Previous Article | Next Article ![]()
Infection and Immunity, July 2004, p. 3968-3973, Vol. 72, No. 7
0019-9567/04/$08.00+0 DOI: 10.1128/IAI.72.7.3968-3973.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Department of Applied Oral Sciences Faculty of Dentistry,1 Department of Microbiology and Immunology, Faculty of Medicine, Dalhousie University, Halifax, Nova Scotia, Canada B3H 3J52
Received 30 October 2003/ Returned for modification 6 February 2004/ Accepted 25 March 2004
|
|
|---|
|
|
|---|
In bacteria, two-component regulatory systems are known to function in virulence, adaptation, and survival (12). A typical two-component system consists of a membrane-bound sensor histidine kinase and a cytoplasmic responder protein. The sensor protein senses changes in the environment, and the responder protein regulates gene expression. Relevant to this study, a two-component regulatory system named covRS (also termed csrRS) has been described for Streptococcus pyogenes (7, 17). CovRS is encoded by the covRSX operon, in which covR codes for the responder and covS codes for the sensor. The identity and function of CovX remain unclear. CovRS has been shown to negatively regulate capsular hyaluronic acid production, streptokinase, streptolysin S, mitogenic factor SpeMF, cysteine protease SpeB, and a Mac-1-like protein in S. pyogenes (9). In vitro studies have shown that CovR binds to the promoters of several of these virulence genes (8, 22). Recently, Biswas and Scott (2) showed that a positive regulator, RocA, activates covR expression in S. pyogenes. In contrast, the regulation of virulence genes in S. mutans is less well understood.
In this study, a two-component regulatory system encoded by the covRSX operon from S. mutans was isolated and insertionally inactivated. S. mutans CovRS was shown to negatively regulate FTF expression and the production of a novel glucose- and glucuronic acid-containing extracellular carbohydrate.
|
|
|---|
Cloning and sequencing of the cov operon from S. mutans NG8. A 3,102-bp DNA fragment carrying the entire cov operon was amplified from the chromosome of S. mutans NG8 by PCR with Taq DNA polymerase and primers SL178 (AGCCCGGGTTCTAACATAAAGTTTA; SmaI site is underlined) and SL179 (ACGGTACCTAAAGTCTTCTGCCAGTTT; KpnI site is underlined). The primer sequences were derived from BLAST searching of the S. mutans UA159 genome at the University of Oklahoma (www.genome.ou.edu) by using the S. pyogenes covR gene as the query sequence (GenBank accession number AF082668). The forward primer, SL178, was designed to include a 133-bp upstream sequence from covR (Fig. 1A). The reverse primer, SL179, included 143 bp from the stop codon of covX. The PCR conditions were as previously described (13). The PCR product was digested with KpnI and SmaI and cloned into KpnI-HincII-digested pUC18. The resulting plasmid, pCovRSX/18, was maintained in E. coli XL-1 Blue. The covRSX operon was further subcloned as overlapping DNA fragments (1-kb SphI-MscI, 0.9-kb HpaI-HindII, and 1.1-kb HindIII-BglII fragments) in pUC18 (Fig. 1A). The cloned DNA fragments were sequenced with M13 forward and reverse primers (Applied Biosystems-Dalhousie University-National Research Council of Canada joint laboratory facilities).
![]() View larger version (23K): [in a new window] |
FIG. 1. covRSX operon of S. mutans NG8. (A) Organization of the genes within the operon. The restriction sites are HindIII (Hd), HpaI (H), MscI (M), SalI (S), and BglII (B). The lollipop indicates the putative Rho-independent terminator. The thick lines under the operon are the fragments subcloned for sequencing. (B) cov operon with the insertion of pVA981 (Tetr) in covR. The 10.5-, 7.5-, 2.6-, and 0.9-kb DNA fragments observed in Southern hybridization are indicated. The 10.5- and 7.5-kb fragments were generated because of the SalI and HindIII sites from pVA981. (C) Promoter region of the operon. Arrows indicate inverted repeats. The predicted transcriptional start site (T), Shine-Dalgarno (S.D.) sequence, and 10 and 35 sequences are shown in bold type.
|
To create a construct for complementation, DNA representing the cov operon from pCovRSX/18 was subcloned into the E. coli-streptococcus shuttle vector pDL276 (Kanr) (6). This procedure was achieved by ligating the 3.1-kb KpnI-SphI fragment from pCovRSX/18 into the same sites of pDL276. The resulting plasmid, pCovRSX/276, was introduced into the covR mutant by natural transformation. Transformants were selected on Todd-Hewitt agar containing tetracycline and kanamycin.
Southern hybridization. Isolation of chromosomal DNA from S. mutans and blotting of HindIII- or SalI-digested DNA onto nylon membranes were performed as described previously (28). DNA probes were prepared from pVA981, the 533-bp MscI-HindIII covS internal fragment, and pCovR/18 by using an enhanced chemiluminescence direct labeling and detection system (Amersham Pharmacia Biotechnology Inc., Baie d'Urfé, Quebec, Canada). Southern hybridization and signal detection were performed according to the manufacturer's instructions.
RNA isolation and reverse transcription. RNA was isolated from S. mutans by a previously described method with modifications (28). Briefly, 50 ml of prewarmed Todd-Hewitt broth was inoculated (1:1) with an overnight culture, and the mixture was incubated for 1.5 h at 37°C. Glycine (5% [wt/vol]) was added, and the mixture was further incubated for 1 h at 37°C. Cells were harvested by centrifugation, washed with cold phosphate-buffered saline, and resuspended in 0.8 ml of a buffer containing 50 mM glucose, 25 mM Tris [pH 8], 1 mM EDTA, and 1 kU of mutanolysin (Sigma-Aldrich Canada Ltd., Oakville, Ontario, Canada). After incubation at 37°C for 15 min, the cells were centrifuged, vortexed in 700 µl of Trizol reagent (Invitrogen Life Technologies, Burlington, Ontario, Canada) for 2 min, cooled on ice for 5 min, and extracted with chloroform. RNA was precipitated from the aqueous layer with isopropanol and washed with 70% ethanol. The pellet was resuspended in 200 µl of diethyl pyrocarbonate (DEPC)-treated water and treated with 20 U of RNase-free DNase (Invitrogen), followed by extraction with phenol and then chloroform. The RNA was dissolved in 200 µl of DEPC-treated water and stored at 70°C.
Reverse transcription was carried out with Superscript II (Invitrogen) in a 20-µl reaction mixture containing 4 µg of total RNA and 3 µg of random primers according to the manufacturer's instructions. In control tubes, Superscript II was omitted from the reaction. Following reverse transcription, the mixture was diluted fourfold in DEPC-treated water, and 4 µl was used for PCR. The primers used for the amplification of ftf were SL184 (GCAGATGAAGCCAATTC) and SL185 (ACAAGATAGCGATCTCC), and those used for the amplification of recA were SL194 (GGGCCGGAATCTTCTG) and SL195 (GTACCAAGCTCCAGCTT). The SL184-SL185 primer pair was designed to amplify a 1-kb internal fragment of ftf, while the SL194-SL195 primer pair was designed to amplify a 0.6-kb internal fragment of recA. The PCR products were analyzed on 1% agarose gels.
SDS-PAGE and Western immunoblotting. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) was performed with 7.5% gels as described by Laemmli (16). Western immunoblotting was performed by the method of Towbin et al. (27). Nitrocellulose blots were probed with a mouse polyclonal antibody raised against the 66-kDa trypsin fragment of FTF (1/5,000; see below), anti-antigen P1 monoclonal antibody 4-10A (1/7,000; courtesy of A. S. Bleiweis, University of Florida, Gainesville), or a rabbit polyclonal anti-FTF antibody (1/100; courtesy of R. R. B. Russell, University of Newcastle, Newcastle upon Tyne, United Kingdom), followed by a goat anti-mouse or anti-rabbit immunoglobulin G-alkaline phosphatase conjugate (Sigma-Aldrich).
Trypsin digestion and N-terminal sequencing. Cells from late-exponential-phase cultures grown in FMC medium (5 ml) were washed with phosphate-buffered saline and resuspended to the same cell density in 200 µl of 50 mM potassium phosphate buffer (pH 7.4) containing 100 µg of sequencing-grade trypsin (Boehringer Mannheim Canada, Laval, Quebec, Canada)/ml. The cell suspension was incubated with gentle rotation at 37°C for 1 h, at which time the cells were pelleted by centrifugation (10 min, 10,000 x g). The clear supernatant was saved, and 20-µl aliquots were analyzed by SDS-PAGE. The 66-kDa protein band from the tryptic digest of covR cells was transferred to polyvinylidene difluoride membranes, and its N-terminal sequence was determined by microsequencing (National Research Council of Canada, Montreal, Quebec, Canada).
FTF assay. The FTF activity of the 66-kDa protein was assayed as described by Aduse-Opoku et al. (1). Briefly, following SDS-PAGE, the protein was renatured by washing with five changes of Tris buffer (pH 8.0) for 1 h and incubated with 1% raffinose-1% Triton X-100-0.01% dextran T10 (Sigma-Aldrich)-50 mM sodium phosphate (pH 6.5) for 8 h. The fructan synthesized appeared as an opaque band.
Generation of an antibody against the tryptic digest containing the 66-kDa protein. Six-week-old BALB/c mice (n = 6) were each immunized intraperitoneally with 40 µg of protein from the tryptic digest of covR cells in Freund's complete adjuvant. The animals were boosted with the same amount of antigen in incomplete adjuvant 14 days later. At 21 days, the animals were euthanatized, and serum was collected following heart puncture. The antiserum obtained was referred to as the anti-66-kDa FTF antibody.
Preparation and analysis of extracellular carbohydrates. Late-exponential-phase cultures (50 ml) of S. mutans grown in FMC-glucose medium were centrifuged. Four volumes of ice-cold acetone were added to the culture supernatant, and carbohydrates were precipitated at 4°C for 24 h. The carbohydrates were recovered by centrifugation, dissolved in 1 ml of distilled water, and reprecipitated with acetone as described above. The pellets obtained from the second precipitation were washed three times with cold acetone, air dried, and dissolved in distilled water. The cells were stirred in 1 M KOH at 4°C for 2 h (10), and the extracted carbohydrates were recovered by centrifugation and dialyzed against water. The carbohydrates were freeze-dried and stored at 20°C. The materials recovered from the culture supernatant and cells were designated extracellular and cell-bound carbohydrates, respectively. Preliminary results showed that the amounts of carbohydrates recovered from the cells were very low and that there were no major differences in the amounts of cell-bound carbohydrates between the mutants and the wild type. Therefore, subsequent experiments focused on extracellular carbohydrates.
Total carbohydrate and uronic acid contents in nonhydrolyzed samples were measured with phenol-sulfuric acid (5) and m-hydroxydiphenyl (3) and with glucose and glucuronic acid as the standards, respectively. To analyze sugar compositions, aliquots (2 mg) of extracellular carbohydrates were hydrolyzed in 2 N trifluoroacetic acid at 121°C for 1 h. The hydrolysates were dried by using a rotary evaporator under reduced pressure at 40°C. The residues obtained were dissolved in 0.5 ml of water and analyzed by ascending paper chromatography on Whatman no. 1 chromatography paper with the solvent system pyrindine-ethyl acetate-water (4:10:3). Glucose, fructose, galactose, rhamnose, glucuronic acid, and N-acetylglucosamine were used as the standards. Sugars were revealed by staining the paper with alkaline silver oxide reagents (21). Fructose in hydrolyzed samples was also measured enzymatically by using a fructose assay kit (Sigma-Aldrich).
Analysis of band intensities. The relative intensities of bands in Western blots and DNA gels were analyzed by using NIH Image software (National Institutes of Health, Bethesda, Md.). For estimation of the ftf transcripts, the bands were normalized to the recA bands.
Nucleotide sequence accession number. The sequence described in this study can be obtained at GenBank accession number AF393849.
|
|
|---|
Construction of a covR mutant. A covR mutant of S. mutans NG8 was constructed by insertion of pVA981 through homologous recombination with pCovR/981. Following transformation of S. mutans NG8 with pCovR/981, five tetracycline-resistant transformants were obtained. The five transformants showed autoaggregation during growth in broth cultures, and one of them was selected for further study.
Southern analysis showed that the pVA981 probe hybridized to 7.5- and 2.6-kb HindIII fragments from the covR mutant DNA, while no signal was obtained from the NG8 DNA (Fig. 2A). When the DNA was hybridized with the covS probe, a 10.5-kb SalI DNA fragment was obtained from the covR mutant DNA and a high-molecular-weight band was observed for the NG8 DNA (Fig. 2B). Computer analysis of the S. mutans genome showed that the closest SalI site upstream of that found in covS is 54 kb away. Therefore, the high-molecular-weight NG8 DNA band represented the expected 54-kb SalI fragment. In contrast, the integration of pVA981 into covR introduced a new SalI site (from the pVA981 sequence) upstream of covS, resulting in the appearance of the 10.5-kb band. In addition, when the DNA was hybridized with the pCovR/18 probe, the expected 2.6-kb HindIII fragment was observed for NG8, while three fragments of the expected sizes (7.5, 2.6, and 0.9 kb) were observed for the covR mutant (Fig. 2C). These hybridization patterns further confirmed the insertion of pVA981 into the covR gene of S. mutans (Fig. 1B).
![]() View larger version (77K): [in a new window] |
FIG. 2. Southern hybridization of S. mutans NG8 DNA (lanes 1) and covR mutant DNA (lanes 2). (A) DNAs were digested with HindIII and probed with the pVA981 probe. (B) DNAs were digested with SalI and probed with an internal covS fragment. (C) HindIII-digested DNAs were probed with a 400-bp internal covR fragment carried on pUC18. The location of the 1-kb DNA ladder is indicated.
|
The extensive aggregation displayed by the mutant suggested changes on the cell surface. Therefore, the cells were subjected to trypsinization. However, trypsinization of the mutant cells did not dissociate the aggregates. Interestingly, when the tryptic digests were analyzed by SDS-PAGE, a 66-kDa protein was present at a higher quantity in the mutant digest than in the wild-type digest (Fig. 3). The N-terminal amino acid sequence of this 66-kDa protein fragment was determined to be NTIDEYGLTEQARKIAT; this sequence was identical to that of the S. mutans GS5 FTF enzyme (GenBank accession number M18954) from amino acid residues 148 to 164. The amino acid at residue 147 of the GS5 FTF is a lysine, indicating a trypsin cleavage site. The 66-kDa trypsin fragment produced an opaque band following incubation with raffinose in the FTF assay (data not shown).
![]() View larger version (96K): [in a new window] |
FIG. 3. Coomassie blue-stained SDS-polyacrylamide gel of proteins released by trypsin treatment from S. mutans NG8 (lane 2) and covR (lane 3) cells. Each of those lanes contained 20 µl of supernatant from tryptic digests of equivalent numbers of NG8 and covR cells. Lane 1 contained low-molecular-weight markers. The arrowhead indicates the 66-kDa FTF fragment.
|
![]() View larger version (52K): [in a new window] |
FIG. 4. Western immunoblots of FTF (A) and antigen P1 (B) produced by S. mutans NG8, the covR mutant, and the covRSX-complemented mutant. Lanes 1 and 2, noninduced and induced NG8; lanes 3 and 4, noninduced and induced covR mutant; lanes 5 and 6, noninduced and induced covRSX-complemented mutant. Each lane contained 20 µl of a late-exponential-phase culture with an OD600 of 1.3. Equal amounts of samples were loaded for FTF and antigen P1. Noninduced cultures were those grown in FMC; induced cultures were those grown in FMC supplemented with 0.5% (wt/vol) sucrose. For FTF, the probe was mouse anti-66-kDa FTF antibody; for antigen P1, the probe was anti-P1 monoclonal antibody 4-10A. The FTF band in panel A was estimated to be 94 kDa. In panel B, the top band represented the 185-kDa antigen P1, and the two lower bands (165 and 155 kDa) were the commonly observed degradation products of P1 (13).
|
A covRSX-complemented mutant was obtained by transforming pCovRSX/276 into the covR mutant. The production of FTF by the covRSX-complemented mutant was inducible by sucrose, as in the wild type (Fig. 4A, lanes 5 and 6). Under noninducing conditions, the level of FTF production by the covRSX-complemented mutant was about one-third the level of FTF production by the wild type, while under sucrose induction, the level of FTF produced by the mutant was similar to that produced by the wild type. In contrast, the levels of a constitutive protein, major surface protein antigen P1, produced by the three strains remained the same regardless of whether sucrose was present or absent (Fig. 4B).
The regulation of ftf expression by covRSX was further demonstrated by analysis of the levels of ftf transcripts produced by the wild type, the covR mutant, and the covRSX-complemented mutant. As shown in Fig. 5, the level of ftf mRNA produced by the covR mutant was about three times higher than that produced by the wild type, while that produced by the covRSX-complemented mutant was barely detectable, presumably due to the effect of multiple copies of covRS.
![]() View larger version (42K): [in a new window] |
FIG. 5. Transcription of ftf by S. mutans NG8 and mutants. ftf transcripts were obtained by PCR with cDNA synthesized by reverse transcription. Lane 1, 1-kb DNA ladder; lanes 2, 3, and 4, ftf transcripts from wild-type NG8, covR mutant, and covRSX-complemented mutant, respectively; lanes 5, 6, and 8, recA transcripts from NG8, covR mutant, and covRSX-complemented mutant; lane 7, similar to lane 3 but with the reverse transcription step omitted.
|
|
|
|---|
One most interesting and novel finding of this work is that the covR mutant produces an increased amount of extracellular carbohydrate, which apparently contains glucose and glucuronic acid but not fructose as constituent sugars. This finding indicates that the extracellular carbohydrate is not fructan, although FTF is overexpressed. The extracellular carbohydrate contained no detectable N-acetylglucosamine, suggesting that it is not hyaluronic acid. The type 3 capsule of Streptococcus pneumoniae consists of repeating units of glucose and glucuronic acid (4). The presence of an unequal molar ratio of glucose and glucuronic acid suggests that the S. mutans extracellular carbohydrate is not identical to the type 3 capsule. Furthermore, searching of the S. mutans genome did not reveal any sequence homology to the S. pneumoniae cps3DSU operon, which is responsible for capsule synthesis. It is not clear at this time whether this new extracellular carbohydrate is made solely of glucuronic acid or a mixture of glucose and glucuronic acid. The ability of S. mutans to produce a glucose- and glucuronic acid-containing extracellular carbohydrate was not previously described, possibly because this novel extracellular carbohydrate is not expressed under laboratory conditions. The biological importance of the glucose- and glucuronic acid-containing extracellular carbohydrate produced by S. mutans is not clear at this time.
The expression of the glucose- and glucuronic acid-containing extracellular carbohydrate is also under the negative control of covRS, as is evident from the results of the inactivation and complementation studies. This finding is consistent with the situation for S. pyogenes, in that the capsular hyaluronic acid is also negatively regulated by covRS (7, 17). It is interesting that the covRS-complemented mutant produced an intermediate level of extracellular carbohydrate, indicating that complementation in trans did not restore the wild-type phenotype fully. In contrast, full restoration of FTF expression was observed in the covRS-complemented mutant. These results suggest that although ftf and the extracellular carbohydrate synthesis gene are both regulated by covRS, there are differences in the form of the regulation.
Two other findings reported in this study deserve mention. One is the autoaggregation phenotype of the covR mutant. This phenotype is likely due to the overproduction of the extracellular carbohydrate, which imparted to the cell surface a highly negative charge that promoted cell clumping, presumably in the presence of divalent cations. covRS complementation reduces extracellular carbohydrate production and returns the cells to the nonaggregation phenotype. The second finding is that the covR mutant is more sensitive to an acidic pH than the wild type. Li et al. (19) recently reported a two-component regulatory system, hk11/rr11, that regulates genes required for acid resistance and biofilm formation. They showed that a histidine kinase mutant (hk11) but not a responder mutant (rr11) of S. mutans was sensitive to an acidic pH. These researchers suggested that the gene product of hk11 acts as a pH sensor and cross talks with other response regulators to confer acid resistance in S. mutans. The fact that covRS and hk11/rr11 are two different loci suggests that S. mutans has more than one two-component system to respond to an acidic pH. It is not clear at this time whether CovR is the putative responder that cross talks with Hk11 or whether covRS is similar to hk11/rr11 in that CovS is the pH sensor and cross talks with other responders to confer acid resistance.
In conclusion, we have identified a two-component regulatory system that regulates virulence traits in S. mutans, including FTF expression and acid resistance. The system also regulates the synthesis of a novel extracellular carbohydrate. These findings suggest that CovR is a global regulator in S. mutans, similar to its counterpart in S. pyogenes.
This study was supported by NSERC.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»