. Biol. 34:1015-1018.[Medline]
    40. 40
  40. Loeb, L., and M. S. Fleisher. 1910. The influence of extracts of Anchylostoma caninum on the coagulation of the blood and on hemolysis. J. Infect. Dis. 7:625-631.
    41. 41
  41. Loukas, A., A. P. Brown, and D. I. Pritchard. 2002. Na-ctl-2, a cDNA encoding a C-type lectin expressed exclusively in adult Necator americanus hookworms. DNA Seq. 13:61-65.[Medline]
    42. 42
  42. Loukas, A., and P. Prociv. 2001. Immune responses in hookworm infections. Clin. Microbiol. Rev. 14:689-703.[Abstract/Free Full Text]
    43. 43
  43. McGuire, C., W. C. Chan, and D. Wakelin. 2002. Nasal immunization with homogenate and peptide antigens induces protective immunity against Trichinella spiralis. Infect. Immun. 70:7149-7152.[Abstract/Free Full Text]
    44. 44
  44. Menon, S., and M. K. Bhopale. 1985. Efficacy of UV-irradiated larval vaccine of Ancylostoma ceylanicum (Looss, 1911) in golden hamsters (Mesocricetus auratus). J. Helminthol. 59:287-293.[Medline]
    45. 45
  45. Mieszczanek, J., W. Kofta, and H. Wedrychowicz. 2000. Molecular cloning of a cysteine proteinase cDNA from adult Ancylostoma ceylanicum by the method of rapid amplification of cDNA ends using polymerase chain reaction. Parasitol. Res. 86:993-998.[CrossRef][Medline]
    46. 46
  46. Miller, T. A. 1971. Vaccination against the canine hookworm diseases. Adv. Parasitol. 9:153-183.[Medline]
    47. 47
  47. Milstone, A. M., L. M. Harrison, R. D. Bungiro, P. Kuzmic, and M. Cappello. 2000. A broad spectrum kunitz type serine protease inhibitor secreted by the hookworm Ancylostoma ceylanicum. J. Biol. Chem. 275:29391-29399.[Abstract/Free Full Text]
    48. 48
  48. Moyle, M., D. L. Foster, D. E. McGrath, S. M. Brown, Y. Laroche, J. De Meutter, P. Stanssens, C. A. Bogowitz, V. A. Fried, J. A. Ely, et al. 1994. A hookworm glycoprotein that inhibits neutrophil function is a ligand of the integrin CD11b/CD18. J. Biol. Chem. 269:10008-10015.[Abstract/Free Full Text]
    49. 49
  49. Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10:1-6.[Abstract/Free Full Text]
    50. 50
  50. Poulain, J., P. Pery, and G. Luffau. 1976. Protection of rats against Nippostrongylus brasiliensis with worm antigens by oral administration. Ann. Immunol. (Paris) 127:209-213.[Medline]
    51. 51
  51. Pritchard, D. I., A. Brown, G. Kasper, P. McElroy, A. Loukas, C. Hewitt, C. Berry, R. Fullkrug, and E. Beck. 1999. A hookworm allergen which strongly resembles calreticulin. Parasite Immunol. 21:439-450.[CrossRef][Medline]
    52. 52
  52. Quinnell, R. J., J. Griffin, M. A. Nowell, A. Raiko, and D. I. Pritchard. 2001. Predisposition to hookworm infection in Papua New Guinea. Trans. R. Soc. Trop. Med. Hyg. 95:139-142.[CrossRef][Medline]
    53. 53
  53. Quinnell, R. J., A. F. Slater, P. Tighe, E. A. Walsh, A. E. Keymer, and D. I. Pritchard. 1993. Reinfection with hookworm after chemotherapy in Papua New Guinea. Parasitology 106:379-385.
    54. 54
  54. Reynoldson, J. A., J. M. Behnke, L. J. Pallant, M. G. Macnish, F. Gilbert, S. Giles, R. J. Spargo, and R. C. Thompson. 1997. Failure of pyrantel in treatment of human hookworm infections (Ancylostoma duodenale) in the Kimberley region of north west Australia. Acta Trop. 68:301-312.[CrossRef][Medline]
    55. 55
  55. Santiso, R. 1997. Effects of chronic parasitosis on women's health. Int. J. Gynaecol. Obstet. 58:129-136.[CrossRef][Medline]
    56. 56
  56. Savioli, L., D. Gundy, and A. Tomkins. 1992. Intestinal parasitic infections: a soluble public health problem. Trans. R. Soc. Trop. Med. Hyg. 86:353-354.[CrossRef][Medline]
    57. 57
  57. Schad, G. A., and R. M. Anderson. 1985. Predisposition to hookworm infection in humans. Science 228:1537-1540.[Abstract/Free Full Text]
    58. 58
  58. Smillie, W. G., and D. L. Augustine. 1926. Hookworm infestation: the effect of varying intensities on the physical condition of school children. Am. J. Dis. Child. 31:151-168.
    59. 59
  59. Stassens, P., P. W. Bergum, Y. Gansemans, L. Jespers, Y. Laroche, S. Huang, S. Maki, J. Messens, M. Lauwereys, M. Cappello, P. J. Hotez, I. Lasters, and G. P. Vlasuk. 1996. Anticoagulant repertoire of the hookworm Ancylostoma caninum. Proc. Natl. Acad. Sci. 93:2149-2154.[Abstract/Free Full Text]
    60. 60
  60. Stoltzfus, R. J., H. M. Chwaya, J. M. Tielsch, K. J. Schulze, M. Albonico, and L. Savioli. 1997. Epidemiology of iron deficiency anemia in Zanzibari schoolchildren: the importance of hookworms. Am. J. Clin. Nutr. 65:153-159.[Abstract/Free Full Text]
    61. 61
  61. Stone, K. L., D. E. McNulty, M. L. LoPresti, J. M. Crawford, R. DeAngelis, and K. R. Williams. 1992. Techniques in protein chemistry III. Academic Press, Inc., New York, N.Y.
    62. 62
  62. Tsuji, N., K. Suzuki, H. Kasuga-Aoki, T. Isobe, T. Arakawa, and Y. Matsumoto. 2003. Mice intranasally immunized with a recombinant 16-kilodalton antigen from roundworm Ascaris parasites are protected against larval migration of Ascaris suum. Infect. Immun. 71:5314-5323.[Abstract/Free Full Text]
    63. 63
  63. Tsuji, N., K. Suzuki, H. Kasuga-Aoki, Y. Matsumoto, T. Arakawa, K. Ishiwata, and T. Isobe. 2001. Intranasal immunization with recombinant Ascaris suum 14-kilodalton antigen coupled with cholera toxin B subunit induces protective immunity to A. suum infection in mice. Infect. Immun. 69:7285-7292.[Abstract/Free Full Text]
    64. 64
  64. Williams, K. R., S. M. Samandar, K. L. Stone, M. Saylor, and J. Rush. 1996. Matrix-assisted laser desorption ionization mass spectrometry as a complement to internal protein sequencing, p. 541-555. In J. M. Walker (ed.), The protein protocols handbook. Humana Press, Totowa, N.J.
    65. 65
  65. Williamson, A. L., P. J. Brindley, G. Abbenante, P. Prociv, C. Berry, K. Girdwood, D. I. Pritchard, D. P. Fairlie, P. J. Hotez, J. P. Dalton, and A. Loukas. 2002. Cleavage of hemoglobin by hookworm cathepsin D aspartic proteases and its potential contribution to host specificity. FASEB J. 16:1458-1460.[Abstract/Free Full Text]
    66. 66
  66. World Health Organization. 1996. Report of the W. H. O. informal consultation on hookworm infection and anaemia in girls and women. Publication W. H. O./CTD/SIP/96.1. World Health Organization, Geneva, Switzerland.
    67. 67
  67. World Health Organization. 2002. The world health report 2002: reducing risks, promoting healthy life. World Health Organization, Geneva, Switzerland.
    68. 68
  68. Xiao, S., H. Ren, Y. Yang, H. Xue, H. Qiang, S. Liu, Z. Feng, and P. J. Hotez. 1998. Protective immunity in mice elicited by living infective third-stage hookworm larvae (Shanghai strain of Ancylostoma caninum). Chin. Med. J. (Engl. Ed.) 111:43-48.
    69. 69
  69. Zhan, B., M. Badamchian, B. Meihua, J. Ashcom, J. Feng, J. Hawdon, X. Shuhua, and P. J. Hotez. 2002. Molecular cloning and purification of Ac-TMP, a developmentally regulated putative tissue inhibitor of metalloprotease released in relative abundance by adult Ancylostoma hookworms. Am. J. Trop. Med. Hyg. 66:238-244.[Abstract]

Infection and Immunity, April 2004, p. 2203-2213, Vol. 72, No. 4
0019-9567/04/$08.00+0     DOI: 10.1128/IAI.72.4.2203-2213.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Cho, Y., Jones, B. F., Vermeire, J. J., Leng, L., DiFedele, L., Harrison, L. M., Xiong, H., Kwong, Y.-K. A., Chen, Y., Bucala, R., Lolis, E., Cappello, M. (2007). Structural and Functional Characterization of a Secreted Hookworm Macrophage Migration Inhibitory Factor (MIF) That Interacts with the Human MIF Receptor CD74. J. Biol. Chem. 282: 23447-23456 [Abstract] [Full Text]  
  • Held, M. R., Bungiro, R. D., Harrison, L. M., Hamza, I., Cappello, M. (2006). Dietary Iron Content Mediates Hookworm Pathogenesis In Vivo. Infect. Immun. 74: 289-295 [Abstract] [Full Text]  
  • BUNGIRO, R. D. JR., CAPPELLO, M. (2005). DETECTION OF EXCRETORY/SECRETORY COPROANTIGENS IN EXPERIMENTAL HOOKWORM INFECTION. Am J Trop Med Hyg 73: 915-920 [Abstract] [Full Text]  
  • Mendez, S., Valenzuela, J. G., Wu, W., Hotez, P. J. (2005). Host Cytokine Production, Lymphoproliferation, and Antibody Responses during the Course of Ancylostoma ceylanicum Infection in the Golden Syrian Hamster. Infect. Immun. 73: 3402-3407 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bungiro, R. D.
Right arrow Articles by Cappello, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bungiro, R. D., Jr.
Right arrow Articles by Cappello, M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»