Previous Article | Next Article ![]()
Infection and Immunity, November 2005, p. 7297-7303, Vol. 73, No. 11
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.11.7297-7303.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Veterinary Molecular Biology, Montana State University, Bozeman, Montana 59717-3610,1 LigoCyte Pharmaceuticals, Inc., 2155 Analysis Drive, Bozeman, Montana 59718-68312
Received 15 April 2005/ Returned for modification 20 May 2005/ Accepted 18 July 2005
|
|
|---|
|
|
|---|
DNA vaccines offer a promising approach because they can stimulate both cellular and humoral immunity (13, 26). Furthermore, DNA vaccines have many advantages over traditional protein-based vaccines, including ease of development, induction of long-lived immunity, and minimal preparation costs. With regard to effectiveness, previous studies have already shown that DNA vaccination with sodC (22), lumazine synthase gene (27), and P39 (2) can elicit partial protection against Brucella challenge. Furthermore, in contrast to live attenuated vaccines, there are no concerns of induced disease, and the DNA vaccines are stable.
With the completion of sequencing the Brucella genome, identification of novel protective antigens is feasible. In the present study, we applied a search strategy to screen the B. melitensis 16M genome for potential immunogenic antigens. By cloning these potential antigen candidates into the pcDNA3.1 vector and testing their efficacy in BALB/c mice, two protective antigens were identified.
|
|
|---|
/) on a BALB/c background (29) at 6 to 9 weeks of age were used throughout the present study. All mice were maintained at Montana State University Animal Resource Center under pathogen-free conditions in individually ventilated cages under HEPA-filtered barrier conditions and were fed sterile food and water ad libitum. In conducting research with animals, the investigator(s) adhered to the Guide for the Care and Use of Laboratory Animals, prepared by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory Animal Resources, National Research Council (NIH publication no. 86-23, revised 1985). For challenge studies with B. melitensis strain 16M, mice were maintained under similar isolation conditions, but in the ABSL-3 facilities. All animal care and procedures were in accordance with institutional policies for animal health and well-being.
Bacterial strains and growth conditions.
B. melitensis virulent strain 16M was obtained from the National Veterinary Services Laboratory, U.S. Department of Agriculture, Ames, IA. Bacteria were grown under aerobic conditions in potato infusion agar for 72 h or in brucella broth (Difco Laboratories, Detroit, MI) overnight at 37°C and 5% CO2. For inoculation, the bacterial suspensions were adjusted spectrophotometrically to an optical density at 600 nm corresponding to 104 CFU/200 µl. All experiments with live brucellae were performed in biosafety level 3 facilities. Escherichia coli strain DH5
(Life Technology, Gaithersburg, MD) was used for producing the necessary plasmid constructs. The E. coli cultures were routinely grown at 37°C in Luria-Bertani (LB) broth or agar supplemented, when required, with 50 µg of ampicillin and 10 µg of kanamycin per ml.
Construction of DNA vaccine candidates. DNA fragments of the 32 target genes from B. melitensis 16M were amplified by a PCR in which the EcoRI and XbaI or BamHI and XhoI sites were integrated into upstream and downstream primers. The Kozak sequence was introduced within the upstream DNA primer (18). These fragments were then cloned under the cytomegalovirus (CMV) promoter in the eukaryotic vector pcDNA3.1(+) (Invitrogen Corp., San Diego, CA).
The resulting plasmids (using the prefix pCMV_) were cultured in LB broth containing ampicillin (50 µg/ml) and kanamycin (10 µg/ml). Large-scale plasmid DNA isolation was performed using a Plasmid Giga Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. Plasmids were finally resuspended in phosphate-buffered saline at a concentration of 1,000 µg/ml. DNA concentration and purity were determined by measuring the optical density, and the A260/A280 ratio was typically greater than 1.8. The recombinant plasmid construct was verified both by restriction enzyme digest and by sequencing the complete insert. In conducting work involving the use of recombinant DNA, the investigator(s) adhered to the Guidelines for Research Involving Recombinant DNA Molecules (notice, Federal Register, 5 July 1994, vol. 59, no. 127).
Production of recombinant bp26 and TF proteins. To enable the assessment of immunity to bp26 and TF, bp26 and TF gene fragments from pcDNA3.1 vector were amplified by PCR. EcoRI and ApaI sites were integrated to the 5' and 3' ends to ensure the fragments were in frame with the C-terminal myc and His tag epitopes of Pichia pastoris vector pPICZA (Invitrogen Corp.). These two plasmids were designated pIC-bp26 and pIC-TF, respectively. The plasmids were digested by PmeI. After precipitation and washing in 70% ethanol, the pellets were dried, resuspended in double-distilled water, and transformed into Pichia pastoris X-33 cells (Invitrogen Corp.). Cells were resuspended in 1 ml of 1 M sorbitol and incubated for 1 h at 30°C. They were then resuspended in 0.5 ml of medium (yeast extract, 10 g/liter; peptone, 20 g/liter; glucose, 20 g/liter; sorbitol, 1 M [final concentration]; agar [optional], 15 g/liter) and incubated for 2 h at 30°C. Transformants were applied to plates containing 100, 500, and 1,000 U of zeocin/ml, respectively. After 3 days, 9 colonies were selected from the 1,000-U/ml zeocin plate. Cells were lysed using glass beads (Sigma-Aldrich Chemical Co., St. Louis, MO), and their expression was examined by Western blot analysis. Proteins were transferred from the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12% (wt/vol) polyacrylamide gel to 0.2-µm-pore-size nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA). Membranes were probed, first with the rabbit polyclonal His tag antiserum and then with a goat anti-rabbit IgG conjugated to horseradish peroxidase (Southern Biotechnology Associates, Inc. [SBA], Birmingham, AL). Detection of His tag fusion protein bands was achieved upon development with the substrate 4-chloro-1-naphthol chromogen and H2O2 (Sigma-Aldrich). The clones providing the best expression were selected and named pICbp26 and pICTF, respectively.
Large-scale expression and purification were performed as follows: X-33/pICbp26 and X-33/pICTF were grown in four flasks, each containing 500 ml of buffered minimal glycerol medium (100 mM potassium phosphate buffer [pH 6.0], 1.34% yeast nitrogen base, 4 x 105% biotin, 1% glycerol), in 2-liter shaker flasks for 48 h at 30°C and 200 rpm, with glycerol replenished after 24 h. Biomass was collected through centrifugation. Pellets were resuspended at a 1:2 ratio in 2-liter baffled flasks containing buffered minimal methanol media (100 mM potassium phosphate buffer [pH 6.0], 1.34% yeast nitrogen base, 4 x 105 % biotin, 0.5% methanol) and shaken for 24 h at 30°C 200 rpm. Pellets were collected by centrifugation, and cells were lysed using glass beads (425 to 600 nm) and acid washed (Sigma-Aldrich) in lysis buffer (300 mM NaCl, 50 mM Na2H2PO4, and 10 mM imidazole [pH 7.2] containing 0.1% Triton X-100). Lysate was cleared through centrifugation and filtered through a 0.45-µm-pore-size bottle top filter (Nalge-Nunc International, Rochester, NY). Purification was accomplished by batch/gravity flow over Talon resin (BD BioSciences Clontech, Franklin Lakes, NJ). The 20-ml final bed volume was equilibrated with Talon wash-equilibration buffer (pH 7.2; 300 mM NaCl, 50 mM Na2H2PO4, 10 mM imidazole) and then incubated with cell lysate for 1 h at 4°C with rotation. A 35-ml glass column was packed with lysate-resin suspension using gravity flow and washed with 10x bed volumes of Talon wash-equilibration buffer (pH 7.2). Protein was diluted with Talon elution buffer (pH 7.2; 300 mM NaCl, 50 mM Na2H2PO4, 150 mM imidazole), and the pooled fractions containing the protein of interest were stored at 80°C. Protein purity was checked by SDS-PAGE/Coomassie staining and Western blot analysis with the anti-myc antibody (Invitrogen Corp.).
SDS-PAGE and Western blot analysis. SDS-PAGE and immunoblot analysis of purified bp26 and TF proteins were performed using standard procedures. For Western blot analysis, proteins were transferred from the SDS-PAGE (12% [wt/vol] polyacrylamide) gel to 0.2-µm-pore-size nitrocellulose membranes (Bio-Rad). Membranes were probed, first with a monoclonal mouse anti-myc antibody (Invitrogen Corp.) and then with a goat anti-mouse IgG conjugated to horseradish peroxidase (SBA). Detection of bp26 and TF antigens was achieved upon development with the substrate 4-chloro-1-naphthol chromogen and H2O2 (Sigma-Aldrich).
Immunization and colony counts. To screen the 32 constructs made in pcDNA3.1, BALB/c mice were anesthetized with inhaled isoflurane, and 300 µg of a single plasmid DNA construct plus 50 µg of CpG was injected at the anterior tibial tuberosity to ensure the vaccines were delivered to the muscle, as previously described (10). The sequence of CpG used was as follows: TCCATGACGTTCCTGACGTT (30). Vaccination was performed at weeks 0, 2, 4, and 6. For negative controls, mice were immunized with an equal amount of empty pcDNA3.1 vector plus 50 µg of CpG. At 4 weeks after the final immunization, mice were challenged intraperitoneally with 2.4 x 104 CFU B. melitensis 16M in 200 µl of PBS buffer. At 4 weeks postchallenge, mice were euthanized, and the spleens were removed for CFU determinations. Spleens were Dounce homogenized in 1 ml of sterile water to completely lyse cells. Serial 10-fold dilutions in duplicate of homogenates in sterile water were grown on potato infusion agar. After incubation for 3 to 5 days at 37°C with 5% CO2, Brucella colonies were enumerated, and the number of CFU per spleen was calculated from the dilutions. An arbitrary criterion of a reduction in splenic colonization by >0.6 log may identify potential candidates. For the repeat experiments, mice (five animals/group) were intramuscularly (i.m.) immunized with 50 µg of CpG plus 300 µg of vector, pCMVbp26, pCMVTF, or 150 µg of pCMVbp26 and 150 µg of pCMVTF; for the third experiment, mice (five animals/group) were i.m. immunized with 50 µg of CpG plus 80 µg of vector or 40 µg of pCMVbp26 and pCMVTF (total 80 µg of DNA).
ELISA. To determine induced antibodies to bp26 and TF, an enzyme-linked immunosorbent assay (ELISA) was used to measure immune serum IgG, IgG1, IgG2a, and IgG2b levels. Purified bp26 and TF proteins (5 µg/ml) were used to coat Maxisorp microtiter plates (Nunc, Roskilde, Denmark) at 100 µl/well overnight at 4°C. Plates were washed four times in a wash buffer (Tris-buffered saline [pH 7.4] with 0.05% Tween 20) and blocked with 2% milk in Tris-buffered saline for 2 h at 37°C and then incubated with serial dilutions of the sera from mice for 3 h at room temperature, and washed three times. Horseradish peroxidase-conjugated goat anti-mouse IgG, IgG1, IgG2a, or IgG2b antibodies (SBA) were used for detection. After 90 min of incubation at 37°C and a washing step, the specific reactivity was determined by the addition of an enzyme substrate, ABTS [2,2'azinobis(3-ethylbenzthiazolinesulfonic acid)] diammonium (Moss, Inc., Pasadena, CA) at 100 µl/well. The absorbance was measured at 415 nm on a Kinetics Reader model EL312 (Bio-Tek Instruments, Winooski, VT). Endpoint titers were defined as the highest reciprocal of dilution of sample giving an optical density at 415 nm of 0.100 U above negative controls after 1 h of incubation at 25°C.
Cytokine ELISPOT.
Groups of BALB/c or IFN-
/ mice (five to ten/group) were euthanized 4 weeks after the last immunization to collect spleens. Splenic lymphocytes were isolated by conventional methods using Dounce homogenization (28), yielding >95% viability using trypan blue exclusion. Total splenic mononuclear cells (5 x 106/ml) were resuspended in complete medium (CM; RPMI 1640 [Gibco-BRL/Life Technologies, Grand Island, NY], 10% fetal bovine serum [Atlanta Biologicals, Atlanta, GA], 10 mM HEPES buffer, 10 mM nonessential amino acids, 10 mM sodium pyruvate, 100 U of penicillin/ml, 100 µg of streptomycin/ml) and restimulated with 20 µg of recombinant bp26 or TF/ml in the presence of 10 U of human IL-2 (PeproTech, Inc., Rocky Hill, NJ)/ml for 2 days at 37°C. Cells were washed and resuspended in CM. Stimulated lymphocytes were then evaluated by IFN-
-, IL-4-, IL-5-, IL-6-, and IL-10-specific enzyme-linked immunospot (ELISPOT) assays as previously described (28). To control for nonspecific reactivity against bp26 and TF, naive BALB/c lymphocytes were cultured as described above with 20 µg of bp26 or TF/ml in the presence of 10 U of human IL-2/ml for 2 days.
Statistical analysis. An analysis of variance followed by Tukey's method was used to evaluate differences between variations in splenic colonization, antibody titers, and cytokine production levels. The P value for statistical differences between plasmid vector and vaccines and the performance of these vaccines stimulating B and T lymphocyte responses was discerned at the 95% confidence interval.
|
|
|---|
A total of 32 genes or open reading frames (ORFs) were termed as being antigenic or immunogenic as indicated by the BLAST search. These genes were amplified by PCR and cloned into pcDNA3.1 plasmid. The ribosomal gene L7/L12, previously known to be a protective antigen for Brucella abortus (19), was also inserted into pcDNA3.1(+) to use as a positive control (Table 1). The empty pcDNA3.1 vector was used as a negative control.
|
View this table: [in a new window] |
TABLE 1. B. melitensis genes or ORFs found to be potential antigens constructed in pcDNA3.1(+)
|
|
View this table: [in a new window] |
TABLE 2. Spleen CFU of the 35 BALB/c mice challenged with B. melitensis 16M
|
![]() View larger version (12K): [in a new window] |
FIG. 1. BALB/c mice vaccinated with bp26 or TF DNA vaccines showed reduced splenic colonization following challenge with 2.4 x 104 CFU of B. melitensis 16M. (A) Groups of mice (five/group) were immunized on days 0, 14, 28, and 42 with 300 µg of pcDNA3.1 vector, pCMVTF, or pCMVbp26 or with 150 µg of pCMVTF and pCMVbp26, and each group received a 50-µg CpG/immunization. At 4 weeks after the last immunization, mice were challenged intraperitoneally with B. melitensis 16M. Compared to the group immunized with pcDNA3.1 vector, the pCMVTF (P = 0.011) and pCMVbp26 (P = 0.036) immunized groups had significantly less splenic colonization, and the combination of pCMVTF and pCMVbp26 (P = 0.016) had the least colonization. (B) To ascertain whether a lesser dose of pCMVTF and pCMVbp26 would still be efficacious (five mice/group), 40 µg of each vaccine was given i.m. on days 0, 14, 28, and 42 and compared to mice (five/group) dosed with 80 µg of pcDNA3.1 vector. As above, each group received 50 µg of CpG/immunization. Compared to the vector-immunized group, the combination of pCMVTF and pCMVbp26 (P = 0.029) showed reduced colonization. These results show that a subunit vaccine for B. melitensis is possible.
|
![]() View larger version (69K): [in a new window] |
FIG. 2. bp26 and TF expression analysis. pICbp26 and pICTF transformed Pichia pastoris in buffered minimal glycerol media were induced by methanol (0.5%) for 24 h to express the recombinant proteins. (A and B) Expression of bp26 (A) and TF (B) was verified by SDS-PAGE (lane 1) and Western blotting with an anti-myc monoclonal antibody (lane 2) showing that bp26 had the expected molecular mass of 29 kDa (26.6 kDa plus myc tag [2.5 kDa]) and TF had the expected molecular mass of 57 kDa (54.5 kDa plus myc tag [2.5 kDa]).
|
![]() View larger version (21K): [in a new window] |
FIG. 3. Immunization with DNA vaccines for bp26 and TF elicits modest serum IgG antibody titers. BALB/c mice (five/group) were i.m. immunized with both pCMVbp26 and pCMVTF plus CpG on days 0, 7, and 14, and serum IgG anti-bp26 and TF titers were measured by standard ELISA methods on weeks 6, 8, and 10. (A) The IgG anti-bp26 titers peaked between weeks 6 and 8 after primary immunization, and (B) IgG anti-TF titers peaked at week 6 after primary immunization, but with less intensity. Control mice immunized with the control vector, pcDNA3.1 plus CpG, failed to elicit antibodies to bp26 or TF. IgG1, IgG2a, and IgG2b anti-bp26 (C) and anti-TF IgG (D) subclass responses were not significantly different. IgG subclass responses were determined using serum samples from week 6.
|
-deficient (IFN-
/) mice (on a BALB/c background) were i.m. immunized with either pCMVbp26 or pCMVTF as described above and, 4 weeks after the last immunization, spleens from individual mice were harvested. Whole splenic cells were cultured with either bp26 or TF for 2 days and then evaluated for IFN-
, IL-4, IL-5, IL-6, and IL-10 secretion by the ELISPOT method (Fig. 4). In BALB/c mice, both bp26 and TF were supported by IFN-
(Fig. 4) compared to unstimulated cultures (P < 0.001 and P = 0.009, respectively). Although TF did not stimulate any other Th2-type cytokines, bp26 produced significant increases in IL-4 (P = 0.020), IL-5 (P = 0.034), and IL-6 (P < 0.001), but not IL-10 (Fig. 4). Since IFN-
/ mice were unable to produce IFN-
, only increases in the measured Th2-type cytokines were observed. Significant increases were observed in IL-4 (P < 0.001 and P = 0.002), IL-5 (P < 0.001), and IL-6 (P < 0.001) after restimulation with bp26 or TF, respectively, compared to unstimulated cultures (Fig. 4). A slight, but significant increase (P = 0.021) in IL-10 was obtained upon restimulation with only TF. The recombinant bp26 and TF proteins failed to stimulate naive lymphocytes (Fig. 4). Differences in the magnitude of the cytokine responses were also observed between IFN-
+/+ and IFN-
/ mice (Fig. 4). Aside from the differences in IFN-
in response to three proteins (P < 0.001), IL-4 was enhanced in IFN-
/ mice against bp26 (P = 0.003) and TF (P < 0.001); IL-5, bp26 (P = 0.002) and TF (P = 0.021); and IL-6, TF (P = 0.015). Thus, these studies confirm that a mixed Th-type response was obtained to bp26 and TF.
![]() View larger version (21K): [in a new window] |
FIG. 4. Serum antibody responses were supported by mixed Th1 and Th2 cells for bp26 and Th1 cells for TF. Whole splenic cells isolated from BALB/c or IFN- / mice immunized with both bp26 and TF were cultured with or without 20 µg of recombinant bp26 or TF for 2 days, and then cells were analyzed for production of IFN- , IL-4, IL-5, IL-6, and IL-10 by the ELISPOT method. In IFN- +/+ mice, IFN- , IL-4, IL-5, and IL-6 were induced against bp26, whereas only IFN- was induced against TF. In the absence of IFN- , the Th2 cytokines compensated, as evidenced by increased production of IL-4, IL-5, and IL-6 upon restimulation with bp26 or TF, and a slight induction of IL-10 was observed against TF only. As a control, naive BALB/c lymphocytes remained unstimulated when cocultured with recombinant bp26 or TF (depicted as dashed line). Thus, IFN- supports antibody responses to both bp26 and TF. The data depict results from five individual mice ± the standard error of the mean, and significant differences were determined between bp26- or TF-restimulated cultures and unstimulated cells: *, P < 0.001; **, P 0.009; ***, P < 0.05.
|
|
|
|---|
7-fold, and this level of protection was significantly enhanced to
20-fold when both DNA vaccines were coadministered. Furthermore, while the use of a lesser dose of the combined vaccines (40 µg of each) did not achieve the level of efficacy with the 150-µg dose, a significant reduction by 6.5-fold in splenic colonization was obtained. Thus, these studies demonstrated the dose dependency of two potential vaccine candidates for B. melitensis and was successfully accomplished without using a live vaccine. The success of the other vaccine candidates showing >0.6-log reduction in splenic colonization may not be viable candidates or may require greater doses of vaccine to show their potential. Studies are currently investigating this possibility. Alternatively, these may perform better in combination with a molecular adjuvant. Studies are currently pursuing the adaptation of the described vaccine candidates coexpressing such molecular adjuvants.
It was previously shown that the Brucella periplasmic protein, bp26, could be used to distinguish vaccinated livestock from naturally infected animals (11, 23, 24). bp26 is highly conserved among B. abortus, B. suis, B. ovis, and B. melitensis (25). Thus, work with this protein has mostly focused on its diagnostic properties in infected livestock and humans (8, 11, 23, 24), but its protective efficacy has yet to be evaluated. In the same vein, to further its diagnostic potential, the bp26 gene of B. abortus S19 vaccine strain was deleted and showed no improved efficacy against wild-type B. abortus challenge in mice (6), suggesting the relevance of other proteins being responsible for stimulating protection against B. abortus. To develop a better test to distinguish vaccinated from naturally infected sheep, a double mutant of B. melitensis Rev1 vaccine was recently developed (7). It was shown that this
bp26
omp31 B. melitensis Rev1 vaccine had the same vaccine efficacy in mice as the parental Rev1 vaccine. Our study is the first to evaluate bp26 as a vaccine candidate as opposed to past studies that mostly concentrated on bp26 as a diagnostic determination of infection. As evidenced from our studies, bp26 does have vaccine potential when combined with TF and possibly other, yet to be defined, vaccine candidates. Our evidence also suggests that bp26 may contribute to protective efficacy against other Brucella serovars.
Based upon sequence homology in E. coli, we identified the Brucella homology for TF. Regarding the function of TF, studies have focused mostly on the E. coli gene. In the E. coli cytosol, a fraction of newly synthesized proteins requires the activity of molecular chaperones for folding to the native state. The major chaperones implicated in this folding process are the ribosome-associated TF and DnaK and GroEL chaperones, with their respective cochaperones (1). TF is an ATP-independent chaperone and displays chaperone and peptidyl-prolyl-cis-trans-isomerase activities in vitro. The positioning of TF at the peptide exit channel, together with its ability to interact with nascent chains as short as 57 residues, renders TF a prime candidate for being the first chaperone that binds to the nascent polypeptide chains. In the present study, TF was revealed for the first time as a protective antigen. As with bp26, the potential protective efficacy in other Brucella spp. species is currently being evaluated.
Interestingly, no preferential bias appeared to exist by the DNA vaccines toward a Th1- or Th2-type response. It was evident here that both IgG1 and IgG2a subclass responses were induced in response to both bp26 and TF. The anti-TF antibody responses were supported by elevated numbers of IFN-
-producing cells but not significantly by elevated levels of IL-4, IL-5, IL-6, or IL-10. However, this does not preclude other Th2-type cytokines, possibly IL-13, which we are currently investigating. Obviously, in the absence of IFN-
, anti-TF antibodies were induced and supported by IL-4, IL-5, IL-6, and possibly other cytokines. In contrast, bp26 induced a mixed Th cell response in which IFN-
, IL-4, IL-5, and IL-6 were induced. It will be interesting to learn whether protection conferred by these Brucella proteins is dependent upon cell-mediated immunity, humoral immunity, or both. Studies are currently pursuing these avenues of research.
From the present study, we learned that the combination of bp26 and TF showed a 20-fold reduction in B. melitensis colonization of BALB/c spleens, resulting in the first evidence of a DNA vaccine capable of rendering this magnitude of protection in the mouse model for B. melitensis. Although we do not suggest that these two vaccine candidates confer complete protection in livestock, their combination with other viable vaccine candidates could potentially enhance the observed protection. Although such additional candidates remain to be discovered, this evidence clearly suggests the potential for developing a subunit vaccine that can circumvent live brucellae usage and thereby minimize infection of livestock and livestock handlers.
The views, opinions, and/or findings contained in this report are those of the authors and should not be construed as an official Department of the Army position, policy, or decision unless so designated by other documentation.
We thank Gary A. Splitter, Department of Animal Health and Biomedical Sciences, University of Wisconsin, for providing us with the cDNA for the Brucella L7/L12 ribosomal protein as a fusion construct. We thank Massimo Maddaloni for his advice on constructing and expression of bp26 and TF proteins in Pichia pastoris and Deanne Stookey and Amy Robison for technical assistance. We also thank Nancy Kommers for assistance in preparing the manuscript.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»