Previous Article | Next Article ![]()
Infection and Immunity, August 2004, p. 4784-4790, Vol. 72, No. 8
0019-9567/04/$08.00+0 DOI: 10.1128/IAI.72.8.4784-4790.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
E0364 INSERM, Faculté de Médecine Henri Warembourg, Université de Lille II, and Institut de Biologie de Lille, F-59021 Lille,1 CNRS UMR8030 and Génoscope, F-91006 Evry, France2
Received 27 January 2004/ Returned for modification 9 March 2004/ Accepted 10 April 2004
|
|
|---|
|
|
|---|
We recently discovered an 11-kb chromosomal type IV pilus gene cluster (pil) that contributes to bacterial virulence in Y. pseudotuberculosis serotype O:1 (6). In silico analysis (www.sanger.ac.uk/Projects/Y_pestis/ and www.genome.wisc.edu/sequencing/pestis) revealed that the pil gene cluster was absent from the genome of the genetically closely related species Y. pestis (1), whereas, in contrast, a homologous locus (83% identity at the nucleotide level) was harbored on the Y. enterocolitica chromosome (www.sanger.ac.uk/Projects/Y_enterocolitica/). We show here that the Y. pseudotuberculosis pil locus is present on a large (98-kb) fragment possessing the characteristics of a PAI.
|
|
|---|
Escherichia coli strains DH10B and DH5
were hosts for plasmids pBeloBac11 and pUC18, respectively. SY327
pir and SM10
pir strains were recipients for replication of the pMM70413 suicide plasmid and its derivatives (15). In addition to the Y. pseudotuberculosis wild-type strain 32777, the present study used 32777 derivatives MIV (lacking the pil operon [6]), pilKS, ureKS,
YAPI1, and
YAPI2 (all newly engineered in this work), as well as reference strains YPT9, 58/87, 2926, 33054, 32945, 32842, ST, 1830, 199/90, 1553, and 682/90. Y. pseudotuberculosis and E. coli strains were grown at 28 and 37°C, respectively, in Luria-Bertani broth or on agar plates. Mating experiments between E. coli and Y. pseudotuberculosis were plated on M9 minimum medium agar, as previously described (5). X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside; 20 µg ml1), IPTG (isopropyl-ß-D-thiogalactopyranoside; 25 µg ml1), ampicillin (100 µg ml1), kanamycin (50 µg ml1), chloramphenicol (25 µg ml1), and sucrose (10%) were added to growth medium for bacterial selection when necessary.
DNA preparation, amplification, analysis, and hybridization. Genomic DNA extraction, small-scale plasmid preparation, endonuclease digestion, DNA ligation, PCR, agarose gel electrophoresis, elution of DNA fragments from agarose gels, E. coli transformation, and colony blotting were carried out by using standard procedures (22). DNA/DNA hybridization was performed by using a digoxigenin (DIG)-labeled probe and the DIG detection kit from Roche according to the manufacturer's instructions.
Synthetic oligonucleotides.
Oligonucleotide primers were custom synthesized (MWG Biotech) for PCR generation of DNA fragments. Their nucleotide sequences (5'
3') were as follows: Af, AATTCGTCATGACCCG; Ar, CGAGTTCCACTGGT; Bf, TCCTTGCTGACCGAAGGTG; Br, AGGTACGCCACCGACCTGA; Cf, GATGGCTCAGTACGTC; Cr, GTCAGTTCGGGAGTAT; Df, AACCAAGGCGTTACACAGACA; Dr, GAACAGGCGGATAGCATCAG; Ef,GGTCGCTGTCTGTTTCTTGA; Er, AAATTACGGAACCCAGTAGCC; Ff, GTAAGTGGTACTCCAC; Fr, CCAAATGTTTAGCGGA; Gf, GCTTCACCAAGCGTAATGAC; and Gr, CCCAGAATGATCTAATGGAG (referred to below as primer sets A to G).
DNA cloning. A bacterial artificial chromosome (BAC) library was constructed from the Y. pseudotuberculosis 32777 chromosome by using the pBeloBac11 vector as described in detail by Buchrieser et al. (3). DNA extracted from selected BAC clones was partially digested with Sau3A: 1.5- to 3-kb and 3- to 5-kb DNA fragments fractionated by agarose gel electrophoresis were randomly ligated to BamHI-restricted pUC18 (shotgun cloning).
DNA sequencing. DNA was sequenced by using the ABI Prism dichlororhodamine dye terminator sequencing kit (Qiagen), and extension products were analyzed with the Applied Biosystems 3700 automated DNA sequencer. After assembly of the nucleotide sequence data by using Sequence Navigator (Perkin-Elmer), the remaining gaps were filled by using an Expand Long Template PCR kit (Roche) on recombinant BACs and the Y. pseudotuberculosis 32777 chromosome. Similarities to known proteins were determined by using the BLAST2N, BLAST2X, BLAST2P (2), and InterPro (16) programs, and transmembrane domains were predicted with TMHMM2.0 (12). tRNA genes were located and identified with tRNAscan (13). Finally, sequence annotation was performed with ARTEMIS software (20).
Introduction of the aph(3')-IIIa and sacB genes into the Y. pseudotuberculosis 32777 chromosome.
A 1,353-bp fragment encompassing the pilS gene (with a SpeI restriction site created 159 bp upstream of the pilS start codon) was generated by PCR. The amplimer was cloned into a pMM70413 suicide vector to yield plasmid pMMpilS. Next, the 3,130-bp SpeI fragment harboring sacB and aph(3')-IIIa from pCCY41.2 was inserted into the SpeI restriction site of pMMpilS, thus yielding pSACpil.1. Allelic exchange was carried out between Y. pseudotuberculosis 32777 and E. coli SM10
pir (pSACpil.1): after bacterial mating, transconjugants were plated on M9 minimum medium containing kanamycin and chloramphenicol in order to select the first recombination event. Selection of the second recombination event and elimination of the suicide plasmid was performed by using the bacteriostatic property of chloramphenicol and the bactericidal activity of cycloserine to eliminate dividing microorganisms. Similarly, the aph(3')-IIIa and sacB genes were inserted upstream of the ureA (the first gene of the urease locus) after mating of Y. pseudotuberculosis 32777 and E. coli SM10
pir(pIL31.3), a method originally reported for Y. pseudotuberculosis AH (5).
Measurement of chromosomal deletion frequency. Dilutions of overnight cultures of Y. pseudotuberculosis 32777 derivatives containing the aph(3')-IIIa and sacB genes (pilKS and ureKS strains) were plated on Luria-Bertani agar in the presence or absence of 10% sucrose. Sucrose-resistant bacteria were tested for loss of kanamycin resistance, and chromosomal deletion frequencies were calculated as the ratio of sucrose-resistant and kanamycin-sensitive bacteria to the total bacterial population.
Experimental infection in mice. Six-week-old female inbred BALB/c mice (Iffa Credo) were challenged by the intragastric or the intravenous route as previously described (6), and infected animals were monitored for 3 weeks.
Nucleotide sequence accession number. The nucleotide sequence data reported here have been deposited in the EMBL database under accession number AJ627388.
|
|
|---|
The 98-kb Y. pseudotuberculosis 32777 chromosomal segment encompassing the pil locus exhibits the genetic features of a PAI. Computer analysis of the 98,058-bp sequence revealed the presence of 95 putative open reading frames (ORFs), 11 of which correspond to the previously characterized pilLMNOPQRSUVW genes (Fig. 1). The overall GC content of the fully sequenced DNA segment is 47.8%, but the base composition was found to be heterogeneous (between 31.2 and 60.6%) along the 98-kb region (Fig. 1). Of the newly identified ORFs (which we call api, for adhesion PAI), 8 encode proteins lacking significantly similar equivalents in the public databases, and 43 are similar to known protein sequences of unknown function. The latter are specified by coding sequences (CDSs) found principally on the SPI-7 PAI and, to a lesser extent, on the Ralstonia solanacearum megaplasmid. Forty-four ORFs code for proteins with putative functions (Table 1), a marked fraction of which are derived from mobile, accessory genetic elements such as IS elements, bacteriophages, and plasmids. IS elements include different subtypes (ISSod13-like, IS100, IS110-like, IS285, IS630-like, IS911-like, and IS1353-like) and can be complete or partial. One of these elements (IS100) disrupts an ORF which, at the nucleotide level, is identical to a gene previously identified in the Y. pestis genome (YPO1092) encoding a DNA-binding protein of phage origin. An intact ORF (api95) adjacent to phe-tRNA gene specifies a 326-amino-acid product displaying high homologies to recombinases of the Cre family, which includes various bacteriophage integrases. Furthermore, for two CDSs located at the other extremity of the large DNA segment, the deduced proteins are homologous to phage and plasmid DNA helicases (for api2) and ATPases involved in plasmid partitioning (for api1). Finally, one ORF (api89) codes for a product that appears to be similar to rearrangement hot spot (Rhs)-related proteins (9).
![]() View larger version (21K): [in a new window] |
FIG. 1. Genetic organization of YAPI from Y. pseudotuberculosis 32777. ORFs related to virulence (red), metabolism (yellow), regulation (purple), phage and plasmid function (blue), insertion elements (pink), type I restriction-modification systems (green), and unknown functions (hatched) are positioned and oriented along the 98-kb segment. The tRNA-phe gene (black) at the 3' extremity flanks a putative integrase-encoding gene, i.e., the last gene of the PAI. Numbers on the right-hand side of the map indicate the scale in kilobases. The DNA sequence's guanine and cytosine (G+C) percentage (determined by using a 500-base window size and a 50-base window slide) is indicated above the genetic map.
|
|
View this table: [in a new window] |
TABLE 1. Characteristics of the 95 CDSs harbored on YAPI from Y. pseudotuberculosis 32777
|
Deletion of the 98-kb fragment occurs at low frequency in Y. pseudotuberculosis 32777.
PAIs tend to display deletion of specific sequences or even the whole genetic element (23). Except for type IV pili production, no other phenotypic traits were known to be associated with the presence of the 98-kb fragment in Y. pseudotuberculosis 32777. Therefore, since we failed to detect pil deletion phenotypically, we screened spontaneous deletion mutants after insertion of a selection gene [kanamycin resistance aph(3')-IIIa] and a counterselectable marker (the sacB levane sucrase-encoding gene) into the pil gene of Y. pseudotuberculosis 32777 (14). We placed the two reporter genes, as a control, upstream of the Y. pseudotuberculosis urease operon, a chromosomal region known to be stable (5). Since the product of the sacB gene is toxic for gram-negative bacteria in the presence of sucrose, only clones from which sacB is deleted will grow on agar containing this sugar. Selection on 10% sucrose and then on kanamycin medium revealed that when the reporter genes were located within pil, the occurrence of sucrose-resistant, kanamycin-sensitive clones was as frequent as when they are inserted upstream of the urease locus (mean value of four separate experiments ± the standard deviation = 1.7 ± 2.5 x 107 versus 0.6 ± 0.3 x 107, respectively). Two independent, sucrose-resistant, kanamycin-sensitive clones (
YAPI1and
YAPI2) were further characterized. PCR analysis and sequencing of PCR products revealed perfect excision of the 98,058-bp segment in these deletion mutants; they carried an intact phe-tRNA gene.
Apart from the pil locus, the 98-kb fragment does not contain any other genes for virulence in the mouse.
We previously reported that the Y. pseudotuberculosis type IV pilus gene cluster contributes to bacterial virulence in the mouse (6). PAIs often contain several pathogenicity genes (23). To determine whether any other genes on the 98-kb segment (i.e., apart from pil) are potentially involved in bacterial virulence (especially those encoding products without any known function), we compared rates of survival of BALB/c mice inoculated orally or intravenously with Y. pseudotuberculosis 32777, from which either the 98,058-bp DNA segment (strain
YAPI1) or the pil locus (strain MIV) had been deleted. When given orally, all mutants were found to be less virulent in the mouse than was the wild-type strain 32777. However, deletion of the entire PAI did not result in a significant decrease of bacterial virulence compared to inactivation of the pil gene cluster alone (the 50% lethal dose [LD50] for the wild type was
107 cells; the LD50s for MIV and
YAPI were
108 cells). Bearing in mind the limits of our model of oral infection, it appears that no virulence genes other than the fimbrial gene cluster pil are harbored on the 98-kb chromosomal segment. Concerning the intravenous route, the LD50 values for the three strains were all <102 cells, indicating that no virulence factors required for systemic infection are encoded within YAPI.
YAPI is not complete in all Y. pseudotuberculosis strains and can be situated in either of the two phe-tRNA genes. Detection of YAPI in 11 Y. pseudotuberculosis strains (originating from various geographical areas and belonging to six different O serotypes) was screened by PCR with primers located outside mobile genetic elements. Three primer sets (B, A, and C), respectively, amplified fragments of the conserved pilin-encoding gene pilS (6) and the CDSs located upstream (api5) and downstream (api24 to api26) in the pil operon; two others (D and E) amplified the Ralstonia megaplasmid homologues api64 and api74 (Table 1). As shown in Table 2, YAPI was not present in all strains tested, and its distribution was found to be independent of the O serotype. It is interesting that for three of the six YAPI-positive strains (32945, ST, and 1553), amplification products were yielded with primer sets A, B, and C but not with primer sets D and E. Our data thus indicate that these strains lacked the YAPI fragment homologous to that in Ralstonia (which we called the metabolic segment).
|
View this table: [in a new window] |
TABLE 2. Distribution of YAPI among different Y. pseudotuberculosis serotypesa
|
|
|
|---|
Like the HPI, YAPI is not uniformly distributed within the species (Table 2). However, whereas the HPI is recovered only in O:1 and O:3 strains (4), YAPI seems to be spread across the species independently of the O serotype. This is consistent with a previous study in which we showed that the pil locus was detected in various Y. pseudotuberculosis serotypes (6). However, this finding needs to be confirmed by an extensive study on a broader strain collection (such studies are in progress). This strongly suggests that YAPI has emerged earlier in Y. pseudotuberculosis than did the HPI. Another feature shared by the HPI and YAPI is the insertion of the two PAIs into either copy of their target tRNA gene (asn for HPI and phe for YAPI) (4). YAPI can spontaneously and perfectly excise itself from the chromosome and comprises an intact putative integrase-encoding gene. Although we failed to detect an excised, circular form of YAPI (most probably due to the relative infrequency of this type of genetic event), intracellular mobility of the PAI is an alternative to a random phe-tRNA insertion or homologous recombination between two copies of the same gene.
In contrast to the HPI, YAPI was not detected in Y. pestis. This finding was established both by in silico analysis of the sequenced genomes of strain KIM (7) and strain CO92 (17) and by PCR experiments with primer sets A and B on several other strains of the Medievalis and Orientalis biovars (strains 518 and 556 and strains 573, 610, and 612, respectively), as well as in biovar Antiqua strains (strains 536, 537, and 539) (data not shown). However, a DNA segment homologous to YAPI (although shorter in length [66 kb]) was detected in silico in the genome-sequenced strain 8081 (biotype 1B [O:8]) of Y. enterocolitica. Also associated with a phe-specific tRNA locus, this fragment shared 41 of its 61 predicted ORFs (64 to 97% identity at the protein level) with the YAPI from Y. pseudotuberculosis 32777 (unpublished data).
The right part of Y. pseudotuberculosis YAPI (which notably encompasses metabolic genes [see Table 1]) was missing in some strains of this species, whereas the left part (which includes the type IV pilus gene cluster and was designated the adhesion segment) was never seen to be lacking in PAI-positive strains (Table 2). The pil operon, which is highly conserved in distantly related strains on the basis of PCR-restriction fragment length polymorphism (data not shown), therefore represents the best probe for detecting YAPI in Y. pseudotuberculosis. Considering the PCR results presented in Table 2 raises the question of whether YAPI was generated in one or two steps. Would the PAI have emerged in one block of genes (which would then have sustained deletion of its right part) or, in contrast, would the latter have been added once the left part had been laterally acquired by the bacterium? In Y. enterocolitica, the presence of a gene cluster encoding putative proteins involved in arsenic resistance (instead of the homologous Ralstonia megaplasmid segment in the corresponding region of Y. pseudotuberculosis YAPI [Table 1 and unpublished data]) argues in favor of the second hypothesis. Comparative analysis of PAI gene composition in a large collection of YAPI-positive strains from various animal and environmental sources (work in progress) should provide insight not only into the pathogenesis and ecological fitness of Y. pseudotuberculosis but also into the PAI's evolution within the species.
, E. Carniel, J. Sundar, R. Van Noyen, and N. Takeda for supplying reference Yersinia strains. F. Collyn received a doctoral studentship from the Ministère de l'Enseignement Supérieur, de la Recherche et de la Technologie and from the Fondation pour la Recherche Médicale. This study was supported in part by the European Regional Development Fund.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»