![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
José Bresciani,4 and John E. Olsen1
Departments of Veterinary Pathobiology,1 Ecology, The Royal Veterinary and Agricultural University, Frederiksberg C, Denmark,4 Microbiology and Tumor Biology Center,2 Department of Neuroscience, Karolinska Institutet, Stockholm, Sweden3
Received 7 July 2003/ Returned for modification 11 August 2003/ Accepted 26 February 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
cheY, cheA, and double-mutant cheYA mutants, but not flaA mutant, were motile in liquid media. However, the cheA mutant had impaired swarming and the cheY and cheYA mutants were unable to swarm on soft agar plates, suggesting that cheY and cheA genes encode proteins involved in chemotaxis. The flaA, cheY, cheA, and cheYA mutants (grown at 24°C) showed reduced association with and invasion of Caco-2 cells compared to the wild-type strain. However, spleens from intragastrically infected BALB/c and C57BL/6 mice showed larger and similar numbers of the flaA and cheYA mutants, respectively, compared to the wild-type controls. Such a discrepancy could be explained by the fact that tumor necrosis factor receptor p55 deficient mice showed dramatically exacerbated susceptibility to the wild-type but unchanged or only slightly increased levels of the flaA or cheYA mutant. In summary, we show that listerial flaA. cheY, and cheA gene products facilitate the initial contact with epithelial cells and contribute to effective invasion but that flaA could also be involved in the triggering of immune responses. |
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B. subtilis and E. coli CheY and CheA constitute a two-component regulatory system involved in signal transduction of chemotaxis (23, 53). In B. subtilis the autophosphorylating activity of CheA increases by binding of attractants to transmembrane receptors (24). Phosphorylated CheA donates the phosphate to the response regulator CheY (4, 24), and phosphorylated CheY interacts with the flagellar motor switch complex to induce counterclockwise (CCW) rotation of the flagella, resulting in smooth swimming behavior (4). The default clockwise (CW) rotation of the flagella in the absence of interaction of CheY-P with switch proteins is associated with tumbling (5).
Flagella and motility contribute to virulence in several bacteria, such as Campylobacter jejuni (25), Legionella pneumophila (13), Clostridium difficile (54), Helicobacter pylori (18), Aeromonas caviae (45), Salmonella enterica serovar Typhi (36), Vibrio cholerae (46), and V. anguillarum (41). Further, the flagella of bacteria such as S. enterica serovar Enteritidis and Pseudomonas aeruginosa are involved in the triggering of innate immune responses in the host, and flagellin up-regulates tumor necrosis factor alpha (TNF-
) expression (9, 58). Toll-like receptors (TLRs) are a family of cell surface receptors that are identified by a conserved cytoplasmic signaling domain. TLRs recognize pathogen-associated molecular patterns and mediate the production of cytokines necessary for the development of effective immunity (31). Flagellin from L. monocytogenes binds to TLR5 (26), which is expressed by intestinal epithelial cells, monocytes, and dendritic cells (6, 40). Likewise, TLR5 stimulates the production of TNF- (26), a cytokine of importance in host resistance to enteric listeriosis (3). To study the role of the flagella and chemotaxis of L. monocytogenes in virulence, we constructed and phenotypically characterized defined flaA. cheY, and cheA mutants. We show that flagella and chemotaxis facilitate the adhesion to and invasion of eukaryotic host cells. Furthermore, diminished virulence of flaA and cheYA mutants relative to the wild type (WT) was observed in TNFR-p55–/– but not in WT mice, suggesting that flagella and cheYA-encoded polypeptides participate in the triggering of TNF secretion, leading to protection against infection.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
was used as the host for recombinant plasmids and was grown in Luria-Bertani broth. Strains harboring pAUL-A or pAT19 derivatives were grown in the presence of erythromycin (150 µg/ml for E. coli and 5 µg/ml for L. monocytogenes). Genetic manipulations. Chromosomal DNA and plasmid extractions, restriction enzyme digestions, and DNA ligations were performed by standard methods (48), using enzymes supplied by New England Biolabs. PCRs were performed with custom primers (DNA Technology, Aarhus C, Denmark) and AmpliTaq DNA polymerase from Perkin-Elmer (Branchburg, N.J.). Nucleotide sequencing was carried out using the Thermo Sequenase fluorescence labeled primer cycle-sequencing kit as specified by the manufacturer (Amersham Pharmacia Biotech, Little Chalfont, England) on an A.L.F. sequencer (Amersham Pharmacia Biotech), using fluorescein-labeled primers.
Construction of the chromosomal deletion mutants.
Deletion mutants with mutations in the flaA. cheY, and cheA genes were generated by PCR with specific primers with incorporated restriction sites (underlined) to introduce in-frame deletions. (i) To create the flaA mutant, the oligonucleotide pair A (GCGGAATTCGCGCAGGTGTTGGAGCCGATG) and B (GCGGGATCCCAAACGTTCTTGCGCTTGAG) with a BamHI restriction site were used to amplify a 428-bp DNA fragment (AB) of the 5' region of flaA (15), encoding the first 32 N-terminal amino acid residues. The oligonucleotide pair C (GCGGGATCCCAAACACCGCAAATGTTAACTC), with a BamHI restriction site, and D (TCGTCGGGTCTTTCTCAAGC) served to amplify a 798-bp DNA fragment (CD) at the 3' region encoding the last 14 C-terminal amino acids of FlaA. The two PCR products were digested with two restriction enzymes: AB with EcoRI and BamHI and CD with HindIII and BamHI. The resulting PCR products were cloned into the temperature-sensitive vector pAUL-A (7). (ii) To create the cheY mutant, the oligonucleotide pair E (GCGAAGCTTTCTCAAGAAGCAACGGAAGC) and F (GCGGGATCCATGAACATTGCATCGTCGAC), with a BamHI restriction site, were used to amplify a 609-bp DNA fragment (EF) of the 5' region of cheY (16) encoding the first 14 N-terminal amino acid residues. The oligonucleotide pair G (GCGGGATCCGGTTTTAGAGGCGTTAGAAAAAGC), with a BamHI restriction site, and H (GCGGAATTCAATCGCTTCTCTGTCTGGCG) served to amplify a 602-bp DNA fragment (GH) at the 3' region encoding the last 12 C-terminal amino acids of CheY. The two PCR products were digested: EF with HindIII and BamHI and GH with EcoRI and BamHI. The resulting PCR products were cloned into the vector pAUL-A. (iii) To create the cheA mutant, the oligonucleotide pair I (GCGGAATTCCAAACACCGCAAATGTTAACTC) and J (GCGGGATCCTTCTCAAGCTGTAACAGATTATC), with a BamHI restriction site, were used to amplify a 796-bp DNA fragment (IJ) of the 5' region of cheA (16) encoding the first 36 N-terminal amino acid residues. The oligonucleotide pair K (GCGGGATCCTCAGATTGCCTTTTCTGGAGC), with a BamHI restriction site, and L (GCGAAGCTTTTAGCATGCGTTTTCCTCCC) served to amplify a 857-bp DNA fragment (KL) at the 3' region encoding the last 26 C-terminal amino acids of CheA. The two PCR products were digested: IJ with EcoRI and BamHI and KL with HindIII and BamHI. The resulting PCR products were cloned into the vector pAUL-A. (iv) To create the cheYA mutant, the oligonucleotide pair M (GCGGAATTCTCTCAAGAAGCAACGGAAGC) and F (GCGGGATCCATGAACATTGCATCGTCGAC), with a BamHI restriction site, were used to amplify a 609-bp DNA fragment (MF) of the 5' region of cheY encoding the first 14 N-terminal amino acid residues. Fragment MF and fragment KL described above were digested: MF with EcoRI and BamHI and fragment KL with HindIII and BamHI. The resulting PCR products were cloned into the vector pAUL-A. Plasmids pAUL-flaA, pAUL-cheY, pAUL-cheA, and pAUL-cheYA were transformed into L. monocytogenes 12067 by electroporation. To obtain the chromosomal in-frame deletions, recombinant clones were processed as previously described (35). The appropriate gene deletions were confirmed by PCR sequencing of chromosomal DNA from mutants (data not shown).
Complementation.
For complementation of the cheY mutant, a 796-bp DNA fragment containing the cheY gene and its promoter was amplified by oligonucleotides I and J (described above). The PCR product was digested with EcoRI and BamHI and cloned into the shuttle vector pAT19 (56), creating pcheY. Plasmid pcheY was transformed into the L. monocytogenes cheY mutant by electroporation. For complementation of the cheA and cheYA mutants, a 2,685-bp DNA fragment containing the cheY and cheA genes and their promoter was amplified with oligonucleotides G (GGCGAATTCGGACGAGGGGCTTTTCTTTT) and H (GCGGGATCCCCAGGTTTCTTTTCCACTTCG). The PCR product was digested with EcoRI and BamHI and cloned into the vector pAT19, creating pcheYA. Plasmid pcheYA was transformed into L. monocytogenes cheA and cheYA mutants.
Motility assays. Swarming on soft agar was analyzed as described by Kathariou et al. (30), with some modifications. Individual colonies were transferred to a petri plate containing tryptic soy broth (Difco) with 0.25% agar, and the motility plates were incubated for 24 h at 24 or 37°C. The low density of the agar allowed the bacteria to move within the agar, forming a halo of growth around the point of inoculation. Motility was also examined by phase-contrast microscopy at a magnification of x1,000, using an Axiolab microscope (Carl Zeiss, Oberkochen, Germany) and a hanging-drop preparation from a liquid culture of L. monocytogenes grown at 24°C (optical density at 600 nm [OD600], 0.8). The behavior of the bacteria was assessed qualitatively. Linear advances were regarded as swimming, and stationary rotations were regarded as tumbling.
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting. To analyze total cell lysates of L. monocytogenes strains, sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting were performed as previously described (15). Bacteria were grown to late logarithmic growth phase (OD600, 0.8), and cell lysates of L. monocytogenes were made by sonication of cells. The samples were run on a 12.5% polyacrylamide gel and incubated with a monoclonal antibody against L. monocytogenes 4b flagellin, kindly provided by W. Donachie, Moredun Research Institute, Edinburgh, Scotland.
Electron microscopy. Bacteria from liquid cultures incubated at 24°C (OD600, 0.8) were washed twice in physiological saline buffer. A drop of bacterial suspension was placed on a carbon-coated grid. After 90 s, the excess was carefully removed and the preparations were negatively stained in 2% uranyl acetate for 45 s. Air-dried grids were examined in a Philips CM100 transmission electron microscope at 80 kV.
Infection of cell cultures. Determination of cell association and invasion of L. monocytogenes was performed as described by Larsen et al. (32), with some modifications. Enterocyte-like Caco-2 cells obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany) were cultured in Eagle's minimal essential medium (MEM) enriched with Glutamax and HEPES (Invitrogen, Tåstrup, Denmark) and supplemented with 20% heat-inactivated (30 min at 56°C) fetal calf serum (Invitrogen), 0.1 mM nonessential amino acids (Invitrogen), and 0.5 ml of gentamicin (50 mg/ml) (Invitrogen) at 37°C under 5% CO2. The cells were used at passages 10 to 15. They were trypsinized, and the cell concentration was adjusted to 5 x 105 cells per ml. They were grown without gentamicin to a monolayer (68 to 72 h at 37°C) in Eagle's MEM supplemented with 10% heat-inactivated fetal calf serum and 0.1 mM nonessential amino acids. For infection experiments, overnight bacterial cultures were diluted 25-fold and grown at 24 or 37°C with agitation until the OD600 reached 0.8. Bacteria were harvested, adjusted to approximately 3 x 106 bacteria per ml, and added to wells of 12-well plates, resulting in a multiplicity of infection of about 30 bacteria per cell. Following 1 h of incubation at 37°C, the cells were washed three times with phosphate-buffered saline (PBS). To kill extracellular bacteria, 2 ml of MEM with gentamicin (10 µg/ml) was added to the wells, and the mixture was then incubated for 1 h at 37°C under 5% CO2. The cells were washed three times and lysed by adding 1 ml of 0.1% Triton X-100. The number of viable bacteria released from the cells was assessed on agar plates. In some experiments, bacteria were centrifuged on the cells at 1,000 x g for 1.5 min. The CFU after the first 1 h of incubation reflects the bacteria associated with the monolayer (attached on the surface or at some stage of internalization). The CFU 1 h after the addition of gentamicin in the extracellular environment represents the viable bacteria that are internalized by the mammalian cells. All parameters were assayed in duplicate. Each experiment was repeated twice. The data were analyzed statistically by Student's t test.
Mouse infections. Overnight cultures of bacteria were diluted 25-fold and incubated at 24 or 37°C with agitation to an OD600 of 0.8. Bacteria were diluted in PBS prior to infection. Eight-week-old female BALB/C mice (Taconic M & B, Ry, Denmark) were infected intragastrically with 2 x 109 bacteria (five mice per group). Seven-week-old female C57BL/6 mice (WT) and TNFR-p55–/– mice (43), bred in our animal facilities, were infected intragastrically with 4 x 108 bacteria (six per group). The mice were sacrified at different times after infection, and the spleens and livers were removed and homogenized in PBS containing 0.1% Triton X-100. Tenfold serial dilutions of the lysates in PBS were plated on BHI agar plates. Colonies were counted after overnight incubation at 37°C. The data were analyzed statistically by Student's t test.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
flaA, cheY, and cheA) as well as an in-frame deletion in both the cheY and cheA genes (cheYA). These chromosomal mutants were obtained by allelic exchange in L. monocytogenes strain 12067. This WT strain was chosen for construction of mutants since the only flaA. cheY, and cheA sequences available at the time this project was initiated were those from L. monocytogenes strain 12067 (15, 16). The phenotype of the mutants were analyzed by semisolid swarm plate assays (Fig. 1A). After incubation at 24°C, the WT strain showed good swarming, with concentric rings that increased with the period of incubation. The flaA mutant did not show swarming and produced small, compact colonies with sharp boundaries. The cheY and the cheYA mutants formed a small fuzzy-looking swarm ring, while the colonies of the cheA mutant showed swarming, but the swarm ring was much smaller than that of the WT, indicating that cheY is required for swarming and that cheA is contributing to a lesser degree. At 37°C, none of the strains showed swarming (Fig. 1B). None of the four mutants were affected for growth rate in BHI medium (data not shown).
|
cheY, cheA, and cheYA mutants and WT bacteria showed similar flagellin levels (Fig. 2). Microscopic examination of cells grown in liquid culture to late-logarithmic phase showed that the cheY, cheA, and cheYA mutants all had flagella (Fig. 3). As expected, no flagella and flagellin were detected in the flaA mutant as analyzed by electron microscopy or Western blotting, respectively (Fig. 2 and 3). Phase-contrast microscopy revealed that the cheY, cheA, and cheYA mutants were all motile and showed only tumbling behavior whereas the WT showed tumbling and smooth swimming.
|
|
cheY mutant, the vector pAT19 containing the cheY gene and its promoter region (pcheY) was introduced into the cheY mutant. For complementation of the cheA and the cheYA mutants, pAT19 containing the cheY and cheA genes and their promoter (pcheYA) was introduced into the cheA and cheYA mutants. As controls, the WT and the cheY, cheA, and cheYA mutants carrying the vector without inserts were used. On semisolid agar, swarming of the complemented mutants was restored (Fig. 4). Phase-contrast microscopy demonstrated that the three complemented strains showed both tumbling and smooth swimming like the WT. None of the phenotypes were restored by the plasmid vector alone.
|
flaA, cheY, cheA, and cheYA mutants to associate with and invade the human enterocyte-like cell line Caco-2 was analyzed. Caco-2 cell association was significantly reduced for the mutants grown at 24°C compared to the WT strain (10.6 to 12.7% of control values; P < 0.001) (Table 1). Likewise, invasion by the mutant bacteria was significantly reduced in comparison to that of the WT strain (P < 0.001), with levels from 1.4 to 7.0% of the wild-type values. To further determine if the reduced invasion capacity of the flaA and cheYA mutants was due to impaired locomotion, the bacteria were centrifuged onto the monolayers prior to the invasion assay. Centrifugation increased cell association to 78.8 and 75.8% of the WT values, respectively, indicating that flagella and chemotaxis are important to ensure that bacteria contact host cells. However, cell association was still lower than that of the WT strain (P < 0.005) (Table 1).
|
cheYA mutant grown at 37°C was only slightly reduced as compared to that of the WT strain. No differences in cell association between the WT strain and the flaA mutant grown at 37°C were observed. The mutant and WT strains grown at 37°C showed similar invasion ability (Table 1).
Virulence of flaA and cheYA mutants in WT and TNFR-p55–/– mice.
To analyze the effect of deleting the flaA and cheYA genes on the virulence of L. monocytogenes, bacterial levels in mice intragastrically (i.g.) infected with flaA and cheYA mutants were compared to those infected with the WT strain. In a first series of experiments, we observed that spleens of BALB/c mice 3 days after i.g. infection with the flaA mutant showed 100-fold larger bacterial numbers than did the spleens of mice infected with the WT strain (Fig. 5A). Spleens of mice infected i.g. with the cheYA or WT L. monocytogenes strain showed similar bacterial levels. No differences in bacterial numbers in spleens were observed when the flaA, and cheYA mutants and WT L. monocytogenes were grown at 37°C (Fig. 5B). These results indicate that abolished expression of the flaA gene increases the virulence of L. monocytogenes in BALB/c mice compared to the flagellated WT strain and the cheYA mutant.
|
flaA and cheYA mutants, the bacterial load in mice deficient in TNFR-p55, the main TNF receptor, was measured. TNFR-p55–/– mice have been previously shown to possess a dramatically increased susceptibility to L. monocytogenes (43, 47). The susceptibility of TNFR-p55–/– mice to WT L. monocytogenes and to the flaA and cheYA mutants grown at 24°C was compared. The spleens and livers from TNFR-p55–/– mice showed a dramatically increased number of WT L. monocytogenes bacteria compared to the same organs of C57BL/6 control mice (Fig. 6). Differences in bacterial numbers in organs from control and TNFR-p55–/– mice were significantly smaller when mice were infected with flaA or cheYA mutants. Moreover, bacterial numbers of the flaA mutant recovered from the spleens of control and TNFR-p55–/– mice were similar (Fig. 6). Also, similar levels of flaA and cheYA in the livers of TNFR-p55–/– mice and WT mice were found (Fig. 6). This suggests that flagellin and cheYA-encoded polypeptides participate in bacterial invasion but the presence of flagella is deleterious to systemic infection, which seems to be dependent on the TNF-p55 receptor.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Phenotypic characterization of the mutants showed that the deletion mutant with a mutation in flaA was completely defective in the production of flagella and motility. Analysis of the mutants with deletions in cheY and cheA showed impaired swarming and tumbling behavior during motility. Trans-complementation of the cheY, cheA, and cheYA mutants restored swarming and smooth swimming behavior, indicating that the mutations had no polar effects. In B. subtilis. cheY and cheA null mutants are tumbly, in contrast to E. coli, where cheY and cheA null mutants exhibit a smooth-swimming phenotype (5, 22, 28). These data suggest that the cheY and cheA gene products of L. monocytogenes contribute to chemotactic signal transduction, as suggested from the amino acid sequence similarity (16), and that the mechanism by which they confer their control may be similar to the mechanism in B. subtilis.
The flagellum (flaA) and chemotaxis (cheY, cheA, cheYA) mutants had a reduced capacity to associate with cells when the bacteria were grown at 24°C, and centrifugation of bacteria onto cells could only partly complement this. In accordance with observations that the production of flagella is markedly reduced at 37°C (42), the ability of the aflagellate flaA and chemotaxis cheYA mutants to associate with cells was only slightly decreased when they were grown at 37°C prior to infection. These findings suggest that flagella and chemotaxis are important to ensure that L. monocytogenes contacts host cells, as also suggested by Flanary et al. (21). The fact that centrifugation did not completely revert the phenotype suggests a role of flagella in adhesion or invasion other than locomotion. On centrifugation, the cheYA mutant was more invasive than the flaA mutant, probably due to the presence of flaA. It has been suggested that components of bacterial flagella can act as adhesins and mediate the binding to host cells and mucosal surfaces (2, 59). Similar effects of mutations in motility-related genes on cell association have been shown for other bacteria. For example, mutations in the Yersinia enterocolitica flhDC or fliA genes, which are transcriptional regulators of the flagellar regulon and are required for the expression of motility (29, 61), affect the effective migration of bacteria to the host cells (60), and in S. enterica serovar Enteritidis the flagella assist in colonization of epithelial cells by enabling motility rather than providing an adhesin (12). The importance of chemotaxis of L. monocytogenes in the interactions with cells has been previously studied by using a chemotaxis mutant of L. monocytogenes strain NCTC 10527 with a transposon insertion in the promoter region of the cheYA operon. This strain was impaired in cell association but not in invasion of fibroblasts (21).
Spleens from i.g. infected BALB/c and C57BL/6 mice contained larger numbers of the flaA mutant than of the WT strain, whereas spleens from mice infected with cheYA and WT L. monocytogenes strains contained similar bacterial numbers, indicating that the presence of flagella is deleterious to systemic infection. In fact, L. monocytogenes is able to repress flagellar expression at 37°C (42). This temperature regulation might serve as a mechanism to evade recognition by the innate immune system in the host. Interestingly, when comparing L. monocytogenes with the nonpathogenic but closely related species L. innocua, Kathariou et al. (30) found that the repression of flagellin in L. innocua was not as strong as the repression in L. monocytogenes. The discrepancy of the in vivo virulence test of the flaA mutant with the in vitro invasion experiments with this mutant can be reconciled through the observation that the flaA mutant were present at lower levels than WT bacteria in TNFR-p55–/– mice. The data suggest that the flagella of L. monocytogenes are important for triggering TNF-mediated growth control of L. monocytogenes. These data correspond to previous reports that flagella from gram-negative bacteria such as S. enterica serovar Enteritidis, P. aeruginosa, and Y. enterocolitica induce the production of cytokines, e.g., TNF- and interleukin-1 (8, 9, 58). Interestingly, it has been shown that two regions in the conserved N- and C-terminal parts of the flagellin of E. coli are required for interleukin-8 release and TLR5 activation in a human epithelial cell line (14). Likewise, it was demonstrated that the N- and C-terminal regions of S. enterica serovar Dublin flagellin induce TNF- production in monocyte cell lines (19). The N- and C-terminal regions are conserved across bacteria, and a considerable degree of homology was also found to these regions of the flagellin of L. monocytogenes (15), suggesting a potential role of those conserved domains of flagellin of L. monocytogenes in activation of the innate immune response. Indeed, the TLR5 recognition site of flagellin has been mapped to highly conserved N- and C-terminal amino acids which are present in flagellin of L. monocytogenes (52). Moreover, a recent study, based on conformation analysis, has predicted that a region in the N-terminal domain of flagellin of L. monocytogenes is involved in binding to TLR5. This region overlaps with the N-terminal binding site (27). However, mice deficient in the adaptor protein MyD88, which is required for TLR signaling (1, 38), contained only slightly augmented bacterial numbers of WT L. monocytogenes in their spleens (unpublished results), indicating that TNF-mediated control of L. monocytogenes is at least partially MyD88 independent.
Factors other than temperature can stimulate the expression of L. monocytogenes flagellin, which is present in trace amounts at 37°C (42). Indeed, flagellin expression is regulated by osmolarity (49). Thus, we propose that the observed effect of flagella and chemotaxis on cell invasion and the suspected role of flagella in TNF induction may be relevant to the biology of infection with L. monocytogenes.
|
ACKNOWLEDGMENTS |
|---|
We thank T. Chakraborty (Institut für Medizinische Mikrobiologie, Justus-Liebig-Universität, Giessen, Germany) for the kind gift of the pAUL-A plasmid. We also thank Michael Engelbrecht Nielsen for assistance with various aspects of this project and Jannie Jørgensen and Jan Pedersen for excellent technical assistance.
|
FOOTNOTES |
|---|
Present address: Chr. Hansen A/S, 2970 Hørsholm, Denmark.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
| 1. | Aderem, A., and R. J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature 406:782-787.[CrossRef][Medline] |
| 2. | Arora, S. K., B. W. Ritchings, E. C. Almira, S. Lory, and R. Ramphal. 1998. The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect. Immun. 66:1000-1007. |
| 3. | Beretich, G. R., Jr., P. B. Carter, and E. A. Havell. 1998. Roles for tumornecrosis factor and gamma interferon in resistance to enteric listeriosis. Infect.Immun. 66:2368-2373. |
| 4. | Bischoff, D. S., R. B. Bourret, M. L. Kirsch, and G. W. Ordal. 1993. Purification and characterization of Bacillus subtilis CheY. Biochemistry 32:9256-9261.[CrossRef][Medline] |
| 5. | Bischoff, D. S., and G. W. Ordal. 1991. Sequence and characterization of Bacillus subtilis CheB, a homolog of Escherichia coli CheY, and its role in a different mechanism of chemotaxis. J. Biol. Chem. 266:12301-12305. |
| 6. | Cario, E., and D. K. Podolsky. 2000. Differential alteration in intestinal epithelial cell expression of Toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect. Immun. 68:7010-7017. |
| 7. | Chakraborty T., M. Leimeister-Wächter, E. Domann, M. Hartl, W. Goebel, T. Nichterlein, and S. Notermans. 1992. Coordinate regulation of virulence genes in Listeria monocytogenes requires the product of the prfA gene. J. Bacteriol. 174:568-574. |
| 8. | Ciacci-Woolwine, F., I. C. Blomfield, S. H. Richardson, and S. B. Mizel. 1998. Salmonella flagellin induces tumor necrosis factor alpha in a human promonocytic cell line. Infect. Immun. 66:1127-1134. |
| 9. | Ciacci-Woolwine, F., P. F. McDermott, and S. B. Mizel. 1999. Induction of cytokine synthesis by flagella from gram-negative bacteria may be dependent on the activation or differentiation state of human monocytes. Infect. Immun. 67:5176-5185. |
| 10. | Cossart, P., and M. Lecuit. 1998. Interactions of Listeria monocytogenes with mammalian cells during entry and actin-based movement: bacterial factors, cellular ligands and signaling. EMBO J. 17:3797-3806.[CrossRef][Medline] |
| 11. | Dabiri, G. A., J. M. Sanger, D. A. Portnoy, and F. S. Southwick. 1990. Listeria monocytogenes moves rapidly through the host-cell cytoplasm by inducing directional actin assembly. Proc. Natl. Acad. Sci. USA 87:6068-6072. |
| 12. | Dibb-Fuller, M. P., E. Allen-Vercoe, C. J. Thorns, and M. J. Woodward. 1999. Fimbriae- and flagella-mediated association with and invasion of cultured epithelial cells by Salmonella enteritidis. Microbiology 145:1023-1031.[Abstract] |
| 13. | Dietrich, C., K. Heuner, B. C. Brand, J. Hacker, and M. Steinert. 2001. Flagellum of Legionella pneumophila positively affects the early phase of infection of eukaryotic host cells. Infect. Immun. 69:2116-2122. |
| 14. | Donelly, M. A., and T. S. Steiners. 2002. Two nonadjacent regions in enteroaggregative Escherichia coli flagellin are required for activation of toll-like receptor 5. J. Biol. Chem. 277:40456-40461. |
| 15. | Dons, L., O. F. Rasmussen, and J. E. Olsen. 1992. Cloning and characterization of a gene encoding flagellin of Listeria monocytogenes. Mol. Microbiol. 6:2919-2929.[Medline] |
| 16. | Dons, L., J. E. Olsen, and O. F. Rasmussen. 1994. Characterization of two putative Listeria monocytogenes genes encoding polypeptides homologous to the sensor protein CheA and the response regulator CheY of chemotaxis. DNA Sequence 4:301-311.[Medline] |
| 17. | Dramsi, S., C. Kocks, C. Forestier, and P. Cossart. 1993. Internalin-mediated invasion of epithelial cells by Listeria monocytogenes is regulated by the bacterial growth state, temperature and the pleiotropic activator PrfA. Mol. Microbiol. 9:931-941.[Medline] |
| 18. | Eaton, K. A., S. Suerbaum, C. Josenhans, and S. Krakowka. 1996. Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes. Infect. Immun. 64:2445-2448.[Abstract] |
| 19. | Eaves-Pyles, T. D., H. R. Wong, K. Odoms, and R. B. Pyles. 2001. Salmonella flagellin-dependent proinflammatory responses are localized to the conserved amino and carboxyl regions of the protein. J. Immunol. 167:7009-7016. |
| 20. | Farber, J. M., and P. I. Peterkin. 1991. Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev. 55:476-511. |
| 21. | Flanary, P. L., R. D. Allen, L. Dons, and S. Kathariou. 1999. Insertional activation of the Listeria monocytogenes cheYA operon abolishes response to oxygen gradients and reduces the number of flagella. Can. J. Microbiol. 45:646-652.[CrossRef][Medline] |
| 22. | Fuhrer, D. K., and G. W. Ordal. 1991. Bacillus subtilis CheN, a homolog of CheA, the central regulator of chemotaxis in Escherichia coli. J. Bacteriol. 173:7443-7448. |
| 23. | Garrity, L. F., and G. W. Ordal. 1995. Chemotaxis in Bacillus subtilis: how bacteria monitor environmental signals. Pharmacol. Ther. 68:87-104.[CrossRef][Medline] |
| 24. | Garrity, L. F., and G. W. Ordal. 1997. Activation of the CheA kinase by asparagine in Bacillus subtilis chemotaxis. Microbiology 143:2945-2951. |
| 25. | Grant, C. C. R., M. E. Konkel, W. Cieplak, Jr., and L. S. Tompkins. 1993. Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures. Infect. Immun. 61:1764-1771. |
| 26. | Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 410:1099-1103.[CrossRef][Medline] |
| 27. | Jacchieri, S. G., R. Torquato, and R. R. Brentani. 2003. Structural study of binding of flagellin by toll-like receptor 5. J. Bacteriol. 185:4243-4247. |
| 28. | Jones, B. D., C. A. Lee, and S. Falkow. 1992. Invasion by Salmonella typhimurium is affected by the direction of flagellar rotation. Infect. Immun. 60:2475-2480. |
| 29. | Kapatral, V., J. W. Olson, J. C. Pepe, V. L. Miller, and S. A. Minnich. 1996. Temperature-dependent regulation of Yersinia enterocolitica class III flagellar genes. Mol. Microbiol. 19:1061-1071.[CrossRef][Medline] |
| 30. | Kathariou, S., R. Kanenaka, R. D. Allen, A. K. Fok, and C. Mizumoto. 1995. Repression of motility and flagellin production at 37°C is stronger in Listeria monocytogenes than in the nonpathogenic species Listeria innocua. Can. J. Microbiol. 41:572-577.[Medline] |
| 31. | Kirschning, C. J., and S. Bauer. 2001. Toll-like receptors: cellular signal transducers for exogenous molecular patterns causing immune responses. Int. J. Med. Microbiol. 291:251-260.[CrossRef][Medline] |
| 32. | Larsen, C. N., B. Nørrung, H. M. Sommer, and M. Jakobsen. 2002. In vitro and in vivo invasiveness of different pulsed-field gel electrophoresis types of Listeria monocytogenes. Appl. Environ. Microbiol. 68:5698-5703. |
| 33. | Leimeister-Wächter, M., E. Domann, and T. Chakraborty. 1992. The expression of virulence genes in Listeria monocytogenes is thermoregulated. J. Bacteriol. 174:947-952. |
| 34. | Leimeister-Wächter, M., C. Haffner, E. Domann, W. Goebel, and T. Chakraborty. 1990. Identification of a gene that positively regulates expression of listeriolysin, the major virulence factor of Listeria monocytogenes. Proc. Natl. Acad. Sci. USA 87:8336-8340. |
| 35. | Lingnau, A., E. Domann, M. Hudel, M. Bock, T. Nichterlein, J. Wehland, and T. Chakraborty. 1995. Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms. Infect. Immun. 63:3896-3903.[Abstract] |
| 36. | Liu, S. L., T. Ezaki, H. Miura, K. Matsui, and E. Yabuuchi. 1988. Intact motility as a Salmonella typhi invasion-related factor. Infect. Immun. 56:1967-1973. |
| 37. | Marco, A. J., N. Prats, J. A. Ramos, V. Briones, M. Blanco, L. Dominguez, and M. Domingo. 1992. A microbiological, histopathological and immunohistological study of the intragastric inoculation of Listeria monocytogenes in mice. J. Comp. Pathol. 107:1-9.[CrossRef][Medline] |
| 38. | Medzhitov, R., and C. Janeway, Jr. 2000. Innate immune recognition: mechanisms and pathways. Immunol. Rev. 173:89-97.[CrossRef][Medline] |
| 39. | Mengaud, J., S. Dramsi, E. Gouin, J. A. Vázquez-Boland, G. Milon, and P. Cossart. 1991. Pleiotropic control of Listeria monocytogenes virulence factors by a gene that is autoregulated. Mol. Microbiol. 5:2273-2283.[Medline] |
| 40. | Muzio, M., N. Polentarutti, D. Bosisio, P. P. Manoj Kumar, and A. Mantovani. 2000. Toll-like receptor family and signalling pathway. Biochem. Soc. Trans. 28:563-566.[Medline] |
| 41. | O'Toole, R., D. L. Milton, and H. Wolf-Watz. 1996. Chemotactic motility is required for invasion of the host by the fish pathogen Vibrio anguillarum. Mol. Microbiol. 19:625-637.[CrossRef][Medline] |
| 42. | Peel, M., W. Donachie, and A. Shaw. 1988. Temperature-dependent expression of flagella of Listeria monocytogenes studied by electron microscopy, SDS-PAGE and Western blotting. J. Gen. Microbiol. 134:2171-2178.[Medline] |
| 43. | Pfeffer, K., T. Matsuyama, T. M. Kündig, A. Wakeham, K. Kishihara, A. Shahinian, K. Wiegmann, P. S. Ohashi, M. Krönke, and T. W. Mak. 1993. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell. 73:457-467.[CrossRef][Medline] |
| 44. | Pron, B., C. Boumaila, F. Jaubert, S. Sarnacki, J.-P. Monnet, P. Berche, and J.-L. Gaillard. 1998. Comprehensive study of the intestinal stage of listeriosis in a rat ligated ileal loop system. Infect. Immun. 66:747-755. |
| 45. | Rabaan, A. A., I. Gryllos, J. M. Tomás, and J. G. Shaw. 2001. Motility and the polar flagellum are required for Aeromonas caviae adherence to Hep-2 cells. Infect. Immun. 69:4257-4267. |
| 46. | Richardson, K. 1991. Roles of motility and flagellar structure in pathogenicity of Vibrio cholerae: analysis of motility mutants in three animal models. Infect. Immun. 59:2727-2736. |
| 47. | Rothe, J., W. Lesslauer, H. Lötscher, Y. Lang, P. Koebel, F. Köntgen, A. Althage, R. Zinkernagel, M. Steinmetz, and H. Bluethmann. 1993. Mice lacking the tumour necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly susceptible to infection by Listeria monocytogenes. Nature 364:798-802.[CrossRef][Medline] |
| 48. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 49. | Sanchez-Campillo, M., S. Dramsi, J. M. Gómez-Gómez, E. Michel, P. Dehoux, P. Cossart, F. Baquero, and J. C. Pérez-Díaz. 1995. Modulation of DNA topology by flaR, a new gene from Listeria monocytogenes. Mol. Microbiol. 18:801-811.[CrossRef][Medline] |
| 50. | Schuchat, A., B. Swaminathan, and C. V. Broome. 1991. Epidemiology of human listeriosis. Clin. Microbiol. Rev. 4:169-183. |
| 51. | Seeliger, H. P. R., and D. Jones. 1986. Genus Listeria pirie, 1940, p. 1235-1245. In P. H. A. Sneath, N. S. Mair, N. E. Sharpe, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. The Williams & Wilkins Co., Baltimore, Md. |
| 52. | Smith, K. D., E. Andersen-Nissen, F. Hayashi, K. Strobe, M. A. Bergman, S. L. Barrett, B. T. Cookson, and A. Aderem. 2003. Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility. Nat. Immunol. 4:1247-1253.[CrossRef][Medline] |
| 53. | Stock, J. B., and M. G. Surette. 1996. Chemotaxis, p. 1103-1129. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 54. | Tasteyre, A., M.-C. Barc, A. Collignon, H. Boureau, and T. Karjalainen. 2001. Role of FliC and FliD flagellar proteins of Clostridium difficile in adherence and gut colonization. Infect. Immun. 69:7937-7940. |
| 55. | Tilney, L. G., and D. A. Portnoy. 1989. Actin filaments and the growth, movement, and spread of the intracellular bacterial parasite, Listeria monocytogenes. J. Cell Biol. 109:1597-1608. |
| 56. | Trieu-Cuot, P., C. Carlier, C. Poyart-Salmeron, and P. Courvalin. 1991. Shuttle vectors containing a multiple cloning site and a lacZ gene for conjugal transfer of DNA from Escherichia coli to Gram-positive bacteria. Gene 102:99-104.[CrossRef][Medline] |
| 57. | Vázquez-Boland, J. A., M. Kuhn, P. Berche, T. Chakraborty, G. Domínguez-Bernal, W. Goebel, B. González-Zorn, J. Wehland, and J. Kreft. 2001. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14:584-640. |
| 58. | Wyant, T. L, M. K. Tanner, and M. B. Sztein. 1999. Salmonella typhi flagella are potent inducers of proinflammatory cytokine secretion by human monocytes. Infect. Immun. 67:3619-3624. |
| 59. | Yao, R., D. H. Burr, P. Doig, T. J. Trust, H. Niu, and P. Guerry. 1994. Isolation of motile and non-motile insertional mutants of Campylobacter jejuni: the role of motility in adherence and invasion of eukaryotic cells. Mol. Microbiol. 14:883-893.[Medline] |
| 60. | Young, G. M., J. L. Badger, and V. L. Miller. 2000. Motility is required to initiate host cell invasion by Yersinia enterocolitica. Infect. Immun. 68:4323-4326. |
| 61. | Young, G. M., M. J. Smith, S. A. Minnich, and V. L. Miller. 1999. The Yersinia enterocolitica motility master regulatory operon, flhDC, is required for flagellin production, swimming motility, and swarming motility. J. Bacteriol. 181:2823-2833. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
