Previous Article | Next Article ![]()
Infection and Immunity, January 2005, p. 135-145, Vol. 73, No. 1
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.1.135-145.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Pi
tek,1
Beata Zalewska,1
Olga Kolaj,1
Micha
Ferens,1
Bogdan Nowicki,2,3 and
Józef Kur1*
Department of Microbiology, Gda
sk University of Technology, Gda
sk, Poland,1
Department of Obstetrics and Gynecology,2
Department of Microbiology and Immunology, The University of Texas Medical Branch, Galveston, Texas3
Received 30 April 2004/ Returned for modification 17 August 2004/ Accepted 20 September 2004
|
|
|---|
|
|
|---|
The family of more than 30 different fimbrial and nonfimbrial polymeric adhesins expressed by different gram-negative bacteria contains members assembled with a common chaperone-usher mechanism (29, 36). This family encompasses complex, heteropolymeric rigid fimbriae (e.g., P pili and type 1 pili of E. coli) (4, 12), much simpler homopolymeric fimbriae with a flexible structure (e.g., Dr fimbriae of uropathogenic E. coli) (25, 35), and nonfimbrial or amorphic structures (e.g., F1 capsular antigen of Yersinia pestis and Afa-III of E. coli) (8, 9). The process of biogenesis of polymeric adhesins in the chaperone-usher pathway depends on the action of two periplasmic proteins, the usher and chaperone proteins. The usher protein is a homooligomer that forms an outer membrane, donut-shaped channel by which the polymerization process occurs (1, 7, 31, 37). The chaperone is a periplasmic protein which has crucial roles in the assembly of polymers (20, 33). As shown first for P and type 1 pili, the subunits that are used to build these polymers after translocation to the periplasm are not able to fold spontaneously to form structures that are capable of polymerization (17, 30). In the periplasm, the chaperone protein interacts with fimbrial subunits, and based on steric information in the structure, the subunits fold to construct a native functional form (2, 23). Only when they are in a complex with the chaperone are subunits able to polymerize in contact with the usher protein to form surface-located adhesive polymers. Accumulation of free subunits in the periplasm induces the toxic effect that results in their degradation by proteases, mainly DegP (HtrP) (17). The chaperone bound to a subunit stabilizes it and caps its interactive regions, thereby protecting the periplasm from a potential toxic effect.
The periplasmic chaperones engaged in assembly of polymeric structures belong to a conserved superfamily whose members have high sequence homology and a common structure (29). Thus far, structures of the following four chaperones have been elucidated: PapD (P pili of E. coli) (13, 15), FimC (type 1 pili of E. coli) (6), SfaE (S pilus of E. coli) (19), and Caf1M (F1 antigen of Y. pestis) (39). All of these molecules are composed of two immunoglobulin-like domains with the overall shape of a boomerang. Comparison of the sequences of known chaperones with crystallographic structure data permits division of the superfamily into two groups, FGL (F1-G1 Long) and FGS (F1-G1 short) (5, 16). The base of this division is the number of residues in the loop connecting ß strands. Chaperones belonging to the FGS subfamily are engaged in the assembly of rod-like fimbriae (PapD and FimC), whereas FGL chaperones appear to assemble thin fimbrial and afimbrial structures (Caf1M) (16).
The crystallographic structures of the chaperone-subunit binary complexes PapD-PapK (27), PapD-PapE (26), FimC-FimH (6, 14), and Caf1M-Caf1 and the ternary complex Caf1M-Caf1'-Caf1" (39) permitted discovery of the molecular mechanism of biogenesis of organelles which are assembled by a chaperone-usher pathway. The crystallographic data showed that all subunits possess incomplete immunoglobulin structures with the seventh ß-strand missing, which results in exposure of a deep, hydrophobic cleft. In complex crystallographic structures, the chaperone completes this cleft with its G1 ß-strand in a donor strand complementation process. During polymerization, the chaperone is removed from the last subunit of the growing polymer by an incoming subunit, resulting in head-to-tail polymerization. This mechanism is called donor strand exchange, in which the G1 donor ß-strand of the chaperone is replaced by a similar interaction arising from the N-terminal strand of the subunit (29). Recently published crystallographic structures of Caf1M-Caf1 complexes permitted researchers to determine the differences in the activities of FGL and FGS chaperone-usher pathways (3, 39).
The adhesins of the Dr family in uropathogenic and diarrheal E. coli are encoded by operons that have similar gene organizations. Each operon contains genes encoding the proteins responsible for adhesin biogenesis and the group of genes encoding proteins that regulate the process of expression (21, 35). The amino acid sequences of accessory proteins are rather conserved in the entire family, but adhesin subunits have limited homology.
The Dr hemagglutinin is encoded by a dra operon in uropathogenic E. coli. DraE subunits form a fimbrial structure with an adhesive capacity. The dra gene cluster also encodes the DraC usher and DraB chaperone proteins. DraB-DraE has only limited homology to the previously characterized binary chaperone-subunit complexes PapD-PapK, PapD-PapE, FimC-FimH, and Caf1M-Caf1. It is, therefore, difficult to predict whether the DraB-DraE binary complex operates in a manner similar to these systems.
Here we constructed a recombinant in vitro and in vivo system for expression of DraB and DraE in the periplasm. We then constructed DraE deletion mutants and investigated the donor strand exchange mechanism in DraE oligomer formation. The results of our experiments are consistent with the interpretation that Dr fimbriae are assembled by the conserved chaperone-usher pathway (as proposed previously on the basis of sequence analyses of the dra operon).
|
|
|---|
DE3 lysogenization kit (Novagen). All expression vectors described in this study were derived from the pET30b(+) plasmid (Novagen). Plasmid pET30b-sygDraBE encoding the DraB and DraE proteins in a bicistronic system was constructed in two steps. The draB gene encoding the native DraB protein (with the signal sequence) was amplified by PCR by using forward primer DraB-syg (5'-TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAAATGCGGGCTGTGGCTGTGTTCACCGGC) and reverse primer DraB-stop (5'-TATGGATCCTCAACCCTTCAGCTCTGCCTCAAACTGCTTAC). The 5' overhanging sequence of the forward primer contains an XbaI site (underlined) and a ribosome binding site (RBS) (boldface type), and the 5' overhanging sequence of the reverse primer contains a BamHI site (underlined). The 876-bp PCR product encoding the DraB protein was digested with BamHI and ligated into pUC19 (New England Biolabs) digested with SmaI and BamHI, resulting in recombinant plasmid pUC19-sygDraB. The draB gene was excised from the pUC19-sygDraB plasmid with XbaI and BamHI and ligated into the XbaI and BamHI sites of expression vector pET30b(+) to obtain pET30b-sygDraB. The draE gene was amplified with the following primers: forward primer DraE-syg (5'-ATAGGATCCAACTTTAAGAAGGAGATATACATATGAAAAAATTAGCGATCATGGCCGCGGCCAG) and DraE-stop (5'-TATAAGCTTTCATTTTGCCCAGTAACCCCCGGTCAGGGTC). The forward DraE-syg primer contained an RBS (boldface type) and a BamHI site (underlined), and the DraE-stop primer contained a HindIII site (underlined). The 521-bp PCR product encoding the native DraE protein was digested with BamHI and HindIII and ligated into pET30b-sygDraB digested with the same endonucleases to obtain the expression plasmid pET30b-sygDraBE.
The plasmids encoding native DraB and N-terminal deletion mutants of the DraE protein were constructed by cutting out the 432-bp SacI-HindIII DNA fragment from pET30b-sygDraBE and ligating the PCR products encoding N-truncated DraE proteins into the same restriction sites. The SacI site is located at the end of the sequence coding for the Sec-dependent signal sequence in the DraE protein. The PCR products encoding the N-terminal mutants of DraE were obtained by using the reverse primer DraE-stop described above and the following forward primers (SacI sites are underlined):
1DraE, 5'-ATAGAGCTCCGCTCACGCGTTCACCCCGAGTGGCACCACCG;
2DraE, 5'-ATAGAGCTCCGCTCACGCGACCCCGAGTGGCACCACCGG;
3DraE, 5'-ATAGAGCTCCGCTCACGCGCCGAGTGGCACCACCGGCACC;
4DraE, 5'-ATAGAGCTCCGCTCACGCGAGTGGCACCACCGGCACCAC;
5DraE, 5'-ATAGAGCTCCGCTCACGCGGGCACCACCGGCACCACCAAAC;
8DraE, 5'-ATAGAGCTCCGCTCACGCGGGCACCACCAAACTCACAGTTACCGAAGAGTGCCAGGT; and
11DraE, 5'-ATAGAGCTCCGCTCACGCGAAACTCACAGTTACCGAAGAGTGCCA.
The pET30b-syg
8DraE and pET30b-syg
11DraE plasmids were constructed by cutting the 861-bp XbaI-BamHI fragment containing the draB gene out of the respective bicistronic plasmids (pET30b-sygDraB
8E and pET30b-sygDraB
11E). The overhangs were filled in by using the Pwo DNA polymerase, and the blunt-ended plasmids were then religated, resulting in plasmids that expressed the
8DraE and
11DraE proteins.
The pET30b-sygDraBC103A plasmid, encoding an alanine mutant at cysteine 103 of the DraB protein, was created from the pET30b-sygDraB plasmid by using a QuikChange site-directed mutagenesis kit according to the instructions of the manufacturer (Stratagene, La Jolla, Calif.).
The pET30b-DraE plasmid was constructed by cloning the 441-bp PCR product encoding the DraE protein without the signal sequence into the NdeI and HindIII sites of the pET30b(+) plasmid with forward primer 5'-ATAATACATATGGGGTTCACCCCGAGTGG (NdeI site underlined) and reverse primer 5'-TTGAAGCTTTCATTTTGCCCAGTAACCCCC (HindIII site underlined). The pET30b-DraEC21A plasmid, encoding an alanine mutant with a mutation at cysteine 21 of the DraE protein, was constructed from the pET30b-DraE plasmid by using a QuikChange site-directed mutagenesis kit (Stratagene).
In all PCRs the Pwo DNA polymerase (DNA-Gda
sk II s.c., Gda
sk, Poland) was used. After enzymatic reactions the DNA fragments were purified by using a DNA Clean Up kit (A&A Biotechnology, Gdynia, Poland). The nucleotide sequences of all recombinant plasmids were confirmed by sequencing (DNA-Gda
sk II s.c.).
Protein expression and purification. The E. coli BL21(DE3) and B178(DE3)htrA63 strains transformed with appropriate plasmids were typically cultivated to an A600 of 0.4 in Luria-Bertani medium supplemented with 20 µg of kanamycin per ml, and protein expression was induced by adding isopropyl-ß-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM for 2 h. Then the cultures were harvested by centrifugation, and periplasmic fractions containing the target proteins were extracted by the osmotic shock procedure (41). To purify complexes of the DraB chaperone with DraE oligomers, the periplasmic fraction obtained from 1 liter of culture was dialyzed overnight against buffer A containing 10 mM NaCl and 20 mM Tris-HCl (pH 7.0). The dialyzed sample was applied to a Resource Q 6-ml anion-exchange column and eluted with a 10 to 400 mM NaCl gradient. At this chromatography step the oligomers were not well resolved. The eluted fractions, which in a dot blot analysis reacted with anti-DraE antibodies, were dialyzed against buffer A and, after concentration to an appropriate volume, were applied to a Mono Q HR 5/5 anion-exchange column. The complexes were eluted with a 10 to 400 mM NaCl gradient, and five well-resolved peaks containing DraB in complexes with DraE oligomers were obtained. DraB-DraE binary complexes were purified on a Resource S 6-ml cation-exchange column by using buffer B (50 mM CH3COONa [pH 5.5]) with a 0 to 250 mM NaCl gradient. Finally, binary complexes were resolved by fractionation on a Superdex G-200 HR 10/30 column with buffer B containing 20 mM NaCl.
The periplasmic extract containing the DraB protein was dialyzed against 20 mM NaCl-20 mM Tris-HCl (pH 7.5) and then applied to a Resource Q 6-ml column. The DraB protein was eluted with a 20 to 300 mM NaCl gradient in 20 mM Tris-HCl (pH 7.5). Finally, the DraB chaperone was resolved by fractionation on a Superdex G-200 HR 10/30 column in buffer containing 20 mM NaCl and 20 mM Tris-HCl (pH 7.5).
The E. coli BL21(DE3) strain transformed with pET30b-DraE (or derivatives of this plasmid) was grown to an A600 of 0.4 in Luria-Bertani medium containing 20 µg of kanamycin per ml. Protein expression was induced by adding IPTG to a final concentration of 1 mM for 4 h. Then the cells were harvested by centrifugation and disrupted by sonication. The centrifuged fraction containing inclusion bodies composed mainly of DraE protein was washed twice with buffer containing 1% Triton X-100, 0.5 mM dithiothreitol (DTT), and 20 mM Tris-HCl (pH 7.5) to remove contaminating proteins. After this, the inclusion bodies were centrifuged and solubilized under denaturing conditions (4 M guanidine-HCl [GuHCl], 0.5 mM DTT, 20 mM Tris-HCl; pH 7.5) for 2 h at 37°C with vigorous shaking. After solubilization the sample was centrifuged, and the supernatant containing denatured DraE protein (purity, 85%) was collected. The purified DraE protein was concentrated by using an Amicon Ultra concentrator (molecular mass cutoff, 10 kDa; Millipore, Eschborn, Germany) to obtain a final concentration of 40 mg/ml.
Renaturation of DraE.
DraE protein (5 µl of a denatured sample [40 mg/ml]) was mixed with 800 µl of refolding buffer (50 mM CH3COONa, pH 5.5) containing DraB protein at a concentration of 5 mg/ml for 1 h at 25°C. After this, the sample was centrifuged and passed through a 0.45-µm-pore-size filter to remove potential precipitates. The supernatant obtained was analyzed by exclusion chromatography on a Superdex G-200 HR 10/30 column in buffer containing 20 mM NaCl and 50 mM CH3COONa (pH 5.5). The eluted fractions were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and Western blotting with anti-DraE and anti-DraB antibodies. In the negative control experiment, we used refolding buffer with bovine serum albumin (BSA) (5 mg/ml). To determine the specificity of binary complex formation, we used refolding buffer containing the following proteins: DraB (5 mg/ml), BSA (3 mg/ml; molecular mass, 66 kDa), carbonic anhydrase (3 mg/ml; from bovine erythrocytes; molecular mass, 30 kDa), and
-lactalbumin (4 mg/ml; from bovine milk; molecular mass, 14.4 kDa). To promote the formation of disulfide bonds in DraE protein complexed with DraB, the sample obtained from exclusion chromatography was dialyzed against oxidation buffer containing 1 mM reduced glutathione, 0.2 mM oxidized glutathione, and 20 mM Tris-HCl (pH 7.3) overnight at 4°C.
Detection of free thiols and disulfide bonds. To detect disulfide bonds, we used a nondirect method based on Ellman's reagent, 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB). DTNB is used directly to estimate the presence of free thiol groups; DTNB reacts with the thiol to give mixed disulfide and 2-nitro-5-thiobenzoic acid (TNB), which is quantified by absorbance of the anion (TNB2) at 412 nm. In the first step, the sample was carboxymethylated with iodoacetamide, which resulted in modification of free thiols, while the disulfide bonds were left intact. Next, the sample with derivatized free thiols was denatured in 6 M GuHCl-0.1 M Tris-HCl (pH 8.0), and this was followed by reduction of disulfide bonds with 10 mM DTT for 2 h. The excess DTT was removed by dialysis against a detection buffer containing 0.1 M phosphate (pH 8.0). To detect free thiols corresponding to disulfide bonds, after dialysis the sample was treated with Ellman's solution containing 10 mM DTNB and 0.1 M phosphate buffer (pH 8.0), and the absorbance at 412 nm was measured. The concentration of thiols was calculated for the molar absorbance of the TNB anion (E412 = 1.415 x 104 cm1 M1). To detect the disulfide bonds, we used 2 nM mature DraB protein or the corresponding cysteine mutant in each reaction.
Partial proteolysis.
Partial proteolysis was performed by using proteinase K (Merck, Darmstadt, Germany) at concentrations of 0.1, 1, 10, and 30 µg/ml and 0.1, 1, and 2 mg/ml (total volume, 17 µl). In the assays we used 10 µl of purified DraB complexes with the N-terminal deletion mutants of the DraE protein (1 mg/ml) or purified unresolved complexes of DraB with native DraE,
1DraE, or
2DraE protein at concentrations of
2 mg/ml (as determined by densitometric analysis). Digestion was performed in a buffer containing 2 mM CaCl2 and 20 mM Tris-HCl (pH 7.8) for 20 min at 25°C. Reactions were stopped by adding a proteinase inhibitor, phenylmethylsulfonyl fluoride, to a final concentration of 2 mM.
Two-dimensional (2D) electrophoresis. Isoelectric focusing IEF (first dimension) was performed by using an Ettan IPGphor II system (Amersham Bioscience, Uppsala, Sweden) and 13-cm-long IPG strips with an immobilized pH 3 to 10 gradient (Amersham Bioscience). Periplasm extract samples were loaded onto the IPG strips during rehydration. The rehydration was carried out for 16 h in 250 µl of buffer containing 0.5% (vol/vol) IPG buffer (pH 3 to 10), 0.002% (wt/vol) bromophenol blue, and 80 µl of periplasmic extract (10 mM MgCl2). To protect DraE oligomers from depolymerization, we did not use recommended denaturing agents, such as urea, in the rehydration buffer. The high-molecular-weight oligomers of DraE proteins were not loaded onto IPG strips under the rehydration reaction conditions used. The IEF was performed with a standard voltage gradient (200 to 5,000 V) for 12 h. The IEF strips were then equilibrated for 20 min with buffer containing 30% (vol/vol) glycerol, 2% (wt/vol) SDS, 0.002% (wt/vol) bromophenol blue, and 50 mM Tris-HCl (pH 8.8); this was followed by SDS-PAGE in a 12% polyacrylamide gel. The gels were stained with a ProteoSilver staining kit (Sigma, St. Louis, Mo.) or were analyzed by Western blotting.
Other techniques. SDS-PAGE was carried out by using samples that were heated in Laemmli buffer at 98°C for 5 min or were incubated with Laemmli buffer at 25°C for 10 min but not denatured thermally. Immunoblot detection of DraE and DraB proteins was performed with polyclonal rabbit monospecific anti-DraE and anti-DraB antibodies, respectively, and secondary anti-rabbit goat antibodies labeled with horseradish peroxidase and diaminobenzidine as a reaction substrate.
Dr adhesins were detected on the surface of E. coli strains by using rabbit anti-DraE antibodies and secondary anti-rabbit goat antibodies conjugated with fluorescein isothiocyanate, and stained fimbriae were viewed with an Olympus BX-60 fluorescence microscope system. Densitometric analyses of SDS-PAGE gels stained with Coomassie brilliant blue G-250 were performed with an SDS low-molecular-weight calibration kit (Amersham Bioscience) by using a VersaDoc system (Bio-Rad, Hertfordshire, United Kingdom) with Quantity One software (Bio-Rad). DNA sequencing and determination of the N-terminal sequence of the mature DraB protein were performed commercially (DNA-Gda
sk II s.c.).
|
|
|---|
![]() View larger version (87K): [in a new window] |
FIG. 1. Alignment of the amino acid sequences of the following chaperones: DraB (GenBank accession number AY481577) (this study), Caf1M (gi: 17380416), PapD (gi: 1172013), and FimC (gi: 29839277). Levels of identity and similarity are indicated as follows: white type with a black background, 100% identity; white type with a grey background, >80% similarity; and black type with a grey background, >60% similarity. In the region from residues 120 to 140 of the alignment are sequences corresponding to loops connecting ß-strands F1 and G1. The arrowheads indicate conserved cysteines that form disulfide bonds in FGL chaperones. ClustalX was used to align the sequences (38).
|
![]() View larger version (46K): [in a new window] |
FIG. 4. 2D electrophoresis of periplasmic fractions of E. coli BL21(DE3)/pET30b-sygDraBE (A) and E. coli BL21(DE3)/pET30b (B). [n] indicates oligomers of the DraE protein resolved on the gel; 1 corresponds to a monomer of DraE, and 2, 3, 4, 5, and 6 correspond to a dimer, a trimer, a tetramer, a pentamer and a hexamer of DraE, respectively. In panel A at pH 9 and 30 kDa is a spot corresponding to the DraB protein. The IEF was performed with a linear pH 3 to 10 gradient as indicated at the top. Separation by size was performed by using an SDS-12% polyacrylamide gel; the masses of compounds in a low-molecular-mass protein marker (Amersham Bioscience) are indicated between the gels. The gels were stained with silver.
|
![]() View larger version (102K): [in a new window] |
FIG. 2. Renaturation of denatured DraE protein with DraB chaperone: SDS-PAGE analysis. Lane 1 contained inclusion bodies of DraE protein isolated from E. coli BL21(DE3)/pET30b-DraE, and lane 2 contained DraE protein purified by extraction with Triton X-100 followed by solubilization in 4 M GuHCl. Lanes 3 and 4 show the results of a gel filtration analysis for a renaturation experiment in which the DraE protein was used with renaturation buffer containing the native DraB chaperone (with a disulfide bond); lane 3 contained a sample corresponding to a peak containing only DraB protein (not complexed with DraE), and lane 4 contained a sample corresponding to a peak containing DraB-DraE binary complexes. Lanes M contained a low-molecular-mass marker (Amersham Biosciences) which included 14.4-, 20.1-, 30.0-, 45.0-, 66.0-, and 99.0-kDa compounds.
|
-lactalbumin (4 mg/ml). In this experiment, only the mature DraB protein was able to form soluble binary complexes with the DraE protein. These results agreed with the results of experiments in which the role of the homologous cysteines in the CaF1M chaperone was determined. Overproduced DraE adhesin has a toxic effect on E. coli cells. Previous studies showed that E. coli cells harboring the pBJN417 plasmid (24) (containing the dra operon with a transposon mutation in a draC gene encoding the outer membrane usher) do not express surface-located Dr fimbriae. The mutant strain also lost the ability to bind to CHO cells expressing the DAF receptor. A similar phenotypic effect was obtained with an E. coli strain harboring the pBJN413 plasmid (containing the dra operon with a transposon mutation in a draB gene) (24). As described above, we showed that the cytoplasmic form of the DraE protein (without its signal sequence) expressed from pET30b-DraE accumulated as insoluble inclusion bodies. When the DraE protein was expressed with its signal sequence (plasmid pET30b-sygDraE), cell growth and the DraE production levels depended on the strength of induction of the cell culture. When the protein was expressed at 30°C with IPTG added to a final concentration of 1 mM (A600, 0.30), it had a toxic effect in connection with overproduction of the DraE protein from a strong T7 promoter. The E. coli cells produced DraE adhesin by 2 h after induction and reached a maximal optical density (A600) of 0.41. Incubation for three additional hours resulted in a reduced optical density (0.32). Under the same cultivation conditions, the control cells, harboring the pET30b vector, grew logarithmically to a maximal optical density of 1.2 (6 h after induction) and reached a stable stationary phase (results not shown). SDS-PAGE and Western blot analysis with anti-DraE antibodies of total cell lysates (taken from cultures during expression) revealed the presence of the DraE protein with and without a signal sequence. When the IPTG concentration was reduced to 0.1 mM, the bacterial cell growth in both cases was almost the same, and Western blotting of total cell lysates showed only the presence of the DraE protein with a signal sequence (cytoplasmic form). The absence of the DraE protein in the periplasm (without a signal sequence) suggests that it was probably efficiently degraded by periplasmic proteases, and no toxic effect was observed. When there was a high level of overproduction (1 mM IPTG), the proteolytic systems probably could not efficiently degrade the misfolded DraE protein, and thus toxicity occurred. These data suggest that fimbrial DraE subunits produced without the DraB chaperone had toxic effects on expressing cells, resulting in accumulation of misfolded DraE protein in the periplasmic space. These data agree with the reports describing expression of pilin subunits of other polymeric structures assembled by the usher-chaperone system (17).
DraB-DraEn complexes accumulate in the periplasm in the absence of the usher DraC. To investigate the mechanism of DraB-DraE complex formation and polymerization of DraE subunits, we constructed the pET30b-sygDraBE plasmid. In this bicistronic construct, the draB and draE genes (each with its own ribosome binding site) were under the control of a common T7 promoter (Tabor-Studier expression system [34]). The draB gene was located proximal to the promoter region, and the draE gene was located distal to the promoter region. One feature of E. coli polycistronic systems is that translation from the first RBS proximal to the promoter is stronger than translation from the RBS sites located distally. Therefore, the level of expression of the DraB chaperone was higher than that of the DraE adhesin from the bicistronic plasmid constructed (Fig. 3A). In accordance with the chaperone-usher pathway, the subunits of outer membrane polymers are able to fold into the native form only by interacting with a cognate chaperone protein to form a chaperone-subunit complex. As first shown for P pili of E. coli, coexpression of the PapD chaperone with pilin subunits eliminated the toxic effect resulting from expression of the subunit alone (17). Thus, in the bicistronic vector constructed, the higher level of expression of the DraB chaperone than of the DraE protein eliminated the previously described toxic effect connected with accumulation of misfolded DraE hemagglutinin. The SDS-PAGE and Western blot analyses of crude extracts of expressing cells harboring plasmid pET30b-sygDraBE revealed two bands that reacted with anti-DraE antibodies corresponding to the DraE protein with and without its signal sequence and also two other bands that reacted with anti-DraB antibodies corresponding to the DraB protein with and without its signal sequence. In isolates isolated from periplasmic fractions, two bands corresponding to the mature forms of the DraB and DraE proteins were detected (Fig. 3C). Densitometric analyses of SDS-PAGE gels containing periplasmic samples showed that the DraB chaperone accounted for almost 40% of the total protein content and DraE accounted for 25% of the total protein content (Fig. 3A).
![]() View larger version (74K): [in a new window] |
FIG. 3. Expression analysis of DraB and DraE proteins from E. coli BL21(DE3)/pET30b-sygDraBE. (A) Denaturing SDS-PAGE of crude extracts and periplasm fractions taken 2 h after induction. Lane 1, total lysate of control E. coli BL21(DE3)/pET30b; lane 2, total lysate of E. coli BL21(DE3)/pET30b-sygDraBE; lane 3, periplasmic fraction of E. coli BL21(DE3)/pET30b; lane 4, periplasmic fraction of E. coli BL21(DE3)/pET30b-sygDraBE. (B) Western blot analysis of periplasmic fraction of E. coli BL21(DE3)/pET30b-sygDraBE with anti-DraE antibodies. Lane 1, sample denatured at 98°C; lane 2, sample not denatured thermally. The arrowheads indicate a monomer form of DraE protein, LMW, low-molecular-weight oligomers of the DraE protein (composed of at most five adhesin subunits) resolvable on an SDS15% polyacrylamide gel; HMW, high-molecular-weight oligomers of DraE adhesin. (C) Western blot analysis of crude extracts and periplasm fraction of E. coli BL21(DE3)/pET30b-sygDraBE with anti-DraB and anti-DraE antibodies. Lane 1, crude extracts, sample denatured at 98°C; lane 2, periplasm fractions, sample denatured at 98°C. The open and solid arrowheads indicate the positions of the cytoplasmic forms (with signal sequence) of the DraB and DraE proteins, respectively.
|
Using two-step ion-exchange chromatography and the gel filtration technique, we purified oligomers corresponding to DraEn (n = 2 to 5). The DraB-DraE binary complex was unstable at pH 7.0, the pH at which we purified oligomers, and therefore we used cation-exchange chromatography and pH 5.5 buffers to purify the oligomers. Analysis of purified oligomers by SDS-PAGE revealed the presence of the DraE and DraB proteins. To determine the amount of the DraE protein in the periplasmic fraction in an oligomeric form in relation to the total amount of DraE, we performed densitometry analyses of SDS-polyacrylamide gels stained with Coomassie brilliant blue G-250. The total amount of DraE was evaluated on gels containing resolved periplasmic samples that were denatured at 98°C for 5 min. The concentration of the DraE protein not in oligomers was determined by using the same periplasmic samples incubated at room temperature in Laemmli buffer. The densitometric data showed that almost 70% of the total DraE protein was in an oligomeric form (Fig. 3B). These data showed that in E. coli BL21(DE3)/pET30b-sygDraBE, in the absence of the DraC usher protein, DraB-DraE binary complexes and DraB-DraEn oligomers accumulated in the periplasm. In the presence of excess chaperone DraB, the DraE protein appeared mainly in an oligomeric form, which suggested that the DraE polymerization process is more favorable than the formation of DraB-DraE binary complexes or that the DraE oligomers are more stable thermodynamically than the DraB-DraE complexes. These data agree with the thermodynamic models of subunit polymerization proposed independently by Sauer et al. (26) and Zavialov et al. (39). According to these models, the energy driving the donor strand exchange reaction is stored in a high-energy, molten-globule-like subunit in a complex with the chaperone. During polymerization, subunits rearrange structurally to form a more rigid core with lower energy.
N-terminal strand of the DraE subunit is required for DraE oligomer formation.
In surface-located polymeric systems in which biogenesis occurs by the usher-chaperone mechanism, the subunits possess two critical sequences responsible for polymerization: the N-terminal donor strand and a C-terminal strand homologous to ß-strand F of P and type 1 pilus subunits (40). During polymerization, the incoming subunit for the donor strand exchange reaction depletes the chaperone protein from the complex with the last subunit of a growing polymer. Crystallographic data showed that during this reaction the N-terminal strand for the incoming subunit exchange prevented the donor strand of the chaperone from interacting with ß-strand F of the last subunit of the polymer. Due to the limited sequence similarity between polymeric subunits for FGL chaperones, we could not precisely predict the minimal sequence of a donor strand in the DraE protein. Thus, mutation analysis of the N-terminal region comprising residues 1 to 11 of the mature DraE protein was performed. In this sequence we distinguished two fragments: two consecutive GTT sequences (residues 6 to 11) and a region comprising the first five N-terminal residues, which had no unique features. Using the pET30b-sygDraBE plasmid, we constructed N-terminal deletion mutants of the DraE protein, including
1DraE,
2DraE,
3DraE,
4DraE,
5DraE,
8DraE, and
11DraE (Table 1). Periplasmic samples isolated from all of the mutants incubated at the ambient temperature or at 98°C were analyzed by SDS-PAGE and Western blotting by using anti-DraE and anti-DraB antibodies. A periplasmic extract from E. coli Bl21(DE3)/pET30b-sygDraBE was the reference point in the analysis of the extracts from DraE deletion mutants. To determine the region comprising the signal for polymerization, we first prepared three long N-terminal deletion mutants,
11DraE,
8DraE, and
5DraE. These mutants did not all polymerize to oligomeric forms detectable by SDS-PAGE and Western blotting (samples were not denatured thermally) (Fig. 5A). Using cation-exchange and exclusion chromatographic techniques, we purified all of the DraE mutants as stable complexes with the DraB chaperone. Western blot analysis of eluted fractions with the anti-DraE and anti-DraB antibodies proved that the
DraE and DraB proteins were present. The level of recovery of
5DraE was comparable to the level of recovery of the wild-type DraE protein. In the case of
8DraE and
11DraE the amount of mutated protein was much smaller than the amount of wild-type DraE protein.
|
View this table: [in a new window] |
TABLE 1. Properties of constructed DraE N-terminal deletion mutants and native DraE
|
![]() View larger version (73K): [in a new window] |
FIG. 5. Western blot analysis of periplasmic extracts from strain E. coli BL21(DE3)/pET30b-sygDraBE and derivatives of this strain with N-terminal deletions in the DraE protein with anti-DraE antibodies. Before electrophoresis (SDS-15% polyacrylamide gel) samples were incubated with Laemmli buffer at room temperature (25°C) (lanes 25) or were denatured thermally at 98°C (lanes 98). (A) Analysis of long-range mutants, including strains expressing the proteins 5DraE (delta5), 8DraE (delta8), and 11DraE (delta11), as well as a periplasmic fraction isolated from strain E. coli BL21(DE3)/pET30b-sygDraBE (native). (B) Analysis of short N-terminal mutants of DraE, including strains expressing 1DraE (delta1), 2DraE (delta2), 3DraE (delta3), 4DraE (delta4), and 5DraE (delta5).
|
8DraE and
11DraE recovery, we performed experiments with E. coli B178(DE3)htrA63 (with a transposon mutation in the htrA [degP] gene). When the
8DraE and
11DraE proteins were expressed without the chaperone DraB (plasmids pET30b-syg
8DraE and pET30b-syg
11DraE, respectively) in degP+ cells, we did not obtain a signal for these proteins in SDS-PAGE and Western blot analyses. Previously described data showed that expression in a degP+ strain harboring plasmid pET30b-sygDraB
8/
11E resulted in the formation of binary complexes of DraB with a cognate deletion mutant of DraE. This suggested that DraB reacts with long deletion mutants of DraE and, to some degree, protects them from proteolysis. Expression from E. coli strain B178(DE3)htrA63 transformed with plasmid pET30b-sygDraB
8/
11E resulted in a level of recovery of deletion mutants of DraE that was higher than the level obtained for the degP+ strain (data not shown). These data suggest that the long deletion mutants of DraE probably have a more flexible structure in complexes with the DraB chaperone and are more susceptible to degradation by periplasmic proteases.
To further determine the N-terminal amino acids of DraE required for polymerization, we constructed the following mutants:
4DraE,
3DraE,
2DraE, and
1DraE. The
3DraE and
4DraE mutant proteins did not polymerize (oligomers were not detectable in Western blots of SDS-polyacrylamide gels; samples were not denatured thermally) (Fig. 5B). The properties of these mutants were very similar to those described above for the
5DraE protein. The periplasmic extract from cells expressing the
2DraE mutant assayed by SDS-PAGE (samples were not denatured thermally) and Western blotting with anti-DraE antibodies contained oligomers composed of at most five subunits of
2DraE, and high-molecular-weight oligomers were not detected (Fig. 5B). As was the case with the
11DraE,
8DraE, and
5DraE deletion mutants, we purified the
4DraE,
3DraE,
2DraE, and
1DraE proteins as stable binary complexes with the DraB protein. The oligomeric properties of the
1DraE mutant were almost the same as those of the native DraE (Fig. 5B).
These data showed that deletion of the first three residues from the N terminus of the mature DraE protein resulted in a mutant which was capable of forming only binary complexes with chaperone DraB and was deficient in formation of DraE oligomers.
To determine the properties of the constructed N-terminal deletion mutants of the DraE protein for the formation of Dr fimbriae in vivo, the pBJN17 plasmid (containing the dra operon with a transposon mutation in the draE gene) (24) was introduced into E. coli BL21(DE3) strains containing constructed plasmids encoding DraE N-terminal mutants. The transformants obtained were cultivated on Luria-Bertani agar plates complemented with IPTG (6 mM), an inducer of DraE mutant protein expression from constructed plasmids. The presence of Dr fimbriae on the surface of E. coli cells was analyzed by an immunofluorescence assay by using anti-DraE antibodies. Only the strain transformed with pET30b-sygDraB
1E expressed surface-located Dr fimbriae. The amount of
1DraE was similar to the amount in cells transformed with control plasmid pET30b-sygDraBE (data not shown).
Oligomerization of DraE subunits increases their resistance to proteolysis.
The data described above showed that deletion of more than two residues from the N terminus of the DraE protein diminished the capacity to form DraE oligomers but did not influence the formation of DraB-DraE binary complexes. The longer deletions (
8DraE and
11DraE) resulted in DraE proteins that were more susceptible to degradation by periplasmic proteases. To investigate the effect of N-terminal deletions on the stability of the DraE protein, we examined the resistance of all mutants obtained to proteolysis by proteinase K (Table 1). Protein complexes of the DraB chaperone with mutant or native DraE, purified by ion-exchange chromatography, were treated with different concentrations of proteinase K (0.1 µg/ml to 2 mg/ml) for 20 min at 25°C. The
8DraE and
11DraE proteins were not detected in samples treated with proteinase K at a concentration of 0.5 µg/ml. The
3DraE,
4DraE, and
5DraE mutants were much more resistant to degradation by proteinase K; the
3DraE protein was detected with anti-DraE antibodies in samples incubated with 30 µg of proteinase K per ml at 25°C.
To measure the resistance of oligomeric DraE proteins in complexes with DraB, we used samples purified by ion-exchange chromatography. Following proteolysis, samples were analyzed by SDS-PAGE (without thermal denaturation) and by Western blotting (Fig. 6). Treatment with proteinase K (10 µg/ml) resulted in the disappearance of monomeric mature DraE (DraB-DraE binary complex) and the appearance of a new band at a molecular mass that was
1.5 kDa lower than that of mature DraE. Western blotting showed that this band reacted with anti-DraE antibody (Fig. 6). In addition, the conentration of low-molecular-weight oligomers decreased. Treatment with 2 mg of proteinase K per ml resulted in only the bands corresponding to high-molecular-weight oligomers (Fig. 6), and similar results were obtained when a proteinase K concentration of 10 mg/ml was used (data not shown). The properties of the
1DraE protein were the same as those of the native DraE protein. The resistance of the
2DraE protein to proteolysis was similar to the resistance of low-molecular-weight oligomers of native DraE protein.
![]() View larger version (65K): [in a new window] |
FIG. 6. Western blot analysis with anti-DraE antibodies of partial proteolysis samples of purified DraB-DraEn oligomers isolated from E. coli BL21(DE3)/pET30b-sygDraBE. Lanes 98 and 25, digestion samples incubated with Laemmli buffer at 98 and 25°C, respectively, followed by electrophoresis (SDS15% polyacrylamide gel). The arrowhead indicates the position of the product of digestion of the DraE protein with the molecular mass reduced 1.5 kDa relative to the molecular mass of the intact protein. The concentrations of proteinase K used are indicated at the top.
|
8DraE and
11DraE mutants confirmed that these proteins have a more accessible core (flexible structure) than the native DraE protein and, therefore, are more susceptible to degradation. The crystalline structure of the ternary complex of the Caf1M chaperone with a dimer of Caf1 subunits (39) and the models of polymerization proposed for P and type 1 pili (12) show that during the formation of oligomers the subunits rearrange in a more rigid form. During the biogenesis of the rigid pili (P and type 1 pili), there are second-order interactions in addition to head-to-tail interactions between subunits, which also stabilize the polymer. Our data for proteolytic resistance of oligomeric forms of the native DraE protein agree with the data obtained previously for other polymers. Disulfide bond of DraE is necessary in oligomer formation. An experiment in which we examined the refolding of denatured DraE protein showed that the native DraB protein formed binary complexes with the DraE subunit. The denatured DraE protein used in this experiment was in a form with reduced disulfide bonds. To investigate if the disulfide bond in DraE is necessary for oligomerization, the DraB-DraE (Cys-reduced) binary complexes obtained were dialyzed against oxidizing buffer containing reduced and oxidized glutathione. To detect the appearance of oligomers after oxidation, the samples were analyzed by SDS-PAGE (samples were not denatured thermally) and stained with silver. An intense band corresponding to the DraE monomer and three additional weak bands, which migrated as DraEn oligomers (n = 2 to 4), were observed. Western blot analysis showed that these bands reacted with anti-DraE antibodies. To verify that the oligomers of DraE detected were not formed due to intersubunit disulfide bonds, before electrophoresis the samples were incubated for 10 min at 50°C in Laemmli buffer with double the normal concentration of DTT. The same refolding and oxidizing experiment was performed with denatured DraE C21A mutant protein (expression plasmid pET30b-DraEC21A). DraEnC21A oligomers were not detected on a silver-stained SDS-polyacrylamide gel. These assays showed that the disulfide bond in the DraE protein is not required to form a binary complex with the DraB chaperone but is important in oligomerization.
Disulfide bond of the DraE subunit is not necessary for maintenance of the polymeric structure of DraE oligomers. In the experiments described above, samples of DraE oligomers prepared by incubation in Laemmli buffer without thermal denaturation were easily detected by SDS-PAGE. Additionally, the oligomers purified from the periplasm and treated with DTT at the same concentration as the concentration in Laemmli buffer reacted with Ellman's reagent. These experiments suggested that disulfide bonds in DraE subunits were not necessary for maintaining the oligomeric structure. We determined the influence of the DraE disulfide bond on the stability of the DraE oligomers by incubating them in Laemmli buffer with and without DTT at temperatures from 50 to 90°C (Fig. 7). Western blot analysis showed that oligomers incubated with buffer containing DTT were depolymerized almost totally at 60°C, but the oligomers incubated with the same buffer without DTT were highly visible at 70°C. Treatment with proteinase K showed that resistance to proteolysis increased continuously from the low-molecular-weight DraE oligomers to the high-molecular-weight DraE oligomers. Analysis of oligomer resistance to depolymerization in the temperature gradient showed that all oligomers disappeared simultaneously at the same temperature. This suggests that the observed depolymerization was probably a secondary effect induced by thermal denaturation of the DraE subunit. At this stage the lower thermal resistance to destruction of oligomers treated with DTT may be accomplished simply with a decrease in the stability of the DraE protein caused by reduction of the disulfide bond.
![]() View larger version (36K): [in a new window] |
FIG. 7. Western blot analysis of samples of DraE oligomers treated in classical Laemmli buffer containing DTT (lanes +) or with modified Laemmli buffer without DTT (lanes ) at 50, 60, 70, 80, and 90°C, followed by electrophoresis (SDS15% polyacrylamide gel). The arrowhead indicates the position of a monomer form of the DraE adhesin.
|
sk University of Technology, ul. Narutowicza 11/12, 80-952 Gda
sk, Poland. Phone: 48 58 3471822. Fax: 48 3471822. E-mail: kur{at}altis.chem.pg.gda.pl. |
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»