Unité de Recherches Laitières et Génétique Appliquée, Institut National de la Recherche Agronomique, Jouy en Josas, France,1 Institute of Fundamental Microbiology, Dorigny, Lausanne, Switzerland2
Received 29 June 2004/ Returned for modification 30 August 2004/ Accepted 22 September 2004
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
S. aureus virulence involves the temporally coordinated synthesis of a large number of surface and secreted proteins. Surface proteins (e.g., protein A and fibrinogen-, fibronectin-, and collagen-binding proteins) mediate bacterial adherence to host tissues and may facilitate the evasion of host defense mechanisms (21, 40), and they are mainly synthesized during the exponential growth phase (40). Secreted exotoxins (e.g., hemolysins and enterotoxins [3, 40]) and exoenzymes (e.g., coagulase, nuclease, and proteases [2]) are implicated in bacterial dissemination and are produced during the postexponential phase (40). The best-characterized regulator of this temporal program of gene expression is the agr (accessory gene regulator) quorum-sensing system. agr comprises genes expressed from two divergent transcripts. The first transcript, called RNA II, encodes AgrA, AgrB, AgrC, and AgrD. AgrD is the precursor of the secreted autoinducing peptide (AIP), which is processed by the transmembrane protein AgrB. AgrC and AgrA are required for sensing and responding to AIP (41). AIP activates the AgrC/AgrA two-component system to induce the transcription of RNA II and a second transcript, called RNA III. RNA III modulates the production of S. aureus extracellular proteins at both the transcriptional and posttranscriptional levels (41). Another global regulator, the DNA binding protein SarA (staphylococcal accessory regulator), is required for maximal agr expression (41). Other regulators of virulence gene expression, such as the stress response sigma factor
B (41), act either independently or in synergy with the agr and sarA regulatory pathways (5, 41).
The ability of S. aureus to cause a multiplicity of infections depends on the complement of virulence factors present in infectious strains and, in some cases, on the presence of antibiotic resistance markers (11). Variations among strains in their genome content, corresponding to insertion elements, transposons, phages, pathogenicity islands, or point mutations (11), may contribute to the differences in infectivity. In addition, the orchestration of virulence regulators may differ between strains, leading to different consequences in the host (41).
The capacity of Staphylococcus to withstand stress conditions may contribute to its pathogenicity. Proteases are among the numerous factors that may be important for bacterial survival in vivo. Proteases acting in the cytoplasm, such as ClpXP or the membrane-associated FtsH protein (14, 32), are responsible for the degradation of damaged proteins produced during stress conditions (14, 32). In addition, chaperone activities of the FtsH and ClpP proteins participate in the quality control of cytoplasmic (by FtsH and ClpP) and membrane (by FtsH) proteins (14, 32). FtsH is reportedly needed for virulence through its involvement in survival under stress conditions (32). In contrast, Clp proteins were shown to modulate virulence factor expression, which was suggested to be their major role in S. aureus virulence (14).
The surface serine protease HtrA (high temperature requirement) was first described for Escherichia coli as a housekeeping protease, and it is the prototype of a highly conserved family that is present in bacteria, yeasts, plants, and humans. In E. coli, HtrA is responsible for the degradation of periplasmic abnormal (51) or damaged proteins produced during thermal or oxidative stress (31, 47, 51). It also exhibits a chaperone activity at low growth temperatures (28, 49).
HtrA-like proteases are involved in the virulence of gram-negative (4, 8, 24) and gram-positive (23, 25) pathogens, mainly by their role in stress resistance and survival (8, 24, 25). However, in Streptococcus pyogenes, HtrA reportedly intervenes in the processing of an extracellular virulence factor and in the control of hemolytic activity (33). Many bacteria contain more than one HtrA homolog, suggesting that a surface protease may be important for different conditions of bacterial life (1, 4, 37, 53).
S. aureus encodes two putative HtrA-like surface proteases (referred to as HtrA1 and HtrA2), as revealed by genome analyses. Both the htrA1 and htrA2 genes were recently cloned by use of a conditional expression system into an htrA mutant strain of Lactococcus lactis (45). Although expression of both the HtrA1 and HtrA2 proteins was achieved, only HtrA1 conferred protection against thermal stress on the thermosensitive L. lactis htrA mutant. Interestingly, despite its efficient stress protection, HtrA1 displayed only a weak protease activity (HtrA2 displayed essentially no phenotype) when tested against several substrates. These observations led us to suggest that in L. lactis, chaperone activity may be a major factor in stress response protection by HtrA1, and that additional proteins and/or cofactors are required for the protease activities of both proteins.
For this study, we constructed htrA1 and htrA2 single and double mutants in two genetically distinct virulent S. aureus strains, RN6390 and COL. Studies with these mutants showed that both htrA genes are phenotypically active in staphylococci but that they have different functions according to the genetic background of the strains. Although the stress sensitivities of the two isolates are different, HtrA1 had a more pronounced role in the stress response than HtrA2 in both strains, and the double mutants were slightly more sensitive to stress. In addition, the RN6390 htrA1 htrA2 mutant displayed a general defect in the expression of secreted virulence factors, including hemolysins. Its virulence was reduced compared to that of the wild type (WT) in a rat endocarditis model. Based on these data, we propose that in the RN6390 context, HtrA proteins are involved in controlling the expression of crucial secreted virulence factors that contribute to bacterial dissemination.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
0.3, the cultures were diluted in peptone water (1 g of Bacto Peptone [Difco] per liter in water) and dilutions were spotted onto BHI plates containing or not containing the following products: puromycin (between 8 and 12 µg/ml), H2O2 (between 0.5 and 2 mM), D-cycloserine (between 50 and 125 µg/ml), bacitracin (2 U/ml), and oxacillin (between 0.05 and 0.5 µg/ml for RN6390 derivatives). The plates were incubated at 37°C for 24 h before colony count determinations. For heat shock experiments, cells were plated on nonselective BHI medium and incubated at 37, 44, or 45°C for 24 h.
DNA manipulations.
Plasmid and chromosomal DNA preparations, PCR amplifications, and DNA modifications were performed according to commonly used techniques or suppliers' instructions. Lysis of S. aureus cell suspensions was achieved by treatment with 100 µg of lysostaphin (Sigma)/ml for 1 h at 37°C, followed by standard methods for DNA preparation. DNA transformation was performed by the CaCl2 method for E. coli (46) and by the electroporation method using HEPES for S. aureus (27). Transduction was performed as described previously (12) by use of the
80
or
11 phage (kindly provided by Olivier Chesneau, Pasteur Institute, Paris, France).
Construction of double-crossover htrA mutants in S. aureus RN4220.
Strain htrA1::cat, in which the chromosomal htrA1 gene (
1.3 kb) was interrupted by a CHL resistance marker (cat), was constructed as follows. An
1.1-kb internal fragment of the htrA1 gene was amplified from S. aureus strain RN6390 with the forward primer A1-5' (5'-CCAAACACCTAGATACAGAAGACC-3') and the reverse primer A1-3' (5'-CCATCACGGATAACGGTAACAG-3'). The PCR fragment was cloned into the pCRII-TOPO vector (TOPO TA cloning kit; Invitrogen) according to the instructions in the kit's manual, resulting in the plasmid pTopo::htrA1int ("int" stands for "internal fragment"). The
1.5-kb cat gene was amplified from the pC194 plasmid (22) with the primers CAT1 (5'-GGGGGTTACCGCACAGACAGGACAAAATCG-3'), containing a BstEII site (underlined), and CAT2 (5'-GGGCGTACGGGGTTCCGAGGCTCAACGTC-3'), containing a BsiWI site (underlined). An
60-bp fragment was deleted from the htrA1int fragment of pTopo::htrA1int after digestion by BstEII and BsiWI and was replaced with the cat gene digested by the same enzymes. The resulting plasmid, pTopo::htrA1intcat, was then digested with EcoRI; the htrA1intcat fragment was purified and cloned into EcoRI-treated pMAD (M. Débarbouillé, personal communication) to generate pMAD::htrA1intcat. pMAD contains the thermosensitive pE194-based origin of replication (from pRN5101) and the bgaB ß-galactosidase (ß-Gal) gene, which permits easy detection on X-Gal plates of transformants that have lost the plasmid vector through a double-crossover event. The pMAD::htrA1intcat plasmid was isolated from E. coli TG1 and introduced by electroporation into the S. aureus RN4220 strain, and transformants were selected at the permissive temperature (30°C) for ERY resistance. The chromosomal htrA1 inactivation was obtained by use of a positive transformant as follows. An overnight preculture grown at 30°C in BHI medium containing ERY was diluted 100-fold in the same medium without selection. The cells were grown at 30°C for 1 h and then shifted to the nonpermissive temperature of 42°C (6 h) to permit plasmid integration into the chromosome by homologous recombination. Integrants containing the first recombination event were selected at 42°C by their ERY resistance. For selection of the second recombination event, an overnight 42°C culture of a single-crossover mutant grown in the presence of ERY was diluted 1,000-fold in BHI medium without selection and then cultivated at 30°C for 6 h to facilitate excision of the plasmid. Cultures were plated at 42°C on BHI medium containing chloramphenicol. After 48 h, Cmr clones were verified for Cmr Erys and ß-Gal-negative phenotypes. Correct htrA1 gene inactivation was confirmed by PCR and Southern blotting.
Strain htrA2::spc, in which the chromosomal htrA2 gene (
2.3 kb) was interrupted by a SPC resistance marker (spc), was constructed as follows. The
1.2-kb spc gene was amplified from a derivative of pIC333 (50) with the forward primer SaSpc1-5' (5'-GGGGGGATCCCATATGTCACCTAGATCCTTTTGACTC-3'), containing an NdeI site (underlined), and the reverse primer SaSpc3-3' (5'-ACGAGGGTCGACCCCGGGACAAATTGTTTCACTAAATTAAAG-3'), containing a SmaI site (underlined). The pTopo::htrA2 plasmid (45) containing the htrA2 gene was first digested with AccI, blunted, and then digested with NdeI. These digestion reactions resulted in an
955-bp internal deletion of htrA2, which was replaced with the spc PCR fragment after digestion by NdeI and SmaI. The resulting plasmid, pTopo::htrA2spc, was then digested with BamHI; the htrA2spc fragment was purified and cloned into BamHI-treated pMAD to generate pMAD::htrA2spc. As with the htrA1 mutant construction, the plasmid pMAD::htrA2spc was extracted from E. coli TG1 and introduced by electroporation into S. aureus RN4220. Transformants were selected at 30°C by their ERY resistance. An overnight culture at 30°C of a positive transformant in BHI medium containing ERY was diluted 100-fold in the same medium without selection, and the cells were grown at 30°C for 1 h prior to a 6-h shift at 42°C. In this case, a double-crossover mutant of htrA2 was obtained directly by selecting integrants at 42°C on BHI plates containing both spectinomycin and X-Gal after 48 h. Spcr and ß-Gal-negative integrants were tested for ERY sensitivity. Inactivation of the chromosomal htrA2 gene was confirmed by PCR and Southern blotting.
Protein extract preparation, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western blotting, and protein identification. Overnight cultures of staphylococcal strains in BHI medium were diluted in the same medium and grown at 37°C. Cell and supernatant protein extracts were prepared from cells that were harvested at different optical densities, as described for L. lactis by Poquet et al. (42), except that lysostaphin (100 µg/ml) was used instead of lysozyme and incubations (1 h) were performed at 37°C prior to lysis with SDS. For each sample, equivalent protein amounts were loaded into SDS-15% polyacrylamide gels. A molecular marker (prestained protein molecular weight marker; Fermentas) was loaded in all gels. For Western blotting experiments, proteins were transferred from gels to polyvinylidene difluoride membranes (Millipore). Immunoblotting was performed (46) with anti-HtrA1 and anti-HtrA2 polyclonal antibodies (45) at a 1:1,000 dilution or with the anti-Nuc (staphylococcal nuclease) monoclonal antibody 2F11 (Bionor, Skien, Norway) at a 1:5,000 dilution. Immunodetection was performed with a protein G-horseradish peroxidase conjugate (Bio-Rad) for polyclonal antibodies or with a goat anti-mouse immunoglobulin G-horseradish peroxidase conjugate (Bio-Rad) for the anti-Nuc monoclonal antibody, followed by revelation with the Western Lightning chemiluminescence reagent (Perkin-Elmer) according to the supplier's protocol. Protein profiles were compared after the gels were stained with Coomassie blue (Fulka). Protein bands whose intensities clearly differed between the WT and htrA mutant profiles were excised. Gel plugs were subjected to matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis conducted by A. Guillot and C. Henry (INRA).
CAMP test. Overnight staphylococcal WT and htrA mutant strain cultures were tested for ß-hemolysin activity as described previously (15). Briefly, strains were streaked on 5% sheep blood-BHI-agar plates perpendicular to, but not touching, a streak of the CAMP factor-producing S. agalactiae NEM 316 strain. The plates were incubated for 24 h at 37°C, and hemolytic activity was detected. A CAMP test was considered positive when hemolysis was enhanced at the junction between the staphylococcal and streptococcal growth areas, resulting from the synergic lysis of erythrocytes by the interaction of the diffused CAMP factor of S. agalactiae and the ß-hemolysin secreted by S. aureus.
RNA extraction and Northern blot analysis.
Total RNAs were extracted as described previously (13) from late-exponential-phase cultures (OD600 of
1.5) of staphylococcal strains. RNA electrophoresis and Northern blot experiments were performed as described previously (46). Briefly, 100-µg samples of total RNA from each strain were denatured and separated in 1% agarose gels. An RNA ladder (High Range; Fermentas) was used for size determination. After migration, the samples were transferred to a nylon membrane (Positive Tm; Qbiogen). Hybridization (42°C) with a probe and ECL detection were performed by use of a direct labeling and detection system (Amersham). For the probe, we used an internal fragment of the RNA III coding region, which was amplified by PCR from S. aureus strain RN6390 with the forward primer RNA III-1 (5' CAGAGATGTGATGGAAAATAGTTG3') and the reverse primer RNA III-2 (5' ATTAAGGGAATGTTTTACAGTTATT 3').
Experimental endocarditis. Catheter-induced aortic vegetation in the aortic valve was produced in rats as previously described (19, 36, 44). Groups of animals were inoculated 24 h after catheterization by intravenous injection of 0.5 ml of saline containing either of two bacterial inocula (103 or 104 CFU/ml) of the RN6390 or COL WT strain from exponential-growth-phase (OD600 = 0.6) cultures. These titration experiments were used to determine the minimal inoculum of these organisms required to cause endocarditis in >50% of animals. The infectivities of the htrA mutants were then compared with those of the WT strains by injecting the same number of CFU into animals. The animals were sacrificed 16 h after bacterial challenge, and bacterial enumerations of vegetation, spleen, and blood cultures were performed. Statistical differences in the rates of tissue infection were evaluated by the Fisher exact test. Differences between median bacterial densities in infected tissues were analyzed by the Mann-Whitney test. Data were considered significant when P values were <0.05 by use of two-tailed significance tests.
| RESULTS |
|---|
|
|
|---|
The use of two strains to examine the roles of htrA genes was motivated by the reported differences between virulent strains. RN6390 is a methicillin-sensitive strain derived from strain NCTC 8325. It carries a deletion in rsbU, which encodes a positive regulator that is crucial for activation of the stress response factor
B (29). In contrast, COL is resistant to methicillin, with a functional
B pathway (55). These two strains differ in extracellular protein expression, especially in the expression of virulence factors (55), among which are major secreted proteases (26). Extracellular protease expression is negatively regulated by
B-dependent expression of the sarA repressor gene (26). Therefore, extracellular protease expression in COL is low, presumably via
B up-regulation of the SarA repressor. In contrast, the rbsU-deficient RN6390 strain is deregulated for protease expression (26). We reasoned that in the COL background, the chance was lower that HtrA deficiencies would be complemented by other extracellular proteases.
Growth of RN6390 and COL is not affected by htrA gene disruption under nonstress conditions. We compared the growth of the WT, htrA1, htrA2, and htrA1 htrA2 strains of RN6390 and COL in aerated BHI medium at 37°C (data not shown). The htrA single and double mutants showed growth characteristics that were essentially identical to those of their respective WT parents. This result shows that under these conditions, htrA genes are not needed for growth, and further indicates that the htrA phenotypes described below did not result from slow growth.
Effects of htrA1 and htrA2 inactivation on growth under stress conditions differ between the RN6390 and COL strains.
The ability of the staphylococcal htrA mutants to survive under temperature, puromycin, antibiotic, or peroxide stress conditions was examined. Strain-specific differences were observed under temperature and puromycin stress conditions. In the RN6390 context, htrA1, htrA2, and htrA1 htrA2 mutant strains grew as well as the WT at both 44°C (Fig. 1) and 45°C (data not shown). Thus, neither HtrA1 nor HtrA2 is indispensable for high-temperature resistance in the RN6390 background. However, in the presence of puromycin (which generates truncated proteins during biosynthesis [18]), the viability of the htrA1 mutant was
10-fold lower than that of the WT, whereas the htrA2 mutant grew as well as the WT strain (Fig. 1). The double mutant showed a slightly higher puromycin sensitivity than the single htrA1 mutant. These results indicate that HtrA1 is involved in the removal of truncated exported proteins and that HtrA2 may compensate slightly for the lack of HtrA1 function.
|
104- or 103-fold lower viability at 44°C, respectively, indicating that both HtrA1 and HtrA2 are crucial for growth at high temperatures. A >104-fold lower viability was observed for the htrA1 htrA2 double mutant. The growth of htrA mutants in the COL background was unaffected by the addition of puromycin (at 8 µg/ml [Fig. 1] or at higher concentrations [data not shown]). Interestingly, under stress conditions to which they were sensitive, the mutants showed confluent spots but did not give single colonies upon dilution. This may suggest that a high cell density confers a protective effect that is lost upon dilution. HtrA is needed for bacterial survival under oxidative stress conditions for many bacteria (8, 24). We compared the viabilities of WT RN6390 and COL and their htrA mutants in the presence of different H2O2 concentrations. In these genetic backgrounds, htrA single or double mutations had no effects on survival (data not shown), indicating that neither HtrA1 nor HtrA2 is required for the H2O2 stress response.
A recent transcriptome study showed that the expression of htrA1 mRNA was induced when S. aureus was treated with cell-wall-active antibiotics, such as oxacillin, bacitracin, and D-cycloserine (52). We tested the growth of strain RN6390 and its htrA mutants in the presence of the three antibiotics and the growth of COL and its htrA mutants in the presence of bacitracin and D-cycloserine (COL is naturally resistant to oxacillin) at different concentrations. No difference in growth that was attributable to htrA was observed for either strain background (data not shown), indicating that neither gene is essential for survival against cell wall antibiotic treatments.
The results described above indicate that HtrA1 (for both strains) and HtrA2 (in the case of COL) are implicated in the stress response but that their roles differ according to the strain background.
Expression of several secreted virulence factors is diminished in the RN6390 htrA1 htrA2 mutant strain.
HtrA1 and/or HtrA2 involvement in the expression of exported virulence factors was examined. Protein extracts were prepared from cells (to analyze possible surface protein differences) and culture supernatants of mid-exponential-phase or overnight cultures of WT RN6390 and COL and their htrA1, htrA2, and htrA1 htrA2 mutant strains. Protein profiles of mid-exponential-phase growing cultures analyzed by SDS-PAGE were essentially the same for each WT strain and its mutant derivatives (data not shown). This was also the case for cell fraction profiles from overnight cultures (data not shown), although the resolution by SDS-PAGE is likely to mask differences. In contrast, an analysis of stationary-phase supernatant proteins did reveal differences in both the RN6390 (Fig. 2A) and COL (Fig. 2B) backgrounds. As previously described (55), the exoprotein profiles of the RN6390 and COL strains are markedly different. In the COL extracts (Fig. 2B), we observed reproducible variations in the intensities of five bands in the htrA1 and htrA1 htrA2 mutant strains compared to the WT. The htrA2 mutant exoprotein profile was similar to that of the WT. A dramatic change was observed in the RN6390 context, in which numerous extracellular proteins essentially disappeared in the htrA1 htrA2 double mutant extract (Fig. 2A). The absence of these highly expressed proteins from the supernatant did not seem to be compensated by the appearance of bands in the cell fraction (although differences may have been masked by the cytoplasmic protein profile), which suggests that these proteins or their precursors do not accumulate intracellularly or in the membrane. The profiles of the htrA1 and htrA2 single mutants and the WT were indistinguishable, suggesting that for this phenotype, the absence of one HtrA protein is compensated for by the other. MALDI-TOF analysis was performed with several secreted proteins that were present in the WT strain but absent from the double mutant. At least three major virulence factors, which corresponded to
-, ß-, and
-hemolysins (Fig. 2A), were absent from stationary-phase supernatants of the RN6390 htrA1 htrA2 strain.
|
Beta-hemolytic activity is abolished in the RN6390 htrA1 htrA2 mutant strain. To confirm the lack of ß-hemolysin production in the RN6390 htrA1 htrA2 strain, as determined by MALDI-TOF analysis (Fig. 2A), we tested the RN6390 WT, htrA1, htrA2, and htrA1 htrA2 strains for beta-hemolytic activity by using the CAMP test. The CAMP test is based on a synergistic effect between the streptococcal diffused CAMP factor and the ß-hemolysin secreted by staphylococcal strains, resulting in a total lysis of sheep erythrocytes (15, 48). The staphylococcal WT, htrA1, and htrA2 strains showed comparable beta-hemolytic activities on BHI plates containing sheep blood. An enhanced hemolytic zone was observed in the growth areas adjacent to the S. agalactiae NEM 316 CAMP-producing strain (Fig. 3). In contrast, the RN6390 htrA1 htrA2 strain displayed neither a hemolytic halo nor a lytic clearing zone near the S. agalactiae growth area. These observations show that the RN6390 htrA1 htrA2 mutant did not produce active ß-hemolysin.
|
|
The results described above led us to suggest that neither HtrA1 nor HtrA2 is directly involved in Nuc processing in either staphylococcal strain. In strain RN6390, the HtrA1 and HtrA2 proteins may contribute indirectly to Nuc processing, i.e., by modulating the expression of secreted proteases.
Disappearance of agr RNA III transcript in RN6390 htrA1 htrA2 strain. The results described above (Fig. 2, 3, and 4) suggest that in the RN6390 genetic background, the production of several major agr-regulated secreted virulence factors (e.g., hemolysins and proteases) (40) is abolished by inactivation of both the htrA1 and htrA2 genes. We asked whether this loss of secreted virulence factors was due to a reduction in the amount of the agr RNA III transcript. To test this, we performed Northern blotting experiments, using an RNA III-specific fragment as a probe, with total RNAs extracted from the RN6390 WT, htrA1, htrA2, and htrA1 htrA2 strains and from an RN6390 agr mutant (RN6911 [39]) which was used as a negative control (Fig. 5). In contrast to the case for the WT and the htrA1 and htrA2 single mutants, no transcript corresponding to the agr RNA III molecule was detected in the RN6390 htrA1 htrA2 extract.
|
Experimental endocarditis. The possible effects of HtrA1 and/or HtrA2 in staphylococcal virulence were examined in the RN6390 (Fig. 6) and COL (data not shown) contexts by use of a rat model of endocarditis. The lowest inoculum producing endocarditis in >50% of animals was determined to be 104 CFU for the RN6390 and COL WT strains. With this inoculum, the numbers of infected aortic and blood tissues in rats challenged with WT RN6390 or either htrA single mutant were larger than those for rats that were challenged with the htrA1 htrA2 mutant, although the differences were not statistically significant (Fig. 6). All spleen cultures were positive. However, differences in bacterial numbers in areas of vegetation and in spleens were significant when we compared rats inoculated with the RN6390 htrA1 htrA2 mutant to those infected with the WT or either single mutant (P < 0.05). The finding that rats challenged with the RN6390 htrA1 htrA2 mutant had lower rates of aortic and blood infection combined with significantly lower bacterial densities in infected tissues suggests that at least one of either HtrA1 or HtrA2 is essential for the infection and survival of S. aureus RN6390 in this model. In contrast, no significant differences were observed between WT COL and its htrA1, htrA2, and htrA1 htrA2 mutants, either in infectivity or in bacterial numbers in infected tissues (data not shown), indicating that htrA genes are not involved in S. aureus COL virulence in this animal model.
|
| DISCUSSION |
|---|
|
|
|---|
In contrast to RN6390, the virulent COL strain has an active
B pathway (29, 55), which is involved in heat shock, oxidative, and acid stress responses (6). However, no
B consensus sequences were identified upstream of the htrA1 and htrA2 gene sequences. Moreover, the amounts of HtrA1 and HtrA2 were similar in the two strains, as observed by Western blot experiments with anti-HtrA1 and anti-HtrA2 antibodies (data not shown). These observations suggest that
B does not control htrA1 and htrA2. Differences in htrA roles in COL and RN6390 may reflect differences in the stress protein requirements of the two strains.
During stationary phase, the expression of secreted proteins is affected by htrA mutations in both S. aureus strains, but in different manners. For COL, slight differences in secreted protein profiles were observed between the htrA1 and htrA1 htrA2 mutants and the WT, indicating a possible role of HtrA1 in exoprotein expression. For RN6390, the amounts of several secreted proteins were severely reduced in the htrA1 htrA2 double mutant, but not in either htrA single mutant, suggesting that the absence of one HtrA homologue can be compensated for by the other. We initially considered that the differences in exoprotein expression profiles for both strains could have resulted from a direct role of HtrA1 or HtrA2 in the processing of secreted proteins, as observed in L. lactis (43). If this were the case, we would expect an accumulation of precursor proteins in the cell fraction, which was not detected. Furthermore, Nuc processing in the COL background was not altered by htrA mutations, as the same small proportion of NucA was observed in all strains. These results suggest that the HtrA1 and HtrA2 targets are possibly not the secreted proteins that are affected in htrA mutant strains.
The secreted proteins that were missing from the RN6390 htrA1 htrA2 mutant corresponded to virulence factors such as toxins (
-, ß-, and
-hemolysins) or secreted proteases. These virulence factors are positively regulated by the quorum-sensing agr system, which is a global regulator of virulence factors in S. aureus (40). No
-hemolytic activity (tested on horse blood-BHI-agar plates [data not shown]) was detected for the RN6390 htrA1 htrA2 mutant;
-hemolysin is a direct product of agr RNA III, which regulates the agr-dependent expression of genes encoding virulence factors (41). Moreover, we showed that the agr RNA III transcript was not present in the RN6390 htrA1 htrA2 strain. We propose that HtrA1 and HtrA2 are involved in controlling the expression of these secreted virulence factors by acting upstream in the agr system regulatory pathway. Interestingly, the cytoplasmic Clp proteins, which form a stress proteolytic complex, have also been implicated in the control of S. aureus virulence via the agr system (14). In the case of HtrA, our results point to a role for HtrA1 and HtrA2 in the folding or processing of some surface components of the agr system. A recent study with Streptococcus pneumoniae implicated HtrA in natural competence through its role in the folding of crucial component proteins of the competence pathway (23). The competence of S. pneumoniae is controlled by a quorum-sensing system that operates in a manner analogous to that of the S. aureus agr system (34). The similarities between these observations will be valuable for validating our hypothesis.
We showed that HtrA1 and HtrA2 are involved in the virulence of S. aureus RN6390 in a rat model of endocarditis, whereas no differences were observed between the WT and htrA mutant strains in the COL context. This can be explained if HtrA1 and HtrA2 are involved in the agr regulatory pathway of secreted virulence factor production, as proposed above. Since no or only slight differences were observed in both cellular (data not shown) and exoprotein profiles between WT COL and its htrA mutants, it is not surprising that virulence was unaffected. Like the RN6390 htrA double mutant, an RN6390 agr mutant was affected in hemolysin activities and attenuated for virulence in a rabbit model of endocarditis (7). We speculate that the virulence of strains such as COL, in which the main factors regulated by agr are produced less, may be less affected by the htrA mutations than strains in which agr plays a major role.
The contribution of the HtrA1 and HtrA2 proteins to the virulence of S. aureus RN6390 seems to result mainly from their involvement in host tissue invasion rather than from a role in the ability of the strain to infect (Fig. 6). In the rat model of endocarditis, the capacity of S. aureus to infect is mainly due to its ability to adhere to damaged cardiac tissues (36, 44). It would follow that the HtrA1 and HtrA2 proteins are not involved in the expression of surface determinants that promote endocarditis. Among them, adhesins such as fibrinogen- or fibronectin-binding proteins are needed for bacterial adherence to damaged cardiac valves (36, 44). We observed no significant differences between WT RN6390 and its htrA mutant strains in adherence in vitro to human fibrinogen- or fibronectin-binding proteins (unpublished data), which is consistent with the above hypothesis.
| ACKNOWLEDGMENTS |
|---|
C.R. was a recipient of a doctoral training grant from the region of Ile de France and from INRA.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
| 1. | Alba, B. M., H. J. Zhong, J. C. Pelayo, and C. A. Gross. 2001. degS (hhoB) is an essential Escherichia coli gene whose indispensable function is to provide E activity. Mol. Microbiol. 40:4323-4333. |
| 2. | Arvidson, S. 2000. Extracellular enzymes, p. 379-385. In V. A. Fischetti et al. (ed.), Gram-positive pathogens. ASM Press, Washington, D.C. |
| 3. | Bohach, G. A., and T. J. Foster. 2000. Staphylococcus aureus exotoxins, p. 367-378. In V. A. Fischetti et al. (ed.), Gram-positive pathogens. ASM Press, Washington, D.C. |
| 4. | Boucher, J. C., J. Martinez-Salazar, M. J. Schurr, M. Mudd, H. Yu, and V. Deretic. 1996. Two distinct loci affecting conversion to mucoidy in Pseudomonas aeruginosa in cystic fibrosis encode homologs of the serine protease HtrA. J. Bacteriol. 178:511-523. |
| 5. | Bronner, S., H. Monteil, and G. Prevost. 2004. Regulation of virulence determinants in Staphylococcus aureus: complexity and applications. FEMS Microbiol. Rev. 28:183-200.[CrossRef][Medline] |
| 6. | Chan, P. F., S. J. Foster, E. Ingham, and M. O. Clements. 1998. The Staphylococcus aureus alternative sigma factor sigmaB controls the environmental stress response but not starvation survival or pathogenicity in a mouse abscess model. J. Bacteriol. 180:6082-6089. |
| 7. | Cheung, A. L., K. J. Eberhardt, E. Chung, M. R. Yeaman, P. M. Sullam, M. Ramos, and A. S. Bayer. 1994. Diminished virulence of a sar/agr mutant of Staphylococcus aureus in the rabbit model of endocarditis. J. Clin. Investig. 94:1815-1822. |
| 8. | Cortes, G., B. de Astorza, V. J. Benedi, and S. Alberti. 2002. Role of htrA gene in Klebsiella pneumoniae virulence. Infect. Immun. 70:4772-4776. |
| 9. | Davis, A., I. B. Moore, D. S. Parker, and H. Taniuchi. 1977. Nuclease B. A possible precursor of nuclease A, an extracellular nuclease of Staphylococcus aureus. J. Biol. Chem. 252:6544-6553. |
| 10. | Drapeau, G. R., Y. Boily, and J. Houmard. 1972. Purification and properties of an extracellular protease of Staphylococcus aureus. J. Biol. Chem. 247:6720-6726. |
| 11. | Fitzgerald, J. R., S. D. Reid, E. Ruotsalainen, T. J. Tripp, M. Liu, R. Cole, P. Kuusela, P. M. Schlievert, A. Jarvinen, and J. M. Musser. 2003. Genome diversification in Staphylococcus aureus: molecular evolution of a highly variable chromosomal region encoding the staphylococcal exotoxin-like family of proteins. Infect. Immun. 71:2827-2838. |
| 12. | Fouace, J., and V. Ferre. 1973. Transduction in staphylococci: changes in lysotype observed in group 3 strains after the acquisition of a number of antibiotic resistance factors. Ann. Microbiol. 124:381-392. |
| 13. | Foucaud-Scheunemann, C., and I. Poquet. 2003. HtrA is a key factor in the response to specific stress conditions in Lactococcus lactis. FEMS Microbiol. Lett. 224:53-59.[CrossRef][Medline] |
| 14. | Frees, D., S. N. Qazi, P. J. Hill, and H. Ingmer. 2003. Alternative roles of ClpX and ClpP in Staphylococcus aureus stress tolerance and virulence. Mol. Microbiol. 48:1565-1578.[CrossRef][Medline] |
| 15. | Gase, K., J. J. Ferretti, C. Primeaux, and W. M. McShan. 1999. Identification, cloning, and expression of the CAMP factor gene (cfa) of group A streptococci. Infect. Immun. 67:4725-4731. |
| 16. | Gibson, T. J. 1984. Ph.D. thesis. University of Cambridge, Cambridge, England. |
| 17. | Glaser, P., C. Rusniok, C. Buchrieser, F. Chevalier, L. Frangeul, T. Msadek, M. Zouine, E. Couve, L. Lalioui, C. Poyart, P. Trieu-Cuot, and F. Kunst. 2002. Genome sequence of Streptococcus agalactiae, a pathogen causing invasive neonatal disease. Mol. Microbiol. 45:1499-1513.[CrossRef][Medline] |
| 18. | Goldberg, A. L. 1972. Correlation between rates of degradation of bacterial proteins in vivo and their sensitivity to proteases. Proc. Natl. Acad. Sci. USA 69:2640-2644. |
| 19. | Heraief, E., M. P. Glauser, and L. R. Freedman. 1982. Natural history of aortic valve endocarditis in rats. Infect. Immun. 37:127-131. |
| 20. | Hiramatsu, K. 2001. Vancomycin-resistant Staphylococcus aureus: a new model of antibiotic resistance. Lancet Infect. Dis. 1:147-155.[CrossRef][Medline] |
| 21. | Höök, M., and T. J. Foster. 2000. Staphylococcal surface proteins, p. 386-391. In V. A. Fischetti et al. (ed.), Gram-positive pathogens. ASM Press, Washington, D.C. |
| 22. | Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150:815-825. |
| 23. | Ibrahim, Y. M., A. R. Kerr, J. McCluskey, and T. J. Mitchell. 2004. Role of HtrA in the virulence and competence of Streptococcus pneumoniae. Infect. Immun. 72:3584-3591. |
| 24. | Johnson, K., I. Charles, G. Dougan, D. Pickard, P. O'Gaora, G. Costa, T. Ali, I. Miller, and C. Hormaeche. 1991. The role of a stress response protein in Salmonella typhimurium virulence. Mol. Microbiol. 2:401-407.[CrossRef] |
| 25. | Jones, C. H., T. C. Bolken, K. F. Jones, G. O. Zeller, and D. E. Hruby. 2001. Conserved DegP protease in gram-positive bacteria is essential for thermal and oxidative tolerance and full virulence in Streptococcus pyogenes. Infect. Immun. 69:5538-5545. |
| 26. | Karlsson, A., and S. Arvidson. 2002. Variation in extracellular protease production among clinical isolates of Staphylococcus aureus due to different levels of expression of the protease repressor sarA. Infect. Immun. 70:4239-4246. |
| 27. | Kraemer, G. R., and J. J. Iandolo. 1990. High frequency transformation of Staphylococcus aureus by electroporation. Curr. Microbiol. 21:373-376.[CrossRef] |
| 28. | Krojer, T., M. Garrido-Franco, R. Huber, M. Ehrmann, and T. Clausen. 2002. Crystal structure of DegP (HtrA) reveals a new protease-chaperon machine. Nature 416:455-459.[CrossRef][Medline] |
| 29. | Kullik, I., P. Giachino, and T. Fuchs. 1998. Deletion of the alternative sigma factor sigmaB in Staphylococcus aureus reveals its function as a global regulator of virulence genes. J. Bacteriol. 180:4814-4820. |
| 30. | Lee, J. C. 1996. The prospects for developing a vaccine against Staphylococcus aureus. Trends Microbiol. 4:162-166.[CrossRef][Medline] |
| 31. | Lipinska, B., M. Zylick, and C. Georgopoulos. 1990. The HtrA (DegP) protein, essential for Escherichia coli survival at high temperatures, is an endopeptidase. J. Bacteriol. 172:1791-1797. |
| 32. | Lithgow, J. K., E. Ingham, and S. J. Foster. 2004. Role of the hprT-ftsH locus in Staphylococcus aureus. Microbiology 150:373-381. |
| 33. | Lyon, W. R., and M. G. Caparon. 2004. Role for serine protease HtrA (DegP) of Streptococcus pyogenes in the biogenesis of virulence factors SpeB and the hemolysin streptolysin S. Infect. Immun. 72:1618-1625. |
| 34. | Martin, B., M. Prudhomme, G. Alloing, C. Granadel, and J. P. Claverys. 2000. Cross-regulation of competence pheromone production and export in the early control of transformation in Streptococcus pneumoniae. Mol. Microbiol. 38:867-878.[CrossRef][Medline] |
| 35. | Miyoshi, A., I. Poquet, V. Azevedo, J. Commissaire, L. Bermudez-Humaran, E. Domakova, Y. Le Loir, S. C. Oliveira, A. Gruss, and P. Langella. 2002. Controlled production of stable heterologous proteins in Lactococcus lactis. Appl. Environ. Microbiol. 68:3141-3146. |
| 36. | Moreillon, P., J. M. Entenza, P. Francioli, D. McDevitt, T. J. Foster, P. Francois, and P. Vaudaux. 1995. Role of Staphylococcus aureus coagulase and clumping factor in pathogenesis of experimental endocarditis. Infect. Immun. 63:4738-4743.[Abstract] |
| 37. | Noone, D., A. Howell, R. Collery, and K. M. Devine. 2001. YkdA and YvtA, HtrA-like serine protease in Bacillus subtilis, engaged in negative autoregulation and reciprocal cross-regulation of ykdA and yvtA gene expression. J. Bacteriol. 183:654-663. |
| 38. | Novick, R. P. 1990. Molecular biology of the staphylococci, p. 1-40. VCH Publishers, New York, N.Y. |
| 39. | Novick, R. P., H. F. Ross, S. J. Projan, J. Kornblum, B. Kreiswirth, and S. Moghazeh S. 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J. 12:3967-3975.[Medline] |
| 40. | Novick, R. P. 2000. Pathogenicity factors and their regulation, p. 392-407. In V. A. Fischetti et al. (ed.), Gram-positive pathogens. ASM Press, Washington, D.C. |
| 41. | Novick, R. P. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol. Microbiol. 48:1429-1449.[CrossRef][Medline] |
| 42. | Poquet, I., S. D. Ehrlich, and A. Gruss. 1998. An export-specific reporter designed for gram-positive bacteria: application to Lactococcus lactis. J. Bacteriol. 180:1904-1912. |
| 43. | Poquet, I., V. Saint, E. Seznec, N. Simoes, A. Bolotin, and A. Gruss. 2000. HtrA is the unique surface housekeeping protease in Lactococcus lactis and is required for natural protein processing. Mol. Microbiol. 35:1042-1051.[CrossRef][Medline] |
| 44. | Que, Y. A., P. Francois, J. A. Haefliger, J. M. Entenza, P. Vaudaux, and P. Moreillon. 2001. Reassessing the role of Staphylococcus aureus clumping factor and fibronectin-binding protein by expression in Lactococcus lactis. Infect. Immun. 69:6296-6302. |
| 45. | Rigoulay, C., I. Poquet, S. M. Madsen, and A. Gruss. 2004. Expression of the Staphylococcus aureus surface proteins HtrA1 and HtrA2 in Lactococcus lactis. FEMS Microbiol. Lett. 237:279-288.[Medline] |
| 46. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 47. | Skorko-Glonek, J., D. Zurawa, E. Kuczwara, M. Wozniak, Z. Wypych, and B. Lipinska. 1999. The Escherichia coli heat shock protease participates in defense against oxidative stress. Mol. Gen. Genet. 262:342-350.[CrossRef][Medline] |
| 48. | Spellerberg, B. 2000. Pathogenesis of neonatal Streptococcus agalactiae infections. Microbes Infect. 2:1733-1742.[CrossRef][Medline] |
| 49. | Spiess, C., A. Beil, and M. Ehrmann. 1999. A temperature dependent switch from chaperone to protease in a widely conserved heat shock protein. Cell 97:339-347.[CrossRef][Medline] |
| 50. | Steinmetz, M., and R. Richter. 1994. Easy cloning of mini-Tn10 insertions from the Bacillus subtilis chromosome. J. Bacteriol. 176:1761-1763. |
| 51. | Strauch, K. L., K. Johnson, and J. Beckwith. 1989. Characterization of degP, a gene required for proteolysis in the cell envelope and essential for growth of Escherichia coli at high temperature. J. Bacteriol. 171:2689-2696. |
| 52. | Utaida, S., P. M. Dunman, D. Macapagal, E. Murphy, S. J. Projan, V. K. Singh, R. K. Jayaswal, and B. J. Wilkinson. 2003. Genome-wide transcriptional profiling of the response of Staphylococcus aureus to cell-wall-active antibiotics reveals a cell-wall-stress stimulon. Microbiology 149:2719-2732. |
| 53. | Waller, P. R. H., and R. T. Sauer. 1996. Characterization of degQ and degS, Escherichia coli genes encoding homologs of the DegP protease. J. Bacteriol. 178:1146-1153. |
| 54. | Wu, S., H. de Lencastre, and A. Tomasz. 1996. Sigma-B, a putative operon encoding alternate sigma factor of Staphylococcus aureus RNA polymerase: molecular cloning and DNA sequencing. J. Bacteriol. 178:6036-6042. |
| 55. | Ziebandt, A. K., H. Weber, J. Rudolph, R. Schmid, D. Hoper, S. Engelmann, and M. Hecker. 2001. Extracellular proteins of Staphylococcus aureus and the role of SarA and sigma B. Proteomics 1:480-493.[CrossRef][Medline] |
This article has been cited by other articles:
| |||||||||||||||||||||||||||