This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S.-B.
Right arrow Articles by Schorey, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.-B.
Right arrow Articles by Schorey, J. S.

 Previous Article  |  Next Article 

Infection and Immunity, October 2005, p. 6499-6507, Vol. 73, No. 10
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.10.6499-6507.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Activation and Mitogen-Activated Protein Kinase Regulation of Transcription Factors Ets and NF-{kappa}B in Mycobacterium-Infected Macrophages and Role of These Factors in Tumor Necrosis Factor Alpha and Nitric Oxide Synthase 2 Promoter Function

Seong-Beom Lee{dagger} and Jeffrey S. Schorey*

Department of Biological Sciences, Center for Tropical Disease Research and Training, University of Notre Dame, Notre Dame, Indiana 46556

Received 8 April 2005/ Returned for modification 23 May 2005/ Accepted 17 June 2005


arrow
ABSTRACT
 
Previous studies have shown that primary murine macrophages infected with Mycobacterium avium produced lower levels of tumor necrosis factor alpha (TNF-{alpha}) and inducible nitric oxide synthase 2 (NOS2) compared to cells infected with nonpathogenic Mycobacterium smegmatis. TNF-{alpha} and NOS2 levels correlated with and were dependent on the activation of mitogen-activated protein kinases (MAPKs) p38 and extracellular signal-regulated kinase 1/2 (ERK1/2). To define the macrophage transcriptional responses dependent on ERK1/2 activation following a mycobacterial infection, we used RAW 264.7 cells transfected with a TNF-{alpha} or NOS2 promoter vector. We determined that macrophages infected with M. avium compared to M. smegmatis showed diminished TNF-{alpha} and NOS2 promoter activity. A more pronounced difference in promoter activity was observed when only the consensus ETS and NF-{kappa}B binding sites were used as promoters. Mutational analysis of the ETS and NF-{kappa}B binding sites present on the TNF-{alpha} and NOS2 promoters, respectively, showed that these sites were essential for a functional promoter. Moreover, the Ets/Elk but not the NF-{kappa}B transcriptional response was dependent on ERK1/2. This correlated with the requirement for ERK1/2 in TNF-{alpha} but not NOS2 promoter activity. Our data indicate that the increased Ets/Elk and NF-{kappa}B promoter activities associated with M. smegmatis-infected macrophages are responsible, at least in part, for the increased TNF-{alpha} and NOS2 production observed in these infected cells and that ERK1/2 is required for Ets/Elk activity and full TNF-{alpha} production.


arrow
INTRODUCTION
 
Mycobacterium avium is an important pathogen of immune-compromised individuals, such as those with AIDS and chronic lung disease (10). M. avium is a facultative intracellular pathogen that resides within the phagosome of an infected cell (10). However, following phagocytosis, M. avium, like M. tuberculosis and M. leprae, halts the maturation of the phagosome through a coordinated block in phagosome/lysosome fusion (9). Significant progress has been made in defining the mechanism by which mycobacteria block phagosome maturation (28). In addition, infection with M. avium produces lower levels of tumor necrosis factor alpha (TNF-{alpha}) and nitric oxide synthase 2 (NOS2) compared to infections with nonpathogenic mycobacteria (21). TNF-{alpha} (3) and nitric oxide (NO) (16) play important roles in host defense against intracellular pathogens.

In a number of experimental systems, macrophage production of TNF-{alpha} (14, 15, 21) and NOS2 (5, 11, 21) was shown to be regulated by NF-{kappa}B and the mitogen-activated protein kinases (MAPKs). Previous studies in our laboratory have shown that MAPK activation in murine primary bone-marrow-derived macrophages (BMM{Phi}) following a mycobacterial infection is inversely correlated with the pathogenicity of the bacillus in mice, suggesting that limited activation of MAPKs may be a virulence mechanism (21).

Transcriptional activation of TNF-{alpha} is highly controlled, and nuclear transcription factors recruited to the promoter in conjunction with the coactivator proteins CBP and p300 form a unique TNF-{alpha} enhanceosome following stimulation (2, 7, 26, 27). There are many transcription factors known to be involved in TNF-{alpha} production, including NFAT, ATF-2, Jun, Ets/Elk, SP-1, NF-{kappa}B, and the cyclic AMP response element binding protein (CREB) (2, 7, 26, 27). Among the transcription factors recruited to the TNF-{alpha} promoter, many are activated by MAPKs. Ets-1 phosphorylation has been shown to be mediated by ERK1/2 (22). The transcriptional activity of c-jun required JNK, while CREB and ATF-2 were dependent on JNK or p38 activation (20, 30). Thus, the coordinated activation of MAPKs is required for maximal TNF-{alpha} promoter activity. We therefore hypothesized that the varied TNF-{alpha} production observed in macrophages following pathogenic and nonpathogenic mycobacterial infections results from differential activation of the transcription factors.

In our recent studies, it was shown that the transcription factor CREB was significantly more activated in the M. smegmatis-infected compared to the M. avium-infected macrophages and that CREB activation was dependent on p38 (20). However, the macrophage transcription factors downstream of ERK1/2, which were differentially regulated by pathogenic and nonpathogenic mycobacteria, remained undefined. Of the various transcription factors regulated by ERK1/2 which also bind the TNF-{alpha} promoter, we focused on the ETS family of transcription factors which cooperate with other transcription factors or coactivator p300/CBP in forming an enhanceosome on the TNF-{alpha} promoter following a mycobacterial infection (2). Members of the ETS family are well-known transcription activators and are implicated in the regulation of gene expression in a wide range of biological processes, including growth control, ossification, and T-cell activation (29). Two major members of this group include Ets-1 and Elk-1

In addition to MAPKs, the NF-{kappa}B pathway is also an important regulator of TNF-{alpha} (14, 15) and NOS2 (5, 11) expression. The NF-{kappa}B transcription factor family is an evolutionarily conserved group and typically functions in response to infection or stress (1). In the present study, we focused on the role of NF-{kappa}B in NOS2 promoter activity following mycobacterial infections. The NOS2 promoter contains numerous binding sites for transcription factors which are organized into two clusters: region I (+10 to –300) contains NF-interleukin-6 (IL-6), a TNF response element, and NF-{kappa}B binding sites (17), and region II (–100 to –800) contains interferon regulatory factor-1 (IRF-1), STAT1a, and NF-{kappa}B binding sites (8, 12). Although many transcription factors are involved in the activation of the NOS2 promoter, NF-{kappa}B is believed to be essential for NOS2 production following various stimulations (11). NF-{kappa}B may also associate with other transcription factors to induce maximal activation of gene expression (19). Moreover, the 19-kDa lipoprotein from M. tuberculosis can trigger NF-{kappa}B activation through Toll-like receptor 2 (25). Therefore, we examined whether NF-{kappa}B is differentially activated by pathogenic and nonpathogenic mycobacteria.

In the present study we determined that the TNF-{alpha} and NOS2 promoters show diminished activity in macrophages infected with M. avium relative to M. smegmatis. We also observed that promoters containing only ETS binding sequences or NF-{kappa}B consensus sites showed minimal activity in macrophages infected with M. avium compared to cells infected with M. smegmatis. In addition, we found that Ets/Elk promoter activity was dependent on ERK1/2. Finally, a mutational analysis demonstrated the functional importance of the ETS binding sequences for TNF-{alpha} promoter activity and the NF-{kappa}B binding site for NOS2 promoter activity.


arrow
MATERIALS AND METHODS
 
Cell culture, transfection, and luciferase assay. The murine macrophage cell line RAW 264.7 was grown in Dulbecco's modified Eagle's medium (GIBCO BRL, Grand Island, N.Y.) supplemented with 20 mM HEPES (Fisher Scientific), 10% fetal bovine serum (GIBCO BRL), 100 U/ml penicillin, and 100 µg/ml streptomycin (Bio Whittaker). RAW 264.7 cells were plated onto 96-well plates at 3 x 105 cells/well for 24 h prior to transfection. Transient transfections were performed using FuGene6 (Boehringer-Mannheim) according to the manufacturer's protocol. Each well was cotransfected with the firefly luciferase reporter and the Renilla luciferase reporter (phRL-SV40) vectors. After a 6-h incubation with FuGene6 and DNA, the transfection medium was replaced with fresh culture medium. Twenty-four hours after the transfection, cells were infected with the mycobacterium and incubated at 37°C, 5% CO2, for various times. For some infection experiments, the cells were incubated for 4 h with the mycobacterium and washed with phosphate-buffered saline (PBS), fresh medium was added, and the cells were incubated for an additional period. Luciferase assays were performed according to the manufacturer's protocols (Dual luciferase reporter assay system; Promega). Firefly luciferase activities were corrected with Renilla luciferase activities and normalized to those of cells transfected with the basic firefly luciferase reporter vector.

Plasmid vector constructs. The reporter vector contained either specific promoters or multiple repeats of a specific transcription factor binding element. The firefly luciferase reporter vector constructs were created by standard PCR subcloning techniques. –1200 TNF-{alpha}-pGL3-luc containing the mouse TNF-{alpha} promoter (–1200 to +2), –1700 NOS2-pGL3-luc containing the mouse NOS2 promoter (–1589 to +160), and 390 NOS2-pGL3-luc containing the mouse NOS2 promoter (–230 to +160) were created by PCR and by subcloning the PCR fragment into the NheI and HindIII site, the KpnI and HindIII site, and the NheI and HindIII site of pGL3 basic luciferase vector (Promega), respectively. The primer sequences for PCR were as follows: for –1200 TNF-{alpha}-pGL3-luc, 5'-TAGCTAGCCCATCTGTGAAACCCAATAAACCTCT-3'(sense) and 5'-GCAAGCTTGGGAGCTTCTGCTGGCTGG-3'(antisense); for –1700 NOS2-pGL3-luc, 5'-TAGGTACCGACTTTGATATGCTGAAATCCATAAGC-3'(sense) and 5'-GCAAGCTTGACTAGGCTACTCCGTGGAGTGAA-3'(antisense); for 390 NOS2-pGL3-luc, 5'-TAGCTAGCCTGCCTAGGGGCCACTGCCTTG-3'(sense) and 5'-GCAAGCTTGACTAGGCTACTCCGTGGAGTGAA-3'(antisense). Primer sequences for the TNF and NOS2 promoters were derived from a Mus musculus Tnf 5'-regulatory region (GenBank accession no. AB062426) and from the mouse NOS2 promoter region (GenBank accession no. L09126), respectively.

The NF-{kappa}B reporter vector containing six copies of the NF-{kappa}B binding site (GGGAATTTC) in front of the TATA promoter and the luciferase gene was created by subcloning the KpnI-HindIII fragment of NF-{kappa}B-pTransLucent (purchased from Panomics, Redwood City, CA) into the KpnI and HindIII site of pGL3 basic luciferase vector (Promega). The Ets reporter vector was created by cloning five copies of the Ets-1 binding site (ACCGGAAGTT) into the NheI and BglII site of pTransLucent (Ets-pTransLucent; Panomics). The KpnI-HindIII fragment from Ets-pTransLucent was again subcloned into the KpnI and HindIII site of pGL3 basic luciferase vector (Promega). The Ets/Elk reporter vector contained five copies of the Ets-1 binding site in front of the TATA promoter and luciferase gene. The consensus sequences for Ets-1 and NF-{kappa}B were derived from previous reports (24, 31, 32).

The –117 Ets/Elk mutant (mt) (–117 to –114; CTTC to ACCG), the –84 Ets/Elk mt (–84 to –81; AAGG to TGCT), and the –76 Ets/Elk mt (–76 to –73; TTTC to CACT) were created using the Quick Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's protocol. The primer sequences used to generate the mutants were as follows: for the –117 Ets/Elk mt, 5'-GGTGTAGGGCCACTACCGACCGCTCCACATGAGATCATGG-3'and 5'-CCATGATCTCATGTGGAGCGGTCGGTAGTG GCCCTACACC-3'; for the –84 Ets/Elk mt, 5'-CATGAGATCATGGTTTTCTCCACCACCTGCTAAGTTTTCCGAGGGTTGAATGA-3'and 5' TCATTCAACCCTCGGAAAACTTAGCAGGTGGAGAAAACCATGATCTCATG-3'; for the –76 Ets/Elk mt, 5'-GGTTTTCTCCACCAAGGAAGTCACTCGAGGGTTGAATGAGAGCTTTTC-3'and 5'-GAAAAGCTCTCATTCAACCCTCGAGTGACTTCCTTGGTGGAGAAAACC-3'.

The NF-{kappa}B binding sites on the –1700 NOS2-pGL3-luc reporter (–971 NF-{kappa}B mt-pGL3-luc; –971 to –969; GGG to CTC) was also mutated using the Quick Change site-directed mutagenesis kit (Stratagene). The mutagenic primers were 5'-CTCGCAGGATGTGCTAGGCTCATTTTCCCTCTCTCTGTTTGT-3'and 5'-ACAAACAGAGAGAGGGAAAATGAGCCTAGCACATCCTGCCAG-3'(underlining indicates site of mutation). The mutation was confirmed by sequencing.

Bacteria culture. M. avium 724 and M. smegmatis strain MC2155 were cultured as described previously (21). Briefly, M. avium 724 was passaged through a mouse to ensure virulence, and a single colony containing both M. avium 724 and M. smegmatis was used to inoculate Middlebrook 7H9 medium (Difco, Sparks, MD) supplemented with 100 mM glucose (Sigma), 0.06% oleic acid (Fisher Scientific, Fair Lawn, NJ), 5% (wt/vol) albumin (Sigma), 0.5% Tween-20 (Fisher Scientific), and 150 mM NaCl (GOATS). Bacteria were grown for 4 to 10 days at 37°C with vigorous shaking, resuspended in Middlebrook-GOATS with 15% glycerol, aliquoted, and stored at –80°C. Frozen stocks were quantitated by serial dilution on Middlebrook 7H10 agar-GOATS. All reagents used to grow mycobacteria were found negative for endotoxin contamination using the E-Toxate assay (Sigma) and the QCL-1000 Endotoxin test (Cambrex Bio Science, Walkersville, MD).

Mycobacterial infection. Infection assays were performed as described previously (21). The assay was performed on each stock of mycobacteria to determine the infection ratio needed to obtain approximately 80% of the macrophages infected. Briefly, RAW 264.7 cells were plated on glass coverslips and infected with different doses of mycobacteria in triplicate. For complement opsonization, appropriate concentrations of mycobacteria were suspended in macrophage culture media containing 10% horse serum (GIBCO BRL) as a source of complement components and incubated for 2 h at 37°C before infection (4). The same concentration of horse serum was added to uninfected controls for all experiments. Mycobacterially infected macrophages were fixed after 4 h with 1:1 methanol:acetone, washed with PBS, and stained with TB Auramine M stain kit (BD Bioscience, Sparks, MD) or with acridine orange (Sigma-Aldrich) for M. avium and M. smegmatis, respectively. Slides were visualized by fluorescent microscopy, and the level of infection was quantitated by counting the number of cells infected in at least four fields per replicate. No fewer than 100 cells per replicate were counted.

Inhibitor treatments. The inhibitors were purchased from Calbiochem (La Jolla, CA) and reconstituted in sterile, endotoxin-tested dimethyl sulfoxide (DMSO) or H2O. PD98059, a MEK1 inhibitor (20 µM), was added 1 h before infection. DMSO was used at the same concentrations as the vehicle control. A dose response was observed in relation to ERK1/2 phosphorylation and PD98059 concentration (data not shown). The concentration chosen was based on this dose response and on previous studies published with PD98059-treated macrophages (20, 21).

ELISA. The levels of TNF-{alpha} secreted into the culture medium by infected macrophages were measured using the PharMingen OptEia Mouse TNF-{alpha} enzyme-linked immunosorbent assay (ELISA) kit (PharMingen, San Diego, CA). Culture media collected from the macrophages were analyzed for cytokines according to the manufacturer's instructions, and the cytokine concentrations were determined against a TNF-{alpha} standard curve.

Western blot analysis. At designated times, the treated RAW 264.7 cells were removed from the incubator, placed on ice, and washed three times with ice-cold PBS containing 1 mM pervanadate. The cells were then treated for 5 to 10 min with ice-cold lysis buffer (150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin, 1 mM pervanadate, 1 mM EDTA, 1% Igepal, 0.25% deoxycholic acid, 1 mM NaF, and 50 mM Tris-HCl, pH 7.4). The cell lysates were removed from the plates and stored at –20°C. Equal amounts of protein, as defined using the Micro BCA Protein Assay (Pierce, Rockford, IL), were loaded onto sodium dodecyl sulfate-10%polyacrylamide gel electrophoresis gels, electrophoresed, and transferred onto a polyvinylidene difluoride membrane (Millipore, Bedford, MA). The membranes were blocked with Tris-buffered saline with 0.05% Tween 20 (TBST) supplemented with 5% powdered milk. The membranes were incubated with primary antibodies against NOS2, phospho-p65 NF-{kappa}B, total p38, phospho-ERK1/2, or total ERK1/2 (Cell Signaling, Beverly, MA). The blots were washed with TBST and incubated with horseradish peroxidase-conjugated anti-rabbit or anti-mouse immunoglobulin (Pierce) secondary antibody in TBST plus 5% powdered milk. The bound antibodies were detected using SuperSignal West Femto enhanced chemiluminescence reagent (Pierce).

Statistical analysis. Statistical significance was determined with the paired two-tailed Student's t test and one-way analysis of variance at the P < 0.05 level of significance using InStat/Prism software.


arrow
RESULTS
 
TNF-{alpha} and NOS2 promoter activities in RAW 264.7 cells following M. avium and M. smegmatis infection. Our previous studies indicated that BMM{Phi} infected with M. avium shows decreased production of TNF-{alpha} and NOS2 compared to cells infected with nonpathogenic mycobacteria (21). To determine if a similar difference is observed with RAW 264.7 cells, we infected these cells with M. avium and M. smegmatis. As shown in Fig. 1A and C, RAW 264.7 cells infected with M. avium showed decreased production of TNF-{alpha} compared to M. smegmatis-infected cells at all time points tested. RAW 264.7 cells infected with pathogenic M. avium also showed decreased levels of NOS2 at 9 and 24 h postinfection. We next examined whether the activation of TNF-{alpha} and NOS2 by M. avium and M. smegmatis were differentially regulated at the transcription level. For this experiment, we transiently transfected RAW 264.7 cells with –1200 TNF-{alpha}-pGL3-luc containing the murine TNF-{alpha} promoter (–1200 to +2) or –1700 NOS2-pGL3-luc containing the murine NOS2 promoter (–1589 to +160) (Fig. 2). The transfected cells were subsequently infected with mycobacteria. As shown in Fig. 1B and D, RAW 264.7 cells infected with M. avium 724 showed decreased TNF-{alpha} and NOS2 promoter activity compared to cells infected with M. smegmatis at 24 h postinfection. These results demonstrate that TNF-{alpha} and NOS2 production by mycobacterium-infected macrophages is regulated, at least in part, at the transcription level.



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 1. RAW 264.7 cells infected with M. avium 724 show decreased production of TNF-{alpha} and NOS2 and a corresponding decrease in promoter activities compared to macrophages infected with M. smegmatis. (A) RAW 264.7 cells were infected with mycobacteria as described in Materials and Methods. Supernatants were collected from cells infected for 1, 4, 9, or 24 h and used for TNF-{alpha} ELISA. (B and D) RAW 264.7 cells, transfected with either Basic-pGL3-luc, –1200 TNF-{alpha}-pGL3-luc, or –1700 NOS2-pGL3-luc, in combination with phRL-SV40, were infected with mycobacteria. Twenty-four hours postinfection, cell extracts were assayed for luciferase activity. Results represent firefly luciferase activities relative to Renilla luciferase activities and were normalized to those of cells transfected with Basic-pGL3-luc. (C) NOS2 expression from cell lysates was detected by Western blotting. Results are representative of three separate experiments. a, P < 0.01 compared to RC; b, P < 0.05 compared to RC; c, P < 0.05 compared to M. avium 724; d, P < 0.01 compared to M. avium 724. Smeg, M. smegmatis; luc., luciferase; RC, noninfected BMM{phi}.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 2. Topography of murine TNF-{alpha} (A) and NOS2 (B) promoter regions. The promoter sequences used in this study were derived from a Mus musculus Tnf 5'-regulatory region (GenBank accession no. AB062426) and from the NOS2 promoter region sequence (GenBank accession no. L09126). (A) The transcription factors NF-{kappa}B, Ets/Elk, SP1, and CREB/ATF-2/c-jun are recruited to the TNF-{alpha} promoter following M. tuberculosis infection (2, 14). Egr, early growth response. (B) The NOS2 promoter contains numerous binding sites for nuclear transcription factors in two clusters: region I (+10 to –300) contains NF-IL-6, a TNF response element, NF-{kappa}B, and octamer binding sites, and region II (–100 to –800) contains interferon regulatory factor-1 (IRF-1), STAT1a, and NF-{kappa}B binding sites (8, 11, 12, 17). The numbers indicate the distance from the TNF-{alpha} or NOS2 transcription start site.

It should be noted that although we did not observe any measurable TNF-{alpha} or NOS2 protein in noninfected macrophages, we did obtain measurable luciferase activity in these cells which could be attributed to the TNF-{alpha} or NOS2 promoter. This suggests some differences in chromosomal versus plasmid TNF-{alpha} and NOS2 promoters, perhaps in their accessibility to the transcription factors.

RAW 264.7 cells infected with M. avium show only limited Ets and NF-{kappa}B promoter activity. Shown in Fig. 2 are the TNF-{alpha} and NOS2 promoters with the various transcription factor binding sites. To investigate the differential activation of the transcription factors involved in TNF-{alpha} and NOS2 production, we made the Ets/Elk and NF-{kappa}B reporter vectors as described in Materials and Methods. We infected the RAW 264.7 cells transfected with either the Ets/Elk or NF-{kappa}B reporter vector with M. smegmatis or M. avium. The Ets/Elk and NF-{kappa}B promoter activities were evaluated over a 24-h period. As shown in Fig. 3B, Ets/Elk-driven luciferase activity was elevated in M. smegmatis- and M. avium-infected RAW 264.7 cells relative to noninfected cells (i.e., resting cells [RC]) at 4 and 9 h postinfection. However, M. smegmatis-infected RAW 264.7 cells showed significantly higher luciferase activity compared to the M. avium 724-infected cells at these time points. Ets/Elk promoter activity returned to RC levels by 24 h postinfection.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. RAW 264.7 cells infected with M. smegmatis show higher Ets/Elk and NF-{kappa}B promoter activities relative to cells infected with M. avium 724. (A) The Ets/Elk and NF-{kappa}B reporter vectors contain five copies of the Ets-1 binding site, ACCGGAAGTT, and six copies of the NF-{kappa}B binding site, GGGAATTTC, respectively, in front of the TATA promoter and luciferase gene (luc+). (B) RAW 264.7 cells, transfected with Ets-pGL3-luc or NF-{kappa}B-pGL3-luc in combination with phRL-SV40, were infected with mycobacteria as described in Materials and Methods. At indicated times, cell extracts were assayed for luciferase activity. Results represent firefly luciferase activities relative to Renilla luciferase activities and were normalized to those of cells transfected with Basic-pGL3-luc. a, P < 0.05 compared to RC; b, P < 0.01 compared to RC; c, P < 0.01 compared to M. avium 724; d, P < 0.05 compared to M. avium 724. luc., luciferase; Smeg, M. smegmatis; RC, noninfected BMM{phi}.

A similar response was seen with the NF-{kappa}B promoter. M. smegmatis-infected RAW 264.7 cells showed significantly higher luciferase activity compared to the M. avium 724-infected cells at 4 and 9 h postinfection (Fig. 3C). NF-{kappa}B promoter activity in both M. smegmatis- and M. avium-infected RAW 264.7 cells was higher than that of RCs throughout the 24-h infection period. Taken together, these results indicate that Ets/Elk and NF-{kappa}B are differentially activated in M. avium- and M. smegmatis-infected RAW 264.7 cells.

The –117 and –84 ETS binding sites are required for TNF-{alpha} gene expression following mycobacterial infection. There are four binding sites for Ets/Elk on the TNF-{alpha} promoter (Fig. 2A). To confirm the importance of the ETS binding site for TNF-{alpha} promoter activity, we made mutant constructs of the –1200 TNF-{alpha}-pGL3-luc reporter by site-directed mutagenesis as described in Materials and Methods. The –117, –84, and –76 Ets/Elk mutants (Fig. 4A) were confirmed by sequencing. These mutations were previously found not to bind to the Ets-1 transcription factor (2). As shown in Fig. 4B, mutations of the –117 and –84 ETS binding sites reduced the promoter activity of TNF-{alpha} in the RAW 264.7 cells infected with either M. avium or M. smegmatis to RC levels or lower. In contrast, the mutation at the –76 ETS binding site led to an increase in TNF-{alpha} promoter activity. These results indicate that the ETS binding sites were important for TNF-{alpha} promoter activity.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. The –117 and –84 ETS binding sites on the TNF-{alpha} promoter are required for TNF-{alpha} promoter activity in mycobacterium-infected RAW 264.7 cells. (A) The –117 Ets/Elk mt (–117 to –114; CTTC to ACCG), the –84 Ets/Elk mt (–84 to –81; AAGG to TGCT), and the –76 Ets/Elk mt (–76 to –73; TTTC to CACT) were created by site-directed mutagenesis as described in Materials and Methods. The numbers indicate the distance from the TNF-{alpha} transcription start site. (B) RAW 264.7 cells, transfected with wild-type (WT) or mutated TNF-{alpha}-pGL3-luc in combination with phRL-SV40, were infected with mycobacteria. Twenty-four hours postinfection, cell extracts were assayed for luciferase activity, and the results represent firefly luciferase activities relative to Renilla luciferase activities and were normalized to those of cells transfected with Basic-pGL3-luc. a, P < 0.05 compared to RC; b, P < 0.05 compared to M. avium 724; c, P < 0.01 compared to RC; d, P < 0.01 compared to –76 Ets/Elk mt plus M. avium 724; e, P < 0.01 compared to WT plus M. smegmatis (Smeg). luc., luciferase; RC, noninfected BMM{phi}.

The –971 NF-{kappa}B site is required for NOS2 gene expression following mycobacterial infection. To investigate the importance of the NF-{kappa}B binding site for NOS2 promoter activity, we made mutant constructs of –1700 NOS2-pGL3 as described in Materials and Methods. The 390 NOS2 (deletion of the sequences between nucleotides –1589 and –230) and –971 NF-{kappa}B mutants (–971 to –969; GGG to CTC) were confirmed by sequencing (Fig. 5A). The –971 NF-{kappa}B mutant was previously demonstrated not to bind the transcription factor NF-{kappa}B (11). As shown in Fig. 5B, the truncated NOS2 promoter and the promoter with the mutated NF-{kappa}B binding site showed significantly reduced promoter activity in both infected and noninfected RAW 264.7 cells compared to the wild-type promoter. These results indicated that the NF-{kappa}B binding site at position –971 is essential for activation of the NOS2 promoter.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 5. The –971 NF-{kappa}B site on the NOS2 promoter is required for promoter activity in RAW 264.7 cells following a mycobacterial infection. (A) 390 NOS2-pGL3-luc containing the mouse NOS2 promoter (–230 to +160) and –971 NF-{kappa}B mt (–971 to –969; GGG to CTC) were generated as described in Materials and Methods. The numbers indicate the distance from the NOS2 transcription start site. (B) RAW 264.7 cells, transfected with wild-type (WT) promoter, 390 NOS2-pGL3-luc, or –971 NF-{kappa}B mt NOS2-pGL3-luc in combination with phRL-SV40, were infected with mycobacteria. Twenty-four hours after infection, cell extracts were assayed for luciferase activity. Results represent firefly luciferase activities relative to Renilla luciferase activities and were normalized to those of cells transfected with Basic-pGL3-luc. a, P < 0.05 compared to RC; b, P < 0.01 compared to M. avium 724. Smeg, M. smegmatis; luc., luciferase; RC, noninfected BMM{phi}.

p65 NF-{kappa}B and ERK1/2 phosphorylation in RAW 264.7 cells infected with M. avium or M. smegmatis. Previous studies indicated that Ets-1 activity is regulated by ERK1/2 (22). To determine if this is the case for RAW 264.7 cells following a mycobacterial infection, we first examined ERK1/2 activation at various times postinfection. As shown in Fig. 6, the M. avium- and M. smegmatis-infected RAW 264.7 cells gave similar levels of ERK1/2 phosphorylation at 1 h postinfection. However, ERK1/2 phosphorylation gradually decreased in the M. avium 724-infected RAW 264.7 cells and returned to RC levels by 24 h. In contrast, following an M. smegmatis infection, ERK1/2 phosphorylation remained elevated throughout the 24-h infection. Our data indicate that RAW 264.7 cells infected with M. smegmatis maintain a prolonged activation of ERK1/2 compared to cells infected with M. avium, similar to our previous results using BMM{phi} (21).



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 6. Elevated p65 NF-{kappa}B and ERK1/2 phosphorylation in M. smegmatis-infected RAW 264.7 cells. Western blot analyses of p65 NF-{kappa}B and ERK1/2 phosphorylation following 1-, 4-, 9-, or 24-h infections with either M. avium 724 or M. smegmatis. Levels of total p38 are shown to indicate equal protein loading in each lane. Smeg, M. smegmatis.

Results from Fig. 3 suggest that NF-{kappa}B is more activated in macrophages following an M. smegmatis compared to an M. avium infection. Active NF-{kappa}B exists in multiple forms of dimers, such as p50/p65 heterodimer, p50 homodimer, and c-Rel/p65 heterodimer (1). However, previous studies indicated that lipopolysaccharide-induced TNF-{alpha} activation was mainly mediated through the NF-{kappa}B p65/p50 heterodimer (15). Moreover, lipopolysaccharide stimulation induced NF-{kappa}B activation via the inducible phosphorylation of I{kappa}B and the subsequent phosphorylation of the p65 subunit (1). Therefore, to determine if a similar response is observed in RAW 264.7 cells, we examined the level of p65 phosphorylation following M. smegmatis and M. avium infections. As shown in Fig. 6, RAW 264.7 cells infected with M. avium 724 compared to M. smegmatis showed decreased phosphorylation of p65 at 1, 4, and 9 h postinfection. By 24 h, p65 phosphorylation in M. avium- and M. smegmatis-infected macrophages was nearly undetectable. Our data suggest that the p65 NF-{kappa}B is differentially regulated in macrophages infected with M. smegmatis compared to M. avium.

ERK1/2 activation is required for TNF-{alpha} but not NOS2 promoter activity following a mycobacterial infection. Our previous studies with PD98059, a MEK1-specific inhibitor, demonstrated that ERK1/2 activation is necessary for TNF-{alpha} production by BMM{Phi} in response to a mycobacterial infection (21). We observed a similar role for ERK1/2 in RAW 264.7 cells. For this experiment, we chose a PD98059 concentration which inhibits ERK1/2 phosphorylation but does not affect mycobacterial uptake. As shown in Fig. 7A, treatment with 20 µM PD98059 did not affect mycobacterial attachment and/or ingestion by RAW 264.7 cells while it decreased the ERK1/2 but not NF-{kappa}B p65 phosphorylation.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 7. ERK1/2 is essential for TNF-{alpha}, but not NOS2, production following a mycobacterium infection. (A) The cells were pretreated with 20 µM PD98059 (PD) or DMSO as a solvent control for 1 h and were then infected with mycobacteria for 4 h. The percentages of mycobacterium-associated macrophages were determined using microscopy as described in Materials and Methods. (B) TNF-{alpha} in the respective cell culture supernatants was analyzed by ELISA. (C) Western blot analysis of NOS2 production in the respective cell lysates. a, P < 0.01 compared to RC; b, P < 0.05 compared to M. avium 724 plus DMSO; c, P < 0.01 compared to M. avium 724 plus DMSO; d, P < 0.01 compared to M. smegmatis plus DMSO. Smeg, M. smegmatis.

Treatment of RAW 264.7 cells with 20 µM PD98059 decreased TNF-{alpha} production 20 to 30% compared to controls following either an M. avium or M. smegmatis infection (Fig. 7B). In contrast, it did not affect NOS2 expression levels (Fig. 7C). We also evaluated ERK1/2's role in TNF-{alpha} promoter activity. Consistent with the results at the protein level, treatment of RAW 264.7 cells with 20 µM PD98059 resulted in a slight but significant inhibition of TNF-{alpha} promoter activity in M. smegmatis-infected RAW 264.7 cells. The activity was also diminished, although not significantly, in M. avium-infected RAW 264.7 cells (Fig. 8A). Consistent with the results for NOS2 protein production, PD98059 did not affect NOS2 promoter activity (Fig. 8B).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 8. ERK1/2 promotes TNF-{alpha} and Ets but not NOS2 or NF-{kappa}B promoter activity. (A to D) RAW 264.7 cells were transfected with either Basic-pGL3-luc, –1200 TNF-{alpha}-pGL3-luc, –1700 NOS2-pGL3-luc, Ets-pGL3-luc, or NF-{kappa}B-pGL3-luc, in combination with phRL-SV40. Twenty-four hours after transfection, the cells were pretreated with 20 µM PD98059 (PD) or DMSO for 1 h and then infected with mycobacteria for 4 h. Cell extracts were assayed for luciferase activity as described in Materials and Methods. Results represent firefly luciferase activities relative to Renilla luciferase activities and were normalized to those of cells transfected with Basic-pGL3-luc. a, P < 0.05 compared to RC plus DMSO; b, P < 0.01 compared to RC plus DMSO; c, P < 0.05 compared to M. avium 724 plus DMSO; d, P < 0.01 compared to M. smegmatis plus DMSO. Smeg, M. smegmatis; luc., luciferase.

ERK1/2 activation is required for Ets/Elk promoter activity in RAW 264.7 cells following an M. smegmatis infection. We examined whether the Ets/Elk promoter activity was dependent on ERK1/2. Treatment with 20 µM PD98059 decreased Ets/Elk, but not NF-{kappa}B, activity in RAW 264.7 cells infected with M. smegmatis (Fig. 8C and D). In contrast, the treatment did not affect Ets/Elk activity in cells infected with M. avium (Fig. 8C). These results suggest that Ets/Elk activity in macrophages following a mycobacterial infection is primarily dependent on ERK1/2.


arrow
DISCUSSION
 
In the present study, we aimed to investigate whether the ETS family of transcription factors or NF-{kappa}B is involved in the differential regulation of TNF-{alpha} and NOS2 by pathogenic and nonpathogenic mycobacteria. Using luciferase reporter vectors, we could identify differential activation of the ETS transcription factors and NF-{kappa}B in macrophages following infection with M. avium and M. smegmatis and the importance of the ETS and NF-{kappa}B binding sites on the TNF-{alpha} and NOS2 promoters, respectively.

A potential mechanism by which pathogenic mycobacteria may evade the host immune response is through modulation of a signaling cascade leading to macrophage activation. Our previous studies demonstrated that infection with M. avium induced less activation of p38 and ERK1/2, resulting in lower production of TNF-{alpha} and NOS2 compared to infection with M. smegmatis (21). In the present study we show that activation of TNF-{alpha} and NOS2 are differentially regulated at the transcriptional level (Fig. 1B and D).

For TNF-{alpha} promoter activity, enhanceosome formation requires precise spatial interactions between the binding sites and the bound transcription factors and coactivators (2, 7, 26, 27). Thus, the transcription factors, which associate with other factors or coactivators, and their respective binding sites are essential for TNF-{alpha} promoter activity. In the enhanceosome following M. tuberculosis infection, ATF-2, c-jun, Ets, and Sp1 cooperate with other transcription factors and coactivator protein p300/CBP (2). Therefore, mutation of binding sites utilized for enhanceosome formation likely results in disruption of promoter activity. In our previous (20) and present studies, we showed that the mutations of the CRE and the –117 and –84 ETS binding sites (Fig. 4B) significantly reduced M. smegmatis-induced TNF-{alpha} promoter activity.

In contrast to the mutation of –117 and –84 ETS binding sites, the mutation of the –76 ETS site significantly increased the TNF-{alpha} promoter activity in mycobacterium-infected cells. At present, we lack a clear understanding of the mechanism by which this ETS site functions to negatively regulate TNF-{alpha} promoter function. However, we predicted that different ETS family members may be binding to different ETS sites to either promote or repress promoter activity. Prior studies have shown that ETS transcription factors function as either transcriptional activators or repressors as well as exhibiting low selectivity in their binding site preferences (23). Further studies are required to determine if one or more of the ETS family members negatively regulate TNF-{alpha} promoter activity.

The ETS gene family encodes a group of more than 45 proteins which have been implicated in the regulation of gene expression. ETS proteins share between 36 and 97% sequence identity with Ets-1 within the DNA binding domain and have overlapping DNA binding specificities (24). Ets-2, Elf-1, and PU-1 were reported to have particularly high similarities to Ets-1 (13). However, previous studies using quantitative DNase I footprinting demonstrated that some regions (–76, –84, and –117) of the human TNF-{alpha} promoter were protected by Ets-1 and Elk-1 in lipopolysaccharide-stimulated macrophages (26). In addition, a second report by Barthel et al., using a chromatin immunoprecipitation assay, confirmed that Ets-1 is recruited to the TNF-{alpha} promoter following M. tuberculosis infection (2). Based on these reports, we hypothesize that Ets-1 is recruited to the –84 and –117 ETS sites of the TNF-{alpha} promoter following a mycobacterial infection.

The ETS multigene family shares a common DNA binding domain that specifically interacts with sequences containing the common core trinucleotide sequence GGA. In addition to the GGA sequence, the flanking sequences are also important for specific binding of Ets-1 to DNA. Previous studies in which the flanking sequences of the Ets-1 site were examined showed that Ets-1 can bind to sequences containing both GGAA and GGAT, with a slight preference for GGAA. Studies also showed that upstream of the tetranucleotide core, A or C residues were preferred at position –1 and that C and A residues were clearly preferred at positions –2 and –3, respectively. Downstream of the tetranucleotide core, an A or G residue was favored at position 1 and T was favored at positions 2 and 3 (31). Based on these reports, we used 5'-ACCGGAAGTT-3'as the promoter sequence in the reporter vector and hypothesize that this sequence would bind Ets-1 preferentially (Fig. 3A).

Phosphorylation of ETS transcription factors is generally dependent upon MAPKs. Previous studies determined that Ets-1 was phosphorylated by ERK1/2, but it may also be a substrate for p38 (22). Although further studies are required to determine the specificity of MAPK phosphorylation of Ets-1, we have shown that Ets-1 activity following an M. smegmatis infection was dependent on ERK1/2 (Fig. 8) but not p38 (data not shown).

As shown in Fig. 2, four NF-{kappa}B sites are present in the 5' distal portion of the TNF-{alpha} promoter. However, we found that using a 200-bp fragment of the TNF-{alpha} promoter which lacked the NF-{kappa}B binding sites was a more active promoter following the mycobacterial infections than a larger fragment of DNA containing the NF-{kappa}B binding sites (data not shown). This is in agreement with a previous study which showed that promoters lacking the NF-{kappa}B binding sites did not affect the activity of the TNF-{alpha} promoter following an M. tuberculosis infection (2). However, another study reported that the mutation of a single NF-{kappa}B site in the 5' distal portion decreased the activity of a murine TNF-{alpha} promoter (14). These results indicate that the distal regions of the TNF-{alpha} promoter may have both positive and negative regulatory regions whose net effect in a luciferase reporter system varies depending on the experimental system. Nevertheless, NF-{kappa}B inhibition studies certainly indicate a role for this transcription factor in promoting TNF-{alpha} production (15, 18).

For the NOS2 promoter, evidence indicates that transcription factors such as NF-{kappa}B and NF-IL-6 are required for NOS2 expression (6, 8, 12, 17). NF-{kappa}B has been found to be essential, but not sufficient, for induction of NOS2 promoter activity. There are two NF-{kappa}B binding sites, the –971 site in region II and the –85 site in region I, on the murine NOS2 promoter (Fig. 3) (11). We mutated the –971 NF-{kappa}B site, which was previously reported to be essential for maximal induction of the NOS2 gene (11). Our data support a role for the –971 NF-{kappa}B binding site for NOS2 promoter activity in RAW 264.7 cells.

In conclusion, we found that the production of TNF-{alpha} and NOS2 by macrophages following infections with pathogenic M. avium relative to nonpathogenic M. smegmatis is regulated at the transcriptional level. This differential response can be traced to an increased activation of the Ets/Elk and NF-{kappa}B transcription factors following an M. smegmatis compared to an M. avium infection. However, our results do not rule out that other transcription factors may be differentially regulated. Moreover, MAPKs can control protein expression through translational regulation, and a differential control of TNF-{alpha} and NOS2 expression at this level is also possible.


arrow
ACKNOWLEDGMENTS
 
This work was supported through grants AI056979 and AI052439 from the National Institute of Allergy and Infectious Diseases.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biology, University of Notre Dame, 130 Galvin Life Science Center, Notre Dame, IN 46556. Phone: (574) 631-3734. Fax: (574) 631-7413. E-mail: schorey.1{at}nd.edu. Back

Editor: W. A. Petri, Jr.

{dagger} Present address: Institute of Hansen's Disease, College of Medicine, The Catholic University of Korea, 505-Manpo-dong, Socho-gu, Seoul, 137-701 Korea. Back


arrow
REFERENCES
 
    1
  1. Baldwin, A. S., Jr. 1996. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649-683.[CrossRef][Medline]
  2. 2
  3. Barthel, R., A. V. Tsytsykova, A. K. Barczak, E. Y. Tsai, C. C. Dascher, M. B. Brenner, and A. E. Goldfeld. 2003. Regulation of tumor necrosis factor alpha gene expression by mycobacteria involves the assembly of a unique enhanceosome dependent on the coactivator proteins CBP/p300. Mol. Cell. Biol. 23:526-533.[Abstract/Free Full Text]
  4. 3
  5. Bermudez, L. E., and L. S. Young. 1988. Tumor necrosis factor, alone or in combination with IL-2, but not IFN-gamma, is associated with macrophage killing of Mycobacterium avium complex. J. Immunol. 140:3006-3013.[Abstract]
  6. 4
  7. Bohlson, S. S., J. A. Strasser, J. J. Bower, and J. S. Schorey. 2001. Role of complement in Mycobacterium avium pathogenesis: in vivo and in vitro analyses of the host response to infection in the absence of complement component C3. Infect. Immun. 69:7729-7735.[Abstract/Free Full Text]
  8. 5
  9. Chan, E. D., K. R. Morris, J. T. Belisle, P. Hill, L. K. Remigio, P. J. Brennan, and D. W. Riches. 2001. Induction of inducible nitric oxide synthase-NO* by lipoarabinomannan of Mycobacterium tuberculosis is mediated by MEK1-ERK, MKK7-JNK, and NF-{kappa}B signaling pathways. Infect. Immun. 69:2001-2010.[Abstract/Free Full Text]
  10. 6
  11. Dlaska, M., and G. Weiss. 1999. Central role of transcription factor NF-IL6 for cytokine and iron-mediated regulation of murine inducible nitric oxide synthase expression. J. Immunol. 162:6171-6177.[Abstract/Free Full Text]
  12. 7
  13. Falvo, J. V., A. M. Uglialoro, B. M. Brinkman, M. Merika, B. S. Parekh, E. Y. Tsai, H. C. King, A. D. Morielli, E. G. Peralta, T. Maniatis, D. Thanos, and A. E. Goldfeld.2000 . Stimulus-specific assembly of enhancer complexes on the tumor necrosis factor alpha gene promoter. Mol. Cell. Biol. 20:2239-2247.[Abstract/Free Full Text]
  14. 8
  15. Gao, J., D. C. Morrison, T. J. Parmely, S. W. Russell, and W. J. Murphy. 1997. An interferon-gamma-activated site (GAS) is necessary for full expression of the mouse iNOS gene in response to interferon-gamma and lipopolysaccharide. J. Biol. Chem. 272:1226-1230.[Abstract/Free Full Text]
  16. 9
  17. Holland, S. M. 1996. Host defense against nontuberculous mycobacterial infections. Semin. Respir. Infect. 11:217-230.[Medline]
  18. 10
  19. Inderlied, C. B., C. A. Kemper, and L. E. Bermudez. 1993. The Mycobacterium avium complex. Clin. Microbiol. Rev. 6:266-310.[Abstract/Free Full Text]
  20. 11
  21. Kim, Y. M., B. S. Lee, K. Y. Yi, and S. G. Paik. 1997. Upstream NF-{kappa}B site is required for the maximal expression of mouse inducible nitric oxide synthase gene in interferon-gamma plus lipopolysaccharide-induced RAW 264.7 macrophages. Biochem. Biophys. Res. Commun. 236:655-660.[CrossRef][Medline]
  22. 12
  23. Kimura, T., K. Nakayama, J. Penninger, M. Kitagawa, H. Harada, T. Matsuyama, N. Tanaka, R. Kamijo, J. Vilcek, T. W. Mak, et al.1994 . Involvement of the IRF-1 transcription factor in antiviral responses to interferons. Science 264:1921-1924.[Abstract/Free Full Text]
  24. 13
  25. Kramer, B., K. Wiegmann, and M. Kronke. 1995. Regulation of the human TNF promoter by the transcription factor Ets.J. Biol. Chem. 270:6577-6583.[Abstract/Free Full Text]
  26. 14
  27. Kuprash, D. V., I. A. Udalova, R. L. Turetskaya, D. Kwiatkowski, N. R. Rice, and S. A. Nedospasov. 1999. Similarities and differences between human and murine TNF promoters in their response to lipopolysaccharide.J. Immunol. 162:4045-4052.[Abstract/Free Full Text]
  28. 15
  29. Liu, H., P. Sidiropoulos, G. Song, L. J. Pagliari, M. J. Birrer, B. Stein, J. Anrather, and R. M. Pope.2000 . TNF-alpha gene expression in macrophages: regulation by NF-kappa B is independent of c-Jun or C/EBP beta.J. Immunol. 164:4277-4285.[Abstract/Free Full Text]
  30. 16
  31. Long, R., B. Light, and J. A. Talbot. 1999. Mycobacteriocidal action of exogenous nitric oxide. Antimicrob. Agents Chemother. 43:403-405.[Abstract/Free Full Text]
  32. 17
  33. Lowenstein, C. J., E. W. Alley, P. Raval, A. M. Snowman, S. H. Snyder, S. W. Russell, and W. J. Murphy. 1993. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide. Proc. Natl. Acad. Sci. USA 90:9730-9734.[Abstract/Free Full Text]
  34. 18
  35. Mancuso, G., A. Midiri, C. Beninati, G. Piraino, A. Valenti, G. Nicocia, D. Teti, J. Cook, and G. Teti. 2002. Mitogen-activated protein kinases and NF-kappa B are involved in TNF-alpha responses to group B streptococci. J. Immunol. 169:1401-1409.[Abstract/Free Full Text]
  36. 19
  37. Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto, and S. Akira. 1993. Transcription factors NF-IL6 and NF-kappa B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90:10193-10197.[Abstract/Free Full Text]
  38. 20
  39. Roach, S. K., S. B. Lee, and J. S. Schorey.2005 . Differential activation of the transcription factor cyclic AMP response element binding protein (CREB) in macrophages following infection with pathogenic and nonpathogenic mycobacteria and role for CREB in tumor necrosis factor alpha production. Infect. Immun. 73:514-522.[Abstract/Free Full Text]
  40. 21
  41. Roach, S. K., and J. S. Schorey. 2002. Differential regulation of the mitogen-activated protein kinases by pathogenic and nonpathogenic mycobacteria. Infect. Immun. 70:3040-3052.[Abstract/Free Full Text]
  42. 22
  43. Seidel, J. J., and B. J. Graves. 2002. An ERK2 docking site in the pointed domain distinguishes a subset of ETS transcription factors. Genes Dev. 16:127-137.[Abstract/Free Full Text]
  44. 23
  45. Sharrocks, A. D., A. L. Brown, Y. Ling, and P. R. Yates. 1997. The ETS-domain transcription factor family. Int. J. Biochem. Cell Biol. 29:1371-1387.[CrossRef][Medline]
  46. 24
  47. Szymczyna, B. R., and C. H. Arrowsmith. 2000. DNA binding specificity studies of four ETS proteins support an indirect read-out mechanism of protein-DNA recognition.J. Biol. Chem. 275:28363-28370.[Abstract/Free Full Text]
  48. 25
  49. Thoma-Uszynski, S., S. Stenger, O. Takeuchi, M. T. Ochoa, M. Engele, P. A. Sieling, P. F. Barnes, M. Rollinghoff, P. L. Bolcskei, M. Wagner, S. Akira, M. V. Norgard, J. T. Belisle, P. J. Godowski, B. R. Bloom, and R. L. Modlin. 2001. Induction of direct antimicrobial activity through mammalian toll-like receptors.Science 291:1544-1547.[Abstract/Free Full Text]
  50. 26
  51. Tsai, E. Y., J. V. Falvo, A. V. Tsytsykova, A. K. Barczak, A. M. Reimold, L. H. Glimcher, M. J. Fenton, D. C. Gordon, I. F. Dunn, and A. E. Goldfeld. 2000. A lipopolysaccharide-specific enhancer complex involving Ets, Elk-1, Sp1, and CREB binding protein and p300 is recruited to the tumor necrosis factor alpha promoter in vivo. Mol. Cell. Biol. 20:6084-6094.[Abstract/Free Full Text]
  52. 27
  53. Tsytsykova, A. V., and A. E. Goldfeld. 2002. Inducer-specific enhanceosome formation controls tumor necrosis factor alpha gene expression in T lymphocytes. Mol. Cell. Biol. 22:2620-2631.[Abstract/Free Full Text]
  54. 28
  55. Vergne, I., J. Chua, S. B. Singh, and V. Deretic.2004 . Cell biology of mycobacterium tuberculosis phagosome. Annu. Rev. Cell Dev. Biol. 20:367-394.[CrossRef][Medline]
  56. 29
  57. Wasylyk, B., S. L. Hahn, and A. Giovane. 1993. The Ets family of transcription factors. Eur. J. Biochem. 211:7-18.[Medline]
  58. 30
  59. Whitmarsh, A. J., and R. J. Davis. 1996. Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways. J. Mol. Med. 74:589-607.[CrossRef][Medline]
  60. 31
  61. Woods, D. B., J. Ghysdael, and M. J. Owen.1992 . Identification of nucleotide preferences in DNA sequences recognised specifically by c-Ets-1 protein. Nucleic Acids Res. 20:699-704.[Abstract/Free Full Text]
  62. 32
  63. Zabel, U., R. Schreck, and P. A. Baeuerle. 1991. DNA binding of purified transcription factor NF-kappa B. Affinity, specificity, Zn2+ dependence, and differential half-site recognition. J. Biol. Chem. 266:252-260.[Abstract/Free Full Text]


Infection and Immunity, October 2005, p. 6499-6507, Vol. 73, No. 10
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.10.6499-6507.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Han, M., Yan, W., Guo, W., Xi, D., Zhou, Y., Li, W., Gao, S., Liu, M., Levy, G., Luo, X., Ning, Q. (2008). Hepatitis B Virus-induced hFGL2 Transcription Is Dependent on c-Ets-2 and MAPK Signal Pathway. J. Biol. Chem. 283: 32715-32729 [Abstract] [Full Text]  
  • Sampaio, E. P., Elloumi, H. Z., Zelazny, A., Ding, L., Paulson, M. L., Sher, A., Bafica, A. L., Shea, Y. R., Holland, S. M. (2008). Mycobacterium abscessus and M. avium Trigger Toll-Like Receptor 2 and Distinct Cytokine Response in Human Cells. Am. J. Respir. Cell Mol. Bio. 39: 431-439 [Abstract] [Full Text]  
  • Gutierrez, M. G., Mishra, B. B., Jordao, L., Elliott, E., Anes, E., Griffiths, G. (2008). NF-{kappa}B Activation Controls Phagolysosome Fusion-Mediated Killing of Mycobacteria by Macrophages. J. Immunol. 181: 2651-2663 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, S.-B.
Right arrow Articles by Schorey, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.-B.
Right arrow Articles by Schorey, J. S.