Previous Article | Next Article 
Infection and Immunity, August 2004, p. 4864-4867, Vol. 72, No. 8
0019-9567/04/$08.00+0 DOI: 10.1128/IAI.72.8.4864-4867.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
The luxS Gene Is Not Required for Borrelia burgdorferi Tick Colonization, Transmission to a Mammalian Host, or Induction of Disease
Jon S. Blevins,1 Andrew T. Revel,1 Melissa J. Caimano,2 Xiaofeng F. Yang,1 James A. Richardson,3 Kayla E. Hagman,1 and Michael V. Norgard1*
Departments of Microbiology,1
Pathology, University of Texas Southwestern Medical Center, Dallas, Texas 75390,3
Department of Pathology and Center for Microbial Pathogenesis, University of Connecticut Health Center, Farmington, Connecticut 060302
Received 5 February 2004/
Returned for modification 10 March 2004/
Accepted 7 April 2004

ABSTRACT
luxS mutants of
Borrelia burgdorferi strain 297 naturally colonized
their arthropod (
Ixodes scapularis) vector, were maintained
in ticks throughout the molting process (larvae to nymphs),
were tick transmitted to uninfected mice, and elicited histopathology
in mice indistinguishable from that induced by wild-type
B. burgdorferi.

TEXT
Borrelia burgdorferi, the causative agent of Lyme disease, persists
in nature via a complex enzootic life cycle that involves both
warm-blooded mammalian hosts and
Ixodes sp. arthropod (tick)
vectors (
24). Because
B. burgdorferi must adapt to these two
very diverse niches (
11,
18,
22,
23), it may utilize any number
of differential expression systems to regulate its virulence
factors for each parasitic environment. One regulatory system
operative in certain other bacterial pathogens is the LuxS/autoinducer-2
(AI-2) quorum-sensing system (
9,
15). In selected bacteria,
the product of the
luxS gene is an enzyme involved in the generation
of an AI (a furanosyl borate diester) (
7) which, in turn, induces
gene expression when the AI reaches a sufficiently high concentration.
The increased local concentration of AI-2 is proportional to
the increased density of the bacteria synthesizing AI-2, thereby
allowing the AI to serve as a surrogate signal of population
density (
9,
15).
In B. burgdorferi, a homolog of luxS (BB0377) was identified from genome sequence information for strain B31 (10). Studies have since demonstrated that expression of borrelial luxS is enhanced during tick feeding or during the growth of spirochetes under in vitro conditions that mimic tick feeding (e.g., elevated temperature) (16, 18). These observations, combined with the finding that the expression of certain membrane lipoproteins of B. burgdorferi (e.g., OspC, Mlp's, P35, and P7.5) is influenced by spirochete cell density (14, 21, 30), have led to the provocative notion that B. burgdorferi may utilize a LuxS/AI-2 quorum-sensing system to regulate differentially factors that sustain the organism in one or more phases of its complex life cycle in ticks and mammals (25, 26). Along these lines, it has been reported that the B. burgdorferi luxS ortholog can functionally complement a luxS deficiency in Escherichia coli (13, 25). However, thus far, AI-2 activity has not been detectable within B. burgdorferi culture supernatants or concentrated cell lysates (13, 25). Furthermore, infection of mice via needle inoculation revealed that a luxS mutant of B. burgdorferi strain 297 was fully infectious for susceptible animals at levels comparable to those of wild-type B. burgdorferi (13). Although the latter results are inconsistent with the notion that luxS plays an essential role in the infectious phenotype of B. burgdorferi, it remained possible that luxS might contribute at some other strategic phase in the natural transmission cycle of the spirochete, particularly one involving B. burgdorferi's arthropod vector. For example, upon tick engorgement, resident spirochetes in the tick midgut undergo a replicative burst to higher cell density (19, 20), a condition ostensibly more conducive to quorum sensing. This population change may be critical for signaling alterations in borrelial gene expression, thereby prompting the spirochetes to migrate to the salivary glands of the tick (where they are subsequently transmitted into the mammalian host). The present study was thus undertaken to assess the potential role(s) of borrelial luxS in the ability of B. burgdorferi to (i) colonize ticks naturally, (ii) be tick transmitted to naïve mice, and (iii) cause disease in the murine model of Lyme borreliosis.
Colonization of Ixodes scapularis with B. burgdorferi strains.
Infectious, low-passage B. burgdorferi strain 297 (17) was the representative wild-type strain for this study. luxS mutants of strain 297, BbAH308 and BbAH309, are infectious clones isolated from ear punch biopsy-positive cultures from needle-inoculated mice (13). Previous characterization of these luxS mutants revealed that they express neither mRNA nor LuxS protein (13). B. burgdorferi strain 297 was cultured in BSK-H medium (Sigma) without selective agents, and luxS mutants were grown in BSK-H containing erythromycin (0.06 µg/ml). To obtain B. burgdorferi-colonized ticks, two independent experiments were carried out: one with strains 297 and BbAH308 and a second with strains 297 and BbAH309. Three- to five-week-old female C3H/HeJ mice (five per group) were first needle inoculated intradermally with 104 bacteria of either wild-type B. burgdorferi strain 297 or the luxS mutant (BbAH308 or BbAH309) as previously described (12). After 2 weeks, mice were confirmed to be infected by immunoblotting of their sera against borrelial whole-cell lysates and by culturing of ear punch biopsy specimens in BSK-H medium (12). Approximately 400 pathogen-free I. scapularis larvae, reared and generously provided by Thomas Mather (University of Rhode Island), were then placed on two infected mice per isolate and were allowed to feed to repletion. Engorged larvae were then collected over a 5- to 7-day period, transferred into 16-ml glass vials, and stored at 22°C over a saturated solution of potassium sulfate (to maintain a relative humidity of 97%) and within an incubator with a photoperiod of 16 h of light and 8 h of darkness. Engorged ticks were then allowed to molt to the nymphal stage.
PCR amplification of the B. burgdorferi ospA gene from chromosomal DNA extracted from these flat nymphs (20) revealed that at least 80% of the ticks were infected with either wild-type B. burgdorferi or the luxS mutants (data not shown). However, the number of spirochetes in flat ticks is relatively low (19, 20), thereby making determinations of infection efficiencies less than optimal. To obtain more precise PCR assessments of efficiencies of tick colonization by wild-type B. burgdorferi or the luxS mutants, we took advantage of the fact that spirochete populations markedly expand during tick feeding (19, 20). To accomplish this expansion, naïve 3-week-old female C3H/HeJ mice were each infested with five I. scapularis nymphs infected with either wild-type B. burgdorferi or one of the luxS mutants. Mice were housed individually in cages with wire bottoms above water and monitored until ticks fed to repletion and detached from the mice (ca. 72 h). Fed ticks were collected and stored individually at 70°C.
To isolate chromosomal DNA from fed nymphs, individual ticks were first surface disinfected using consecutive washes of sterile water, 0.5% sodium hypochlorite, 3% hydrogen peroxide, 70% ethanol, and sterile water. Ticks were then transferred into 1.5-ml tubes of a Kontes disposable homogenizer, frozen in liquid nitrogen, and pulverized using a fitted pestle. DNA was purified using the Invitrogen Easy-DNA kit according to the manufacturer's instructions, and mussel glycogen was added to a concentration of 20 µg/ml at the precipitation step. Barrier tips were used during DNA extraction and preparation of PCR mixtures to protect against contamination of samples. The primer set used for detecting borrelial DNA in the extracted tick sample, OspA-2 (5'-GTTTTGTAATTTCAACTGCTGACC) and OspA-4 (5'-CTGCAGCTTGGAATTCAGGCACTT), generates a 156-bp amplicon specific for the ospA gene. As a control for contamination, an unfed naïve I. scapularis nymph was prepared with each set of B. burgdorferi-infected ticks. PCRs were carried out with Takara Ex-Taq, 1 µM (each) primers, and 0.5 mM MgCl2. The optimized reaction conditions required an initial 94°C denaturation for 3 min followed by 45 cycles of the following steps: 94°C for 15 s, 65°C for 15 s, and 72°C for 15 s.
PCR results showed that 100% of nymphs were infected with either wild-type B. burgdorferi strain 297 or the luxS mutant BbAH308 (Table 1). BbAH309 yielded similar tick colonization efficiencies (Table 1). These findings support the conclusion that luxS is not required for either the initial colonization of I. scapularis larvae by B. burgdorferi or the spirochete's persistence within the arthropod during subsequent maturation to the nymphal form.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Efficiencies of tick colonization by and mouse infectivity of wild-type B. burgdorferi strain 297 and derivative luxS mutants (BbAH308 and BbAH309)
|
Infectivity of the luxS mutants for mice challenged via tick bite.
The presence of a
luxS gene was not required for
B. burgdorferi colonization of
I. scapularis larvae or maintenance of spirochetes
in nymphs. To examine whether the
luxS mutant was deficient
for subsequent transmission of
B. burgdorferi into a mammalian
host, naïve 3-week-old female C3H/HeJ mice were each infested
with five
I. scapularis nymphs infected with
B. burgdorferi (the fewest number of ticks that has been demonstrated to result
in consistent 100% infection by strain 297) (data not shown).
Mice were housed individually in cages with wire bottoms above
water. Three weeks after tick infestation, ear punch biopsy
specimens from mice were cultured in BSK-H medium with 1
x Borrelia antibiotic mixture (Sigma). One to two weeks later, dark-field
microscopy was used to examine cultures for the presence of
motile spirochetes. In the first set of experiments, motile
spirochetes were observed in 100% of the cultures from mice
infected with
B. burgdorferi strain 297 (Table
1). Cultures
from five (83%) of the six mice infected with BbAH308 via tick
infestation were also positive for growth of
B. burgdorferi (Table
1). Histopathological analysis of the single culture-negative
BbAH308-infected mouse revealed pathology identical to that
of mice infected with
B. burgdorferi strain 297 (data not shown),
suggesting that this mouse indeed was infected (raising the
infection efficiency for BbAH308 to 100%). A second set of mouse
infestation experiments, comparing
B. burgdorferi strain 297
with BbAH309, showed 100% infection in both groups (Table
1).
An aliquot of each ear punch biopsy culture from the above-described
experiments was used to inoculate a larger volume of BSK-H medium
without selection by erythromycin. Once these cultures reached
an adequate cell density (ca. 10
7 spirochetes/ml), chromosomal
DNA was extracted and the genotypes of the recovered spirochetes
were confirmed using a set of primers (priAH166, 5'-GTGACCGGTCAATGGGAAAAATTAGATTTTGTATTTGTAAAAAAAATAC,
and priAH167, 5'-GAAAAGGTACCTTACTAAGGATATTTTAAATTTTCTTCTTTAATATTG)
that flank the region of
luxS where the erythromycin marker
was inserted. In all cases, the cultures derived from mice infected
with
B. burgdorferi strain 297 via tick infestation yielded
the wild-type 546-bp amplicon, whereas PCR amplification of
DNA extracted from the cultures of the mice infected with the
luxS mutants (with insertionally disrupted
luxS genes) resulted
in the larger 1.5-kb
luxS::
ermC PCR product (data not shown).
The combined data suggest that the
luxS mutants were fully capable
of being transmitted from ticks to mice and, furthermore, were
competent for establishing disseminated infection in the murine
model of Lyme borreliosis.
Histopathology in mice infected with the luxS mutants via tick bite.
Previous studies have established that borrelial infectivity and pathogenicity are dissociable, inasmuch as isolates of B. burgdorferi strain N40 can retain the ability to infect C3H/HeJ mice but are unable to induce arthritis or carditis (1, 27). To examine whether a deficiency in luxS perhaps allowed infectivity at the expense of pathogenicity, histological examinations were performed on heart and joint tissues from mice infected with either wild-type B. burgdorferi strain 297 or the luxS mutants. Three weeks post-tick infestation, the heart and right hind limb were harvested from each mouse, fixed in 10% neutralized formalin, and embedded in paraffin. A blind histological assessment was then performed with tissue sections stained with hematoxylin and eosin. Arthritis of the knee joint was evaluated for thickening of the tendon sheath, severity of inflammation, leukocyte infiltration, synovial proliferation, and involvement of adjacent bone or muscle tissue (3-5). Cardiac sections were examined for the severity of inflammation, leukocyte infiltration, and fibroblastic proliferation, as well as involvement of the aortic epithelium, the epicardium, and the endocardium (2, 4, 5).
Cardiac and knee tissues from mice infected with B. burgdorferi strain 297 (n = 8) or either of the luxS mutants (n = 8; four mice from each group) were virtually indistinguishable (Fig. 1). In all specimens from mice infected with either wild-type B. burgdorferi or the luxS mutants, there was significant inflammation within the myocardium at the base of the heart surrounding the aorta, pulmonary artery, and coronary arteries. The inflammatory response consisted of macrophages admixed with lymphocytes, plasma cells, and occasional polymorphonuclear cells. In more severely affected animals in all groups, inflammation extended into the mediae of the arteries, resulting in proliferation and inflammation of the overlying intimae. Articular lesions consisted primarily of those of tendonitis. The tendon sheaths were infiltrated with macrophages and fibroblasts admixed with lymphocytes, plasma cells, and small numbers of degenerating neutrophils. There was mild proliferation of the synovial linings of the knee joints associated with infiltration of small numbers of neutrophils and lymphocytes.
Summary and implications.
Increased recognition of the importance of LuxS/AI-2 quorum-sensing
systems for bacterial gene regulation (
7,
9,
15) has prompted
the hypothesis that the
luxS gene product of
B. burgdorferi also may be involved in regulating borrelial gene expression
in a LuxS/AI-2-dependent manner (
25,
26). However, the relevance
of observations implicating LuxS/AI-2 as a regulatory system
in
B. burgdorferi (
25,
26) remains unclear. Furthermore, Winzer
et al. (
29) have cautioned strongly about the pitfalls of proposing
AI-2-dependent quorum sensing as a regulatory system for any
bacterium largely, if not solely, because of the mere presence
of a
luxS gene and/or the production of an AI-2-like molecule(s).
To garner more direct evidence for the potential involvement
of LuxS in the infectivity of
B. burgdorferi for mammalian hosts,
it was previously reported that a LuxS-deficient mutant of
B. burgdorferi readily infects mice via intradermal (needle) inoculation
(
13); this finding suggests that LuxS function is not required
for the mammalian phase of infection or, at the very least,
adaptation of
B. burgdorferi to the mammalian host. Herein we
now show that the same
luxS mutants are fully competent for
(i) colonization of their natural arthropod (
I. scapularis)
vector, (ii) maintenance in
I. scapularis throughout the molting
process (from larval to nymphal forms), (iii) transfer from
ticks to uninfected mice, and (iv) after dissemination in mice,
elicitation of histopathology indistinguishable from that induced
by wild-type
B. burgdorferi. Of note, this is not the first
study to show that a bacterial
luxS mutant can retain pathogenicity;
luxS mutants of both
Porphyromonas gingivalis and
Shigella flexneri are not attenuated in their respective models (
6,
8).
All studies by us to date have failed to garner support for the contention that B. burgdorferi requires a luxS gene product for any key regulatory aspect(s) of either its complex life cycle in ticks and mammals or its ability to produce disease in a susceptible mammalian host. Although the precise functional role of LuxS in B. burgdorferi remains unknown, until direct evidence indicates otherwise, it should be considered more plausible that the major, if not sole, function for LuxS is the conversion of S-ribosylhomocysteine to homocysteine and 4,5-dihydroxy-2,3-pentanedione. The latter product likely represents a dispensable by-product of methionine metabolism that ultimately is excreted to reduce toxicity and maintain a proper metabolic state (28, 29).

ACKNOWLEDGMENTS
We thank Anette Hubner for generation of the
luxS mutants, Dena
Nolen for technical assistance, and Thomas Mather for supplying
I. scapularis larvae.
This work was supported by grants AI-45538 and AI-29735 from the Lyme disease program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health, and by a grant (Advanced Research Program) from the Texas Higher Education Coordinating Board.

FOOTNOTES
* Corresponding author. Mailing address: Department of Microbiology, U.T. Southwestern Medical Center, 6000 Harry Hines Blvd., Dallas, TX 75390-9048. Phone: (214) 648-5900. Fax: (214) 648-5905. E-mail:
michael.norgard{at}utsouthwestern.edu.

Editor: D. L. Burns

REFERENCES
1 - Anguita, J., S. Samanta, B. Revilla, K. Suk, S. Das, S. W. Barthold, and E. Fikrig. 2000. Borrelia burgdorferi gene expression in vivo and spirochete pathogenicity. Infect. Immun. 68:1222-1230.[Abstract/Free Full Text]
2 - Armstrong, A. L., S. W. Barthold, D. H. Persing, and D. S. Beck. 1992. Carditis in Lyme disease susceptible and resistant strains of laboratory mice infected with Borrelia burgdorferi. Am. J. Trop. Med. Hyg. 47:249-258.
3 - Barthold, S. W., D. S. Beck, G. M. Hansen, A. A. Terwilliger, and K. D. Moody. 1990. Lyme borreliosis in selected strains and ages of laboratory mice. J. Infect. Dis. 162:133-138.[Medline]
4 - Barthold, S. W., M. S. de Souza, J. L. Janotka, A. L. Smith, and D. H. Persing. 1993. Chronic Lyme borreliosis in the laboratory mouse. Am. J. Pathol. 143:959-971.[Abstract]
5 - Barthold, S. W., D. H. Persing, A. L. Armstrong, and R. A. Peeples. 1991. Kinetics of Borrelia burgdorferi dissemination and evolution of disease after intradermal inoculation of mice. Am. J. Pathol. 139:263-273.[Abstract]
6 - Burgess, N. A., D. F. Kirke, P. Williams, K. Winzer, K. R. Hardie, N. L. Meyers, J. Aduse-Opoku, M. A. Curtis, and M. Camara. 2002. LuxS-dependent quorum sensing in Porphyromonas gingivalis modulates protease and haemagglutinin activities but is not essential for virulence. Microbiology 148:763-772.[Abstract/Free Full Text]
7 - Chen, X., S. Schauder, N. Potier, A. Van Dorsselaer, I. Pelczer, B. L. Bassler, and F. M. Hughson. 2002. Structural identification of a bacterial quorum-sensing signal containing boron. Nature 415:545-549.[CrossRef][Medline]
8 - Day, W. A., and A. T. Maurelli. 2001. Shigella flexneri LuxS quorum-sensing system modulates virB expression but is not essential for virulence. Infect. Immun. 69:15-23.[Abstract/Free Full Text]
9 - de Kievit, T. R., and B. H. Iglewski. 2000. Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68:4839-4849.[Free Full Text]
10 - Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J.-F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586.[CrossRef][Medline]
11 - Gilmore, R. D., M. L. Mbow, and B. Stevenson. 2001. Analysis of Borrelia burgdorferi gene expression during life cycle phases of the tick vector Ixodes scapularis. Microbes Infect. 3:799-808.[CrossRef][Medline]
12 - Hagman, K. E., P. Lahdenne, T. G. Popova, S. F. Porcella, D. R. Akins, J. D. Radolf, and M. V. Norgard. 1998. Decorin-binding protein of Borrelia burgdorferi is encoded within a two-gene operon and is protective in the murine model of Lyme borreliosis. Infect. Immun. 66:2674-2683.[Abstract/Free Full Text]
13 - Hubner, A., A. T. Revel, D. M. Nolen, K. E. Hagman, and M. V. Norgard. 2003. Expression of a luxS gene is not required for Borrelia burgdorferi infection of mice via needle inoculation. Infect. Immun. 71:2892-2896.[Abstract/Free Full Text]
14 - Indest, K. J., R. Ramamoorthy, M. Sole, R. D. Gilmore, B. J. B. Johnson, and M. T. Philipp. 1997. Cell-density-dependent expression of Borrelia burgdorferi lipoproteins in vitro. Infect. Immun. 65:1165-1171.[Abstract]
15 - Miller, M. B., and B. L. Bassler. 2001. Quorum sensing in bacteria. Annu. Rev. Microbiol. 55:165-199.[CrossRef][Medline]
16 - Narasimhan, S., F. Santiago, R. A. Koski, B. Brei, J. F. Anderson, D. Fish, and E. Fikrig. 2002. Examination of the Borrelia burgdorferi transcriptome in Ixodes scapularis during feeding. J. Bacteriol. 184:3122-3125.[Abstract/Free Full Text]
17 - Norton Hughes, C. A., C. B. Kodner, and R. C. Johnson. 1992. DNA analysis of Borrelia burgdorferi NCH-1, the first northcentral U.S. human Lyme disease isolate. J. Clin. Microbiol. 30:698-703.[Abstract/Free Full Text]
18 - Ojaimi, C., C. Brooks, S. Casjens, P. Rosa, A. Elias, A. Barbour, A. Jasinskas, J. Benach, L. Katona, J. Radolf, M. Caimano, J. Skare, K. Swingle, D. Akins, and I. Schwartz. 2003. Profiling of temperature-induced changes in Borrelia burgdorferi gene expression by using whole genome arrays. Infect. Immun. 71:1689-1705.[Abstract/Free Full Text]
19 - Piesman, J., J. R. Oliver, and R. J. Sinsky. 1990. Growth kinetics of the Lyme disease spirochete (Borrelia burgdorferi) in vector ticks (Ixodes dammini). Am. J. Trop. Med. Hyg. 42:352-357.
20 - Piesman, J., B. S. Schneider, and N. S. Zeidner. 2001. Use of quantitative PCR to measure density of Borrelia burgdorferi in the midgut and salivary glands of feeding tick vectors. J. Clin. Microbiol. 39:4145-4148.[Abstract/Free Full Text]
21 - Ramamoorthy, R., and M. T. Philipp. 1998. Differential expression of Borrelia burgdorferi proteins during growth in vitro. Infect. Immun. 66:5119-5124.[Abstract/Free Full Text]
22 - Revel, A. T., A. M. Talaat, and M. V. Norgard. 2002. DNA microarray analysis of differential gene expression in Borrelia burgdorferi, the Lyme disease spirochete. Proc. Natl. Acad. Sci. USA 99:1562-1567.[Abstract/Free Full Text]
23 - Schwan, T. G. 2003. Temporal regulation of outer surface proteins of the Lyme-disease spirochaete Borrelia burgdorferi. Biochem. Soc. Trans. 31:108-112.[Medline]
24 - Steere, A. C. 1993. Current understanding of Lyme disease. Hosp. Pract. 28:37-44.
25 - Stevenson, B., and K. Babb. 2002. LuxS-mediated quorum sensing in Borrelia burgdorferi, the Lyme disease spirochete. Infect. Immun. 70:4099-4105.[Abstract/Free Full Text]
26 - Stevenson, B., K. von Lackum, R. L. Wattier, J. D. McAlister, J. C. Miller, and K. Babb. 2003. Quorum sensing by the Lyme disease spirochete. Microbes Infect. 5:991-997.[CrossRef][Medline]
27 - Thomas, V., J. Anguita, S. Samanta, P. A. Rosa, P. Stewart, S. W. Barthold, and E. Fikrig. 2001. Dissociation of infectivity and pathogenicity in Borrelia burgdorferi. Infect. Immun. 69:3507-3509.[Abstract/Free Full Text]
28 - Winzer, K., K. R. Hardie, N. Burgess, N. Doherty, D. Kirke, M. T. G. Holden, R. Linforth, K. A. Cornell, A. J. Taylor, P. J. Hill, and P. Williams. 2002. LuxS: its role in central metabolism and the in vitro synthesis of 4-hydroxy-5-methyl-3(2H)-furanone. Microbiology 148:909-922.[Abstract/Free Full Text]
29 - Winzer, K., K. R. Hardie, and P. Williams. 2002. Bacterial cell-to-cell communication: sorry, can't talk nowgone to lunch. Curr. Opin. Microbiol. 5:216-222.[CrossRef][Medline]
30 - Yang, X., M. S. Goldberg, T. G. Popova, G. B. Schoeler, S. K. Wikel, K. E. Hagman, and M. V. Norgard. 2000. Interdependence of environmental factors influencing reciprocal patterns of gene expression in virulent Borrelia burgdorferi. Mol. Microbiol. 37:1470-1479.[CrossRef][Medline]
Infection and Immunity, August 2004, p. 4864-4867, Vol. 72, No. 8
0019-9567/04/$08.00+0 DOI: 10.1128/IAI.72.8.4864-4867.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Stewart, P. E., Bestor, A., Cullen, J. N., Rosa, P. A.
(2008). A Tightly Regulated Surface Protein of Borrelia burgdorferi Is Not Essential to the Mouse-Tick Infectious Cycle. Infect. Immun.
76: 1970-1978
[Abstract]
[Full Text]
-
Riley, S. P., Bykowski, T., Babb, K., von Lackum, K., Stevenson, B.
(2007). Genetic and physiological characterization of the Borrelia burgdorferi ORF BB0374-pfs-metK-luxS operon. Microbiology
153: 2304-2311
[Abstract]
[Full Text]
-
Parveen, N., Cornell, K. A., Bono, J. L., Chamberland, C., Rosa, P., Leong, J. M.
(2006). Bgp, a Secreted Glycosaminoglycan-Binding Protein of Borrelia burgdorferi Strain N40, Displays Nucleosidase Activity and Is Not Essential for Infection of Immunodeficient Mice.. Infect. Immun.
74: 3016-3020
[Abstract]
[Full Text]
-
Dubytska, L., Godfrey, H. P., Cabello, F. C.
(2006). Borrelia burgdorferi ftsZ Plays a Role in Cell Division.. J. Bacteriol.
188: 1969-1978
[Abstract]
[Full Text]
-
Xu, L., Li, H., Vuong, C., Vadyvaloo, V., Wang, J., Yao, Y., Otto, M., Gao, Q.
(2006). Role of the luxS Quorum-Sensing System in Biofilm Formation and Virulence of Staphylococcus epidermidis. Infect. Immun.
74: 488-496
[Abstract]
[Full Text]
-
Xu, Q., Seemanapalli, S. V., Lomax, L., McShan, K., Li, X., Fikrig, E., Liang, F. T.
(2005). Association of Linear Plasmid 28-1 with an Arthritic Phenotype of Borrelia burgdorferi. Infect. Immun.
73: 7208-7215
[Abstract]
[Full Text]
-
Revel, A. T., Blevins, J. S., Almazan, C., Neil, L., Kocan, K. M., de la Fuente, J., Hagman, K. E., Norgard, M. V.
(2005). bptA (bbe16) is essential for the persistence of the Lyme disease spirochete, Borrelia burgdorferi, in its natural tick vector. Proc. Natl. Acad. Sci. USA
102: 6972-6977
[Abstract]
[Full Text]