This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukasawa, Y.
Right arrow Articles by Mitsuyama, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukasawa, Y.
Right arrow Articles by Mitsuyama, M.

 Previous Article  |  Next Article 

Infection and Immunity, October 2005, p. 7051-7055, Vol. 73, No. 10
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.10.7051-7055.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Streptomycin-Dependent Exhibition of Cytokine-Inducing Activity in Streptomycin-Dependent Mycobacterium tuberculosis Strain 18b

Yutaka Fukasawa,1,3 Ikuo Kawamura,1 Ryosuke Uchiyama,1 Kazuhiro Yamamoto,1 Taijin Kaku,1 Takanari Tominaga,1 Takamasa Nomura,1 Satoshi Ichiyama,2 Takayuki Ezaki,3 and Masao Mitsuyama1*

Department of Microbiology,1 Department of Clinical Laboratory Medicine, Kyoto University Graduate School of Medicine, Kyoto,2 Department of Microbiology, Regeneration and Advanced Medical Science, Gifu University Graduate School of Medicine, Gifu, Japan3

Received 24 February 2005/ Returned for modification 12 April 2005/ Accepted 13 June 2005


arrow
ABSTRACT
 
Peritoneal exudate cells of mice were stimulated with a streptomycin-dependent Mycobacterium tuberculosis strain, 18b. Gamma interferon production by natural killer cells depending on interleukin-12 and interleukin-18 was induced only in the presence of a high dose of streptomycin. This study suggested the requirement of active bacterial metabolism for this host response.


arrow
TEXT
 
Mycobacterium tuberculosis is a causative agent of tuberculosis in human being. One-third of the world's population is currently infected with tubercle bacilli, and the global incidence of active tuberculosis per year is around 8 million cases (2). It is of great importance to understand the basic mechanism for the induction of the immune response of the host against M. tuberculosis. The generation of protective immunity against tuberculosis is dependent on the induction of CD4+ Th1 cells capable of producing gamma interferon (IFN-{gamma}) upon stimulation with specific antigen. IFN-{gamma} contributes to the development of acquired resistance via the activation of macrophages (3). The importance of IFN-{gamma} in the resistance of mice to M. tuberculosis has been confirmed by utilizing IFN-{gamma} knockout mice and IFN-{gamma} receptor knockout mice (1, 4, 11). IFN-{gamma} is crucial also for the development of protective T cells. In our previous study, the treatment of mice with anti-IFN-{gamma} antibody during primary immunization with viable cells of M. bovis bacillus Calmette-Guérin reduced the number of antigen-specific IFN-{gamma}-producing cells and abolished the generation of protective immunity (26). Thus, IFN-{gamma} is indispensable for both induction and expression of protective immunity against tuberculosis.

It has been shown that CD4+ protective T cells are generated after infection with a sublethal dose of M. tuberculosis or M. bovis bacillus Calmette-Guérin, whereas such effector T cells are hardly induced by immunization with killed bacteria (14). We have found that the failure of killed bacteria to induce effective protective immunity in mice is due to the absence of an IFN-{gamma}-inducing ability that is observed exclusively in viable bacilli (25, 26). Killed M. tuberculosis has been prepared generally by treatment with heating, germicides, or irradiation (7, 16, 20, 24), but such treatment may affect several bacterial components physically or chemically. In order to address whether the significant difference in the IFN-{gamma}-inducing abilities of viable and killed M. tuberculosis is due to some undesirable changes introduced during the killing process or actually due to the viability itself, we have employed a streptomycin (SM)-dependent M. tuberculosis strain, 18b, in this study.

This particular strain, originally isolated in 1955 (6), has been maintained as a stock for a long time at the National Institute of Infectious Diseases in Japan, so we first confirmed whether this strain maintained the original SM dependency. On a Middlebrook 7H10 agar plate, strain 18b never grew during 5 weeks of observation in the absence of SM (Fig. 1). However, the addition of SM at concentrations of 50 µg/ml and above supported the growth of bacteria, resulting in the formation of countable colonies. It was confirmed that cells of strain 18b kept under even an SM-free condition never die for many weeks, as has been reported in the past (12, 19). According to the molecular characterization reported in 1995, M. tuberculosis strain 18b was shown to carry a novel mutation in the rrs gene, coding for 16S rRNA (8). By PCR amplification and sequence analysis of the corresponding region of genomic DNA, we were able to detect just one insertion of an additional cytosine residue (underlined) between positions 512 and 513 in the 530 loop of 16S rRNA (AGCCAGCCGCGGTAATACGTAG), as reported previously (8).



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. SM-dependent growth of M. tuberculosis strain 18b. One hundred microliters of an appropriately diluted suspension of M. tuberculosis strain 18b was inoculated on Middlebrook 7H10 agar plates containing the indicated concentrations (concn) of SM. After 5 weeks of cultivation at 37°C, the number of visible colonies was counted. Data are shown as the means for three cultures ± standard deviations (SD). On the plates containing 0 and 10 µg/ml of SM, no colony formation was observed at the end of 5 weeks of cultivation. Two independent experiments showed similar results.

We compared the IFN-{gamma}-inducing activities of M. tuberculosis H37Rv and strain 18b. Peritoneal exudate cells (PECs) were induced in C3H/HeN mice by the intraperitoneal injection of 3% thioglycolate medium, and the cells were stimulated with M. tuberculosis at a multiplicity of infection (MOI) of 2 for 18 h in the absence of SM to measure the cytokine produced in the supernatant. The concentration of IFN-{gamma} was measured by a sandwich enzyme-linked immunosorbent assay constructed in our laboratory (10), and a mouse tumor necrosis factor alpha (TNF-{alpha}) enzyme-linked immunosorbent assay set purchased from BD Biosciences (San Jose, CA) was used for measuring TNF-{alpha}. Interestingly, the IFN-{gamma}-inducing activity of viable strain 18b was considerably weaker than that of viable H37Rv (Fig. 2).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Production of IFN-{gamma} and TNF-{alpha} after stimulation of PECs with H37Rv or 18b in the absence of SM. PECs were stimulated with viable or heat-killed cells of H37Rv (A) or 18b (B) for 18 h at MOIs of 2 in the absence of SM. Killed bacteria were prepared by heating at 70°C for 2 h. The culture supernatants were collected, and the concentrations of IFN-{gamma} and TNF-{alpha} were measured by enzyme immunoassay. Data are shown as the means for triplicate wells ± SD. The data shown are from one of two independent experiments.

In order to consider whether the activation of the growth cycle results in the change in IFN-{gamma}-inducing activity, we next examined the IFN-{gamma} production induced by stimulation with viable cells of strain 18b in the presence of graded concentrations of SM in a PEC culture. The high-level production of both IFN-{gamma} and TNF-{alpha} induced by stimulation with viable cells of strain H37Rv showed slight decreases corresponding to the increase of SM concentration in the cell culture (Fig. 3A). On the other hand, the IFN-{gamma} production induced by stimulation with viable cells of strain 18b, which was very low in the absence of SM, showed a significant increase that depended on the concentration of SM supplemented in the culture (Fig. 3B). TNF-{alpha} production was also increased, depending on the concentration of SM. This result indicated that support of bacterial growth is essential for the maximum expression of the IFN-{gamma}-inducing activity of M. tuberculosis and suggested that the initiation of active metabolism may account for the changes observed here.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 3. Production of IFN-{gamma} and TNF-{alpha} after stimulation of PECs with H37Rv or 18b in the presence of various concentrations (concn) of SM. The indicated concentrations of SM were added to the PEC culture. Two hours later, PECs were stimulated with viable cells of H37Rv (A) or 18b (B) for 18 h at MOIs of 2. The culture supernatants were collected and the concentrations of IFN-{gamma} and TNF-{alpha} were measured. The data shown are the means for triplicate wells ± SD. The data shown represent three independent experiments that showed the same tendency. *, P < 0.01 according to Student's t test.

In contrast to the SM concentration supporting the growth of strain 18b on Middlebrook 7H10 medium, an extremely higher concentration was required in PEC culture for the acquisition of a significant level of cytokine-inducing activity. As SM is one of the antibiotics that are believed to have difficulty in penetrating cell membranes of PECs (15), it was plausible that this high concentration of SM was necessary to provide an intracellular SM concentration required by the bacteria inside macrophages. To address this possibility, PECs were cultured in the presence of various concentrations of SM for 20 h, a period equivalent to that used in the cytokine assay. After extensive washings, cells were lysed, and the SM was titrated by using a RIDASCREEN streptomycin assay (AZmax Co. Chiba, Japan). Then, the intracellular concentrations of SM were calculated from the packed-cell volume. The results indicated that the intracellular concentration of SM was highly dependent on the concentration in the cell culture medium. As shown in Fig. 4, the intracellular concentration of SM was estimated to be above 100 µg/ml when added to the cell culture at 1,000 µg/ml. This finding supported an idea that the IFN-{gamma}-inducing activity of M. tuberculosis is highly dependent on the presence of active metabolism. As one of the parameters for bacterial metabolism, the concentration of ammonium ion produced by M. tuberculosis (5) was measured by using a PACK TEST (PACK TEST Ammonium; Kyoritsu Chemical-Check Laboratory Corp., Tokyo, Japan). There was an increase in the concentration of ammonium ion in the supernatant of 18b cultured in RPMI 1640 medium for 20 h in the presence of 100 µg/ml of SM compared to that in the absence of SM (data not shown), suggesting that the active metabolism was induced by SM during this period of culturing.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. Determination of intracellular concentration (concn) of SM in the PECs incubated at different concentrations of SM in media for 20 h. After three washes with PBS, the intracellular concentrations of SM were calculated. Data are shown as the means for triplicate wells ± SD. The data shown are for one of two independent experiments.

Based on these findings, it was likely that there are some mycobacterial factors existing in viable bacteria, but not in killed bacteria, which contribute to the induction of IFN-{gamma} production. Changes of the transcriptional or translational levels in various M. tuberculosis genes inside macrophages have been reported previously (17, 22). This may be an important strategy of M. tuberculosis for intracellular survival, and it is probable that some components synthesized inside the phagosome may play a role in triggering IFN-{gamma} production. The present finding appeared to be consistent with an old observation that acquired immunity was not induced in mice by immunization with strain 18b cultivated in an SM-starved condition (13).

In order to know whether the IFN-{gamma} production observed in this study was induced in similar manners in the stimulations by both H37Rv and 18b plus SM, the cytokines and effector cells involved in the final IFN-{gamma} production were examined with special reference to interleukin-12 (IL-12) and IL-18, which are known to induce IFN-{gamma} production by natural killer (NK) cells in PECs (27). The addition of neutralizing antibody to IL-12 or IL-18 resulted in appreciable levels of inhibition of IFN-{gamma} production after stimulation with H37Rv or 18b plus SM, and a marked inhibition was observed when IL-12 and IL-18 were neutralized simultaneously (Fig. 5A). Next, the whole PECs were depleted of NK cells by using anti-asialo GM1 antibody (Wako Pure Chemical Industries, Ltd., Osaka, Japan) and complement. The reason for the increase in the IFN-{gamma} production after treatment with the complement alone or with control immunoglobulin is not clear, but the treatment of PECs with anti-asialo GM1 antibody followed by treatment with the complement almost completely abolished the IFN-{gamma} response after stimulation with H37Rv and 18b plus SM (Fig. 5B). These findings suggested that, first, Il-12 and Il-18 were produced from adherent macrophages infected with M. tuberculosis H37Rv or with 18b, and then these IFN-{gamma}-inducing cytokines activated NK cells, just as we previously observed in the cells and cytokines involved in the IFN-{gamma} response to Listeria monocytogenes (18).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. Cytokines and the cells responsible for the IFN-{gamma} production in the culture of whole PECs stimulated with M. tuberculosis (MTB). (A) Neutralizing antibodies to IL-12 or IL-18 were added to the culture and the change in the level of IFN-{gamma} production was examined. (B) PECs were treated either with complement (C) alone, with 100 µg/ml of control rabbit immunoglobulin G (IgG), or with 100 µg/ml of anti-asialo GM1 (ASGM1) antibody followed by complement. Then, the cells were washed and stimulated with H37Rv or with 18b in the presence of SM. Data are shown as the means for four wells ± SD. The data shown are from one of two independent experiments. * P < 0.01 according to Student's t test. concn, concentration.

A recent study has shown that IFN-{gamma} induction does occur after infection with M. tuberculosis in mice knocked out for MyD88, a cytoplasmic adaptor molecule for the Toll-like receptor signaling pathway (23). Several lines of evidence indicated that there are intracellular pattern recognition receptors, including nucleotide-binding oligomerization domain proteins, that respond to bacterial products (9, 21). It is probable that viable cells of M. tuberculosis may stimulate a type of such intracellular pathways, resulting in the induction of Th1 cytokine production.

The present study employing an SM-dependent M. tuberculosis strain, 18b, presented a piece of the mechanism accounting for the highly potent IFN-{gamma}-inducing activity that was virtually unobserved in killed M. tuberculosis but was observed in the viable form of this organism. The use of strain 18b may provide more insights into the essential role of metabolic products for the host response in addition to clarifying the precise molecular mechanism of SM dependency of this unique mutant strain in the future.


arrow
ACKNOWLEDGMENTS
 
We thank Toshio Yamazaki (National Institute of Infectious Diseases, Tokyo, Japan) for strain 18b of M. tuberculosis.

This work was supported in part by grants from The Ministry of Education, Science, Culture and Sports of Japan and from The Japan Society for the Promotion of Science.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, Kyoto University Graduate School of Medicine, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606-8501, Japan. Phone: 81-75-753-4448. Fax: 81-75-753-4446. E-mail: mituyama{at}mb.med.kyoto-u.ac.jp. Back

Editor: J. L. Flynn


arrow
REFERENCES
 
    1
  1. Cooper, A. M., D. K. Dalton, T. A. Stewart, J. P. Griffin, D. G. Russell, and I. M. Orme. 1993. Disseminated tuberculosis in interferon gamma gene-disrupted mice. J. Exp. Med. 178:2243-2247.[Abstract/Free Full Text]
  2. 2
  3. Enarson, D. A., C.-Y. Chiang, and J. F. Murray. 2004. Global epidemiology of tuberculosis, p. 13-29, In W. N. Rom and S. M. Garay (ed.), Tuberculosis, 2nd ed. Lippincott Williams and Wilkins, Philadelphia, Pa.
  4. 3
  5. Flynn, J. L., and J. Chan. 2001. Immunology of tuberculosis. Annu. Rev. Immunol. 19:93-129.[CrossRef][Medline]
  6. 4
  7. Flynn, J. L., J. Chan, K. J. Triebold, D. K. Dalton, T. A. Stewart, and B. R. Bloom. 1993. An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178:2249-2254.[Abstract/Free Full Text]
  8. 5
  9. Gordon, A. H., P. D. Hart, and M. R. Young. 1980. Ammonia inhibits phagosome-lysosome fusion in macrophages. Nature 286:79-80.[CrossRef][Medline]
  10. 6
  11. Hashimoto, T. 1955. Experimental studies on the mechanism of infection and immunity in tuberculosis from the analytical standpoint of streptomycin-dependent tubercle bacilli. Kekkaku 30:4-8. (In Japanese.)[Medline]
  12. 7
  13. Havlir, D. V., J. J. Ellner, K. A. Chervenak, and W. H. Boom. 1991. Selective expansion of human {gamma}{delta}-T cells by monocytes infected with live Mycobacterium tuberculosis. J. Clin. Investig. 87:729-733.
  14. 8
  15. Honore, N., G. Marchal, and S. T. Cole. 1995. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 39:769-770.[Abstract]
  16. 9
  17. Inohara, N., and G. Nunez. 2003. NODs: intracellular proteins involved in inflammation and apoptosis. Nat. Rev. Immunol. 3:371-382.[CrossRef][Medline]
  18. 10
  19. Ito, Y., I. Kawamura, C. Kohda, H. Baba, T. Nomura, T. Kimoto, I. Watanabe, and M. Mitsuyama. 2003. Seeligeriolysin O, a cholesterol-dependent cytolysin of Listeria seeligeri, induces gamma interferon from spleen cells of mice. Infect. Immun. 71:234-241.[Abstract/Free Full Text]
  20. 11
  21. Kamijo, R., J. Le, D. Shapiro, E. A. Havell, S. Huang, M. Aguet, M. Bosland, and J. Vilcek. 1993. Mice that lack the interferon-gamma receptor have profoundly altered responses to infection with bacillus Calmette-Guérin and subsequent challenge with lipopolysaccharide. J. Exp. Med. 178:1435-1440.[Abstract/Free Full Text]
  22. 12
  23. Kanai, K. 1962. Experimental analysis of the host-parasite equilibrium in tuberculous infection. I. Preparation of multiplication-resting virulent tubercle bacilli in vitro and the significance of their use. Med. Biol. 64:147-150. (In Japanese.)
  24. 13
  25. Kanai, K. 1962. An experimental analysis of the host-parasite equilibrium in tuberculous infection. II. Relation between multiplication and the living cell-specific immunogenicity. Med. Biol. 65:18-22. (In Japanese.)
  26. 14
  27. Kawamura, I., H. Tsukada, H. Yoshikawa, M. Fujita, K. Nomoto, and M. Mitsuyama. 1992. IFN-gamma-producing ability as a possible marker for the protective T cells against Mycobacterium bovis BCG in mice. J. Immunol. 148:2887-2893.[Abstract]
  28. 15
  29. Law, K. F., and M. Weiden. 1996. Streptomycin, other aminoglycosides, and capreomycin, p. 785-797. In W. N. Rom and S. M. Garay (ed.) Tuberculosis. Little, Brown and Company, Boston, Mass.
  30. 16
  31. Malik, Z. A., G. M. Denning, and D. J. Kusner. 2000. Inhibition of Ca2+ signaling by Mycobacterium tuberculosis is associated with reduced phagosome-lysosome fusion and increased survival within human macrophages. J. Exp. Med. 191:287-302.[Abstract/Free Full Text]
  32. 17
  33. Monahan, I. M., J. Betts, D. K. Banerjee, and P. D. Butcher. 2001. Differential expression of mycobacterial proteins following phagocytosis by macrophages. Microbiology 147:459-471.[Abstract/Free Full Text]
  34. 18
  35. Nomura, T., I. Kawamura, K. Tsuchiya, C. Kohda, H. Baba, Y. Ito, T. Kimoto, I. Watanabe, and M. Mitsuyama. 2002. Essential role of interleukin-12 (IL-12) and IL-18 for gamma interferon production induced by listeriolysin O in mouse spleen cells. Infect. Immun. 70:1049-1055.[Abstract/Free Full Text]
  36. 19
  37. Ohta, Y. 1971. Studies on the effect of antituberculosis agents against tubercle bacilli in the resting state, using streptomycin-dependent strain (18-b). Kekkaku 46:295-301. (In Japanese.)[Medline]
  38. 20
  39. Orme, I. M. 1988. Induction of nonspecific acquired resistance and delayed-type hypersensitivity, but not specific acquired resistance, in mice inoculated with killed mycobacterial vaccines. Infect. Immun. 56:3310-3312.[Abstract/Free Full Text]
  40. 21
  41. Quesniaux, V., C. Fremond, M. Jacobs, S. Parida, D. Nicolle, V. Yeremeev, F. Bihl, F. Erard, T. Botha, M. Drennan, M. N. Soler, M. L. Bert, B. Schnyder, and B. Ryffel. 2004. Toll-like receptor pathways in the immune responses to mycobacteria. Microbes Infect. 6:946-959.[CrossRef][Medline]
  42. 22
  43. Schnappinger, D., S. Ehrt, M. I. Voskuil, Y. Liu, J. A. Mangan, I. M. Monahan, G. Dolganov, B. Efron, P. D. Butcher, C. Nathan, and G. K. Schoolnik. 2003. Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment. J. Exp. Med. 198:693-704.[Abstract/Free Full Text]
  44. 23
  45. Sugawara, I., H. Yamada, S. Mizuno, K. Takeda, and S. Akira. 2003. Mycobacterial infection in MyD88-deficient mice. Microbiol. Immunol. 47:841-847.[Medline]
  46. 24
  47. Weiss, D. W. 1959. Vaccination against tuberculosis with nonliving vaccines. Am. Rev. Respir. Dis. 80:340-358.[Medline]
  48. 25
  49. Yang, J., I. Kawamura, H. Zhu, and M. Mitsuyama. 1995. Involvement of natural killer cells in nitric oxide production by spleen cells after stimulation with Mycobacterium bovis BCG. Study of the mechanism of the different abilities of viable and killed BCG. J. Immunol. 155:5728-5735.[Abstract]
  50. 26
  51. Yang, J., and M. Mitsuyama. 1997. An essential role for endogenous interferon-{gamma} in the generation of protective T cells against Mycobacterium bovis BCG in mice. Immunology 91:529-535.[CrossRef][Medline]
  52. 27
  53. Zhang, T., K. Kawakami, M. H. Qureshi, H. Okamura, M. Kurimoto, and A. Satoh. 1997. Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of gamma interferon by natural killer cells. Infect. Immun. 65:3594-3599.[Abstract]


Infection and Immunity, October 2005, p. 7051-7055, Vol. 73, No. 10
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.10.7051-7055.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Hara, H., Tsuchiya, K., Nomura, T., Kawamura, I., Shoma, S., Mitsuyama, M. (2008). Dependency of Caspase-1 Activation Induced in Macrophages by Listeria monocytogenes on Cytolysin, Listeriolysin O, after Evasion from Phagosome into the Cytoplasm. J. Immunol. 180: 7859-7868 [Abstract] [Full Text]  
  • Hara, H., Kawamura, I., Nomura, T., Tominaga, T., Tsuchiya, K., Mitsuyama, M. (2007). Cytolysin-Dependent Escape of the Bacterium from the Phagosome Is Required but Not Sufficient for Induction of the Th1 Immune Response against Listeria monocytogenes Infection: Distinct Role of Listeriolysin O Determined by Cytolysin Gene Replacement. Infect. Immun. 75: 3791-3801 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukasawa, Y.
Right arrow Articles by Mitsuyama, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukasawa, Y.
Right arrow Articles by Mitsuyama, M.