Previous Article | Next Article 
Infection and Immunity, November 2005, p. 7541-7547, Vol. 73, No. 11
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.11.7541-7547.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Invariant NKT Cells Are Essential for the Regulation of Hepatic CXCL10 Gene Expression during Leishmania donovani Infection
Mattias Svensson,1,
Soombul Zubairi,1,
Asher Maroof,1,
Fatima Kazi,1
Masaru Taniguchi,2 and
Paul M. Kaye1*
Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT, United Kingdom,1
RIKEN Research Center for Allergy and Immunology, Laboratory for Immune Regulation, Tsurumi, Yokohama 230-0045, Japan2
Received 8 June 2005/
Returned for modification 20 July 2005/
Accepted 25 July 2005
 |
ABSTRACT
|
|---|
Gamma interferon (IFN-
)-regulated chemokines of the CXC family have been implicated as key regulators of a variety of T-cell-dependent inflammatory processes. However, the cellular source(s) of IFN-
that regulates their early expression has rarely been defined. Here, we have directly addressed this question in mice after Leishmania donovani infection. Comparison of CXCL10 mRNA accumulation in normal and IFN-
-deficient mice confirmed an absolute requirement for IFN-
for sustained (24 h) expression of CXCL10 mRNA accumulation in this model. In normal mice, IFN-
was produced by both CD3int NK1.1+ NKT cells and CD3 NK1.1+ NK cells, as detected by intracellular flow cytometry. Strikingly, B6.J
281/ mice lacking NKT cells that express the invariant V
14J
18 T-cell-receptor
chain, although retaining a significant population of IFN-
-producing NK cells and NKT cells, were unable to sustain CXCL10 mRNA accumulation. These data indicate that invariant NKT cells are indispensable for the regulation of hepatic CXCL10 gene expression during L. donovani infection.
 |
INTRODUCTION
|
|---|
The chemokines represent a large family of chemoattractant cytokines involved in multiple aspects of immunity. Chemokines are low-molecular-mass (8- to 11-kDa) polypeptides placed into one of four families (CXC, CC, C, and CX3C) depending upon the position of the first two of four conserved cysteine residues in their N termini (reviewed in references 24 and 30). Chemokines are recognized by cell surface-expressed, seven-transmembrane domain, G-protein-coupled receptors. Although redundancy is a hallmark of many chemokine-mediated events, there is nevertheless a degree of cell and tissue specificity associated with both chemokine and chemokine receptor expression. Thus, CXCR2 has a major role in neutrophil recruitment mediated by CXCL1 and CXCL2 (6), whereas monocytes express CCR2 and respond to CCL2 (29). A variety of stimuli are known to regulate chemokine gene expression and protein production, including ligation of cell surface receptors involved in phagocytosis such as the mannose receptor (8), various Toll-like receptors (TLRs) including TLR-2, TLR-4, and TLR-5 (38, 41, 48), and, directly or indirectly, a variety of cytokines expressed early during inflammation, including the interferons (IFNs) interleukin-1
/ß (IL-1
/ß) and IL-6 (34, 35). Furthermore, a group of chemokines particularly involved in the regulation of T-cell migration are regulated by IFN-
. These IFN-
-regulated CXC chemokines include monokine induced by IFN-
(Mig; CXCL9), interferon-induced protein of 10 kDa (IP10; CXCL10), and interferon-inducible T-cell
chemoattractant (I-TAC; CXCL11) (10, 11, 28, 32). Consistent with regulation by IFN-
, CXCL10 gene expression is regulated by the IFN regulatory factor family of transcription factors and by NF-
B, and the CXCL10 gene promoter contains typical ISRE and NF-
B motifs (12, 36, 46, 50). IFN-
-independent regulation of CXCL10 has also been reported (18, 26, 37). For example, murine peritoneal macrophages are stimulated to accumulate CXCL10 mRNA following exposure to lipid A by a pathway that requires TLR-4 but not Myd88 (26).
Protozoan parasites of the genus Leishmania are well known for their relatively silent entry into host macrophages and dendritic cells (43). Nevertheless, chemokine production represents one of the earliest outcomes of infection both in vitro and in vivo. For example, in vitro infection of macrophages with Leishmania major was followed by expression of CCL2 and CXCL1 (39); injection of L. major into an air pouch rapidly induced mRNA accumulation for CCL2, CCL3, CCL5, and CXCL10, among others (33); and preferential induction of CXCL1, CXCL10, and CCL2 was observed in the draining lymph nodes of L. major-resistant mice (53). Following infection with Leishmania donovani, which causes a visceral rather than cutaneous form of leishmaniasis, hepatic mRNAs for CXCL10, CCL2, and CCL3 were all increased in abundance by 5 h postinfection (p.i.), and the observation that the early induction profile of these chemokines was identical in both BALB/c mice and SCID mice suggested that their initial induction occurred in a T-cell-independent manner (9). In both BALB/c and SCID mice, CCL2 and CCL3 mRNA accumulation was transient and had receded to baseline levels by 24 h p.i. In contrast, CXCL10 mRNA accumulation was sustained at elevated levels for more than 24 h p.i. in BALB/c mice but not in SCID mice (9), suggesting a critical role for hepatic lymphocytes in promoting CXCL10 expression. However, neither the requirement for IFN-
for CXCL10 regulation nor the potential source(s) of this IFN-
was determined in those previous studies.
In this study, we demonstrate that IFN-
is critical for the sustained accumulation of CXCL10 mRNA following L. donovani infection and show that resident hepatic NK cells as well as NKT cells expressing the invariant V
14J
18 T-cell-receptor (TCR)
chain (invariant NKT [iNKT]) and NKT cells with other diverse TCRs (diverse NKT [dNKT]) are activated for IFN-
production within 24 h of L. donovani infection. Strikingly, although V
14 NKT-cell-deficient mice retain IFN-
-producing NK cells and dNKT cells, these mice are unable to sustain the accumulation of CXCL10 mRNA that is seen in infected wild-type mice. Our results illustrate that hepatic iNKT-cell activation is a feature of L. donovani infection that appears to be indispensable for the efficient regulation of CXCL10.
 |
MATERIALS AND METHODS
|
|---|
Mice and infections.
C57BL/6 (B6), B6.RAG1/, and B6.IFN
/ mice were bred at the London School of Hygiene and Tropical Medicine. iNKT-cell-deficient (B6.J
281/) mice were obtained from a breeding colony maintained at the University of Oxford. Mice were used at 6 to 10 weeks of age and housed under conventional conditions with food and water ad libitum. Parasites of the Ethiopian strain of Leishmania donovani (LV9) were maintained by serial passage in Syrian hamsters. Amastigotes were isolated from infected spleens, as previously described (16), and mice were infected with 2 x 107 L. donovani amastigotes intravenously in 200 µl of RPMI 1640 medium (Invitrogen, Paisley, United Kingdom). Mice were killed 5 or 24 h p.i by CO2 inhalation. Livers were perfused via the portal vein with ice-cold perfusion buffer (phosphate-buffered saline, 0.5 mM EDTA, 5 mM glucose), and tissue was collected for mononuclear cell preparations or stored in RNAlater (Ambion) at 20°C for subsequent extractions of total RNA. All animal care and experimental procedures were approved by the London School of Hygiene and Tropical Medicine Animal Procedures and Ethics Committee and were conducted in accord with United Kingdom Home Office requirements.
Hepatic mononuclear cell isolation.
Following perfusion, the liver was cut into small pieces, and liver tissue was digested under constant rotation in RPMI medium containing 0.5 mg/ml of collagenase (Worthington Biochemical, Lakewood, NJ) and 0.5 mg/ml of DNase I (Lorne Laboratories, Reading, United Kingdom) at room temperature for 45 min. Digested tissue was passed through a 100-µm cell strainer (BD Biosciences, Mountain View, CA) and washed twice at 200 x g for 10 min at room temperature. The pellet was resuspended in 4 ml of 40% Percoll (Sigma), and mononuclear cells were isolated by layering over 4 ml of 70% Percoll. Mononuclear cells were collected at the interface of the Percoll gradient and were washed twice in RPMI medium. Remaining red blood cells were lysed using Gey's solution, and cells were washed, counted, and used directly for flow cytometry analysis or cultured in vitro prior to intracellular cytokine stainings. For in vitro cultures, cells were resuspended in RPMI medium (50 µM 2-mercaptoethanol, 100 U/ml penicillin, 100g/ml streptomycin [all from Invitrogen], 1 mM sodium pyruvate, 2 mM L-glutamine [both from Sigma-Aldrich, Poole, United Kingdom]) supplemented with 5% fetal calf serum (Sigma-Aldrich) and 10 µg/ml of brefeldin A (Sigma), and cells were then seeded in 24-well plates (TPP, Trasadingen, Switzerland) and cultured for 3 h.
RNA extraction and real-time RT-PCR.
Extraction of total RNA was performed using the RNeasy mini kit (QIAGEN, Crawley, United Kingdom) according to the manufacturer's protocol. Briefly, liver tissue was homogenized under liquid nitrogen, and homogenized tissue was transferred into RNase/DNase-free microcentrifuge tubes and placed on ice and lysis buffer was added. The lysate was passed over a Qiashredder spin column, and the cleared lysate was transferred to a clean microcentrifuge tube. The cleared lysate was mixed with 70% ethanol and then applied to an RNeasy Mini column. The RNA was eluted in RNase-free water. Quantification of RNA was performed using the Ribogreen quantification kit (Molecular Probes, OR) according to the manufacturer's protocol. RNA was converted into cDNA by reverse transcription (RT) using a cDNA synthesis kit (Invitrogen) with an oligo(dT)20 primer and SuperScript III reverse transcriptase according to the manufacturers' instructions. Quantification of cDNA was performed using the Picogreen quantification kit (Molecular Probes, OR) according to the manufacturer's protocol. Cytokine mRNA was quantified using real-time RT-PCR. Oligonucleotides (5'
3') used for specific amplification of CXCL10 were CACGTGTTGAGATCATTGC (sense) and TAAGGAGCCCTTTTGACC (antisense), and those used for amplification of the housekeeping gene hypoxanthine phosphoribosyltransferase (HPRT) were GTTGGATACAGGCCAGACTTTGTTG (sense) and GATTCAACCTTGCGCTCATCTTAGGC (antisense). For detection of CXCL10, HPRT samples were amplified under the following conditions: 15 seconds of denaturation at 95°C, 30 seconds of annealing at 62°C (CXCL10) or 53°C (HPRT), and 30 seconds of extension at 72°C (repeated 40 cycles). The number of CXCL10 and HPRT cDNAs in each samples was calculated by real-time reverse transcription-PCR using a QuantiTect SYBR green master mix (QIAGEN) and a LightCycler (Applied Biosystems, Warrington, United Kingdom) according to the manufacturer's instructions. Standard curves were constructed with known amounts of CXCL10 and HPRT cDNA, and the number of CXCL10 molecules per 1,000 HPRT molecules in each sample was calculated.
Flow cytometry and intracellular cytokine detection.
For flow cytometry, cells were incubated with 10 µg/ml 2.4G2 anti-Fc receptor monoclonal antibody (ATCC, Rockville, MD) followed by staining with directly conjugated monoclonal antibodies. Cells were stained with fluorescein isothiocyanate-conjugated anti-CD4 (clone CT-CD4; Caltag Laboratories, Burlingame, CA) or anti-CD8 (clone 53-6.7) antibodies, phycoerythrin-conjugated anti-NK1.1 (clone PK136) antibody, and biotinylated anti-CD3 (clone 145.2C11) antibody (all from BD Pharmingen, San Diego, CA). Labeling with biotinylated antibodies was visualized with PerCP-streptavidin (BD Pharmingen). Minimal background staining was observed using control fluorescein isothiocyanate-conjugated and phycoerythrin-conjugated mouse and rat immunoglobulin G2a (IgG2a) and IgG2b antibodies and a biotinylated hamster IgG antibody (all from BD Pharmingen). Surface staining was performed on ice in Hanks' balanced salt solution (HBSS; Gibco) containing 2% fetal calf serum, 5 mM EDTA, and 0.01% sodium azide for 20 min. Intracellular IFN-
cytokine staining was performed in the dark at room temperature. Cells were fixed for 30 min in 2% paraformaldehyde followed by permeabilization for 30 min in HBSS containing 0.5% saponin and 0.5% bovine serum albumin. Subsequently, cells were stained with APC-conjugated anti-IFN-
antibody (clone XMG1.2; BD Pharmingen) in HBSS containing 0.5% saponin and 0.5% bovine serum albumin for 45 min. Minimal background staining was observed using control allophycocyanin (APC)-conjugated rat IgG1 antibody (BD Pharmingen). Flow cytometry analysis was performed with a FACSCalibur (BD Biosciences, Mountain View, CA) on 200,000 cells and analyzed using CellQuest software (BD Biosciences).
Statistical analysis.
All mice were examined individually in each experiment (n = 4 to 6 mice per time point/strain), and data were analyzed using Student's t test. A P value of <0.05 was considered significant. All experiments have been repeated at least twice with similar results.
 |
RESULTS
|
|---|
CXCL10 mRNA accumulation in response to L. donovani infection.
We had previously shown, using semiquantitative RT-PCR, that CXCL10 mRNA accumulation was significantly elevated in the livers of BALB/c mice but not BALB.SCID mice 24 h after infection with L. donovani (9). In order to confirm these observations in mice on the B6 background and using more quantitative methods, we infected B6 and B6.RAG1/ mice with L. donovani and measured liver mRNA accumulation using real-time RT-PCR. As shown in Fig. 1A, CXCL10 mRNA accumulation was observed in B6 but not B6.RAG1/ mice. As both IFN-
as well as other stimuli can lead to the expression of CXCL10 (26), we next determined whether CXCL10 expression was IFN-
dependent in this model. As shown in Fig. 1B, increased CXCL10 mRNA accumulation resulting from L. donovani infection was only observed in B6 mice and not in B6.IFN
/ mice. Thus, elevated CXCL10 gene expression at 24 h p.i. requires both IFN-
and the participation of cells expressing rearranged antigen receptors.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1. Hepatic CXCL10 mRNA accumulation after L. donovani infection. (A) C57BL/6 and B6.RAG1/ mice (n = 4 to 6) were infected with 2 x 107 L. donovani amastigotes, and 24 h later, hepatic CXCL10 mRNA accumulation was compared between naïve (open bars) and infected (black bars) mice. (B) C57BL/6 and B6.IFN / mice were infected as described above, and 24 h later, hepatic CXCL10 mRNA accumulation was compared between naïve (open bars) and infected (black bars) mice. Data represent numbers of CXCL10 mRNA molecules relative to HPRT. Significance was determined using Student's t test, and P values are as indicated. n.s, not significant.
|
|
Both NK and NKT cells are sources of hepatic IFN-
.
Next, we performed a series of experiments to determine the cellular source(s) of IFN-
that might be responsible for the accumulation of CXCL10 mRNA at this early stage of hepatic L. donovani infection. As shown in Fig. 2A, both NK1.1+ CD3 NK cells and NK1.1+ CD3int NKT cells are readily detectable in the liver of naïve mice, representing 12.0% ± 1.2% and 10.2% ± 0.9% of hepatic mononuclear cells, respectively (n = 12 to 15 mice). To determine whether these cells made IFN-
, hepatic mononuclear cells were isolated from control and infected mice and analyzed directly ex vivo for the expression of IFN-
by intracellular flow cytometry (Fig. 2B to D). In naïve mice, approximately 4% of NKT cells and 1.5% of NK cells spontaneously produced IFN-
. At 5 h p.i., there was no significant increase in the frequency of either NK or NKT cells expressing IFN-
. However, by 24 h p.i., the frequency of IFN-
+ NK cells (3.9% ± 0.7%; P < 0.007) and IFN-
+ NKT cells (9.7% ± 1.2%; P < 0.02) was significantly increased in comparison to naïve mice (Fig. 2C and D). As determined by flow cytometry, there appeared to be little difference in the level of expression of IFN-
by NK and NKT cells (Fig. 2B). These data confirm that L. donovani infection does indeed activate a cytokine response from hepatic NKT cells (1) as well as formally demonstrate IFN-
production by NK cells in normal mice.
NKT-cell activation has often been associated with a loss of detectable NKT cells in the tissues, as the result of either activation-induced apoptosis (15) or down-regulation of the V
14 receptor (22) commonly used to identify this population of cells. As either of these events might have lead to an underestimate of the numbers of NKT cells producing IFN-
, we enumerated NK and NKT cells in the livers of control and L. donovani-infected mice. The total number of recoverable hepatic mononuclear cells did not alter significantly in the first 24 h of L. donovani infection (data not shown). Furthermore, neither the frequency nor the absolute number of NKT cells (Fig. 3A and B) or NK cells (Fig. 3C and D) was significantly altered at this early stage of infection. These data demonstrate that unlike NKT-cell activation mediated by alpha-galactosylceramide (
GalCer) (25), little if any loss of detectable hepatic NKT cells occurs as an immediate consequence of L. donovani infection.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3. L. donovani infection does not alter the frequency or number of hepatic NKT and NK cells. C57BL/6 mice (n = 4 to 6) were infected with 2 x 107 L. donovani amastigotes, and 24 h later, the frequency (A) and absolute number (B) of hepatic NKT cells and the frequency (C) and absolute number (D) of NK cells determined by flow cytometry (as described in the legend of Fig. 2A) were compared between naïve (open bars) and infected (black bars) mice. Significance was determined using Student's t test. n.s., not significant.
|
|
IFN-
production in L. donovani-infected V
14 NKT-cell-deficient mice.
Our results indicated that both NK and NKT cells could produce IFN-
rapidly after infection but did not demonstrate whether IFN-
secretion by both populations had similar functional importance in terms of CXCL10 gene expression. Furthermore, NKT cells can be subdivided into subsets on the basis of TCR usage, with V
14J
18TCR iNKT cells comprising the predominant hepatic NKT population (45). We therefore examined L. donovani infection in iNKT cell-deficient B6.J
281/ mice. As shown in Fig. 4, B6.J
281/ mice had a markedly reduced number of NKT cells compared to B6 mice, although a small residual population of CD3int NK1.1+ NKT cells (dNKT) was clearly visible (15,800 ± 2,000 versus 43,400 ± 8,300 in B6.J
281/ and B6 mice, respectively; n = 5, P < 0.01). In contrast, NK cells in these mice were found in greater frequency compared to B6 mice (19.7% ± 0.7% versus 12.3% ± 1.7% in B6.J
281/ and B6 mice, respectively; n = 5, P < 0.01).
We then examined ex vivo IFN-
production in these mice (Fig. 5). A comparison of the frequency and absolute number of IFN-
+ NKT cells and NK cells in B6 and B6.J
281/ mice indicated that (i) dNKT cells found in V
14 NKT-cell-deficient mice could also make IFN-
following L. donovani infection, but the total number of IFN-
+ NKT cells in the liver of these mice was reduced by 50% compared to that seen in infected B6 mice (Fig. 5A and B), and (ii) NK cells retained the capacity to produce IFN-
in the absence of iNKT cells, with the number of hepatic IFN-
+ NK cells in infected B6 and B6.J
281/ mice being equivalent (Fig. 5C and D).
Regulation of CXCL10 mRNA accumulation in V
14 NKT-cell-deficient mice.
The above-described analysis indicated that IFN-
was produced by multiple cellular sources during the early stages of infection with L. donovani, including conventional NK cells, iNKT cells, and dNKT cells. In order to determine whether a selective deficiency in iNKT cells would affect the accumulation of CXCL10 mRNA during infection, we quantified the accumulation of CXCL10 mRNA in naïve and infected B6 and B6.J
281/ mice. As shown in Fig. 6, iNKT cell-deficient mice showed a striking failure to respond to infection with accumulation of CXCL10 mRNA. To rule out the possibility that iNKT cells were themselves a source of CXCL10, we sorted NKT cells from the liver of naïve mice and mice after 24 h of infection and analyzed them directly for CXCL10 mRNA accumulation. L. donovani-induced CXCL10 mRNA accumulation was not observed in sorted NKT cells (fluorescence-activated cell sorter analysis on CD3+ NK1.1+) but was readily observed within the residual NK1.1 population (data not shown). Thus, although other cellular sources of IFN-
persist in iNKT-cell-deficient mice, iNKT cells appear to play a critical role in regulating CXCL10 gene expression.
 |
DISCUSSION
|
|---|
IFN-
-regulated chemokines have well-described properties in immune regulation, notably in tissues undergoing Th1 type inflammation (10, 31, 52). However, little is known about the cellular requirements for the regulation of these chemokines in vivo. In this paper, in addition to defining that NK, iNKT, and dNKT cells produce IFN-
after L. donovani infection, we demonstrate that in the absence of iNKT cells, IFN-
from dNKT cells and from NK cells is insufficient to drive the sustained expression of CXCL10.
Data from a variety of in vitro and in vivo sources indicate that chemokine expression is one of the few signatures of macrophages and dendritic cells infected with Leishmania parasites, contrasting with the very reduced, or absence of, proinflammatory cytokine production (43). However, little is known of the mechanisms by which these various chemokines are regulated. By comparing the response of B6 and B6.IFN
/ mice, we have now shown that IFN-
production is essential for the sustained accumulation of CXCL10 mRNA. Thus, while initial regulation of CXCL10, as well as that of CCL2 and CCL3, may occur through other perhaps more direct means, a cellular source of IFN-
is an essential component of the early CXCL10 response to infection in vivo. In previous studies, we had, however, shown that L. donovani was a poor activator of NK cells, at least as measured using cells derived from SCID mice (27). Nevertheless, normal mice do express IFN-
rapidly, consistent with an innate source of this cytokine (16). The second major outcome of this study, therefore, is that we have now directly demonstrated that NK cells produce IFN-
following hepatic infection with L. donovani. The contrast between these results and those obtained previously suggests that NK-cell IFN-
production also requires the participation of a third-party cell, absent in both SCID (27) and RAG1/ (this study) mice.
In addition to identifying NK cells as an early source of IFN-
, we demonstrate that hepatic NKT cells, including both the dominant iNKT as well as dNKT subsets, actively produce IFN-
after L. donovani infection. Indeed, quantitatively, there are similar numbers of IFN-
+ NKT cells as there are IFN-
+ NK cells (a little under 5,000 of each population per liver at 24 h p.i.). IFN-
production by iNKT cells has previously been shown following injection of L. donovani or lipophosphoglycan (LPG) (1), and a previous report using J
281/ mice indicated that iNKT cells may play a late-acting regulatory role during infection with L. major (23). Following
GalCer treatment, NKT cells have been shown to be dramatically reduced in number in target tissues. Although this loss of NKT cells had previously been thought to reflect cell death by apoptosis, more recent studies suggest that this might be an artifact of
GalCer-mediated down-regulation of the NKT cell receptor (22, 42). Although we cannot rule out, due to intermouse variation, that we may not have been able to detect the loss of a small fraction of activated NKT cells, it is nonetheless clear that L. donovani infection does not lead to any gross alteration of the number of hepatic NKT cells.
Although the major defined ligand for iNKT cells is
GalCer (45), other candidate antigens which might be presented by CD1d have been identified from a variety of pathogens, including the mycobacterial phosphatidylinositol mannosides (3), glycolipids derived from Yersinia (51), and protozoal (including Leishmania) glycophosphatidylinositol (14, 20, 21). More recently, both L. donovani LPG and glycoinositolphospholipids have been identified as low-affinity (compared to
GalCer) ligands of CD1d. CD1d/ mice show decreased resistance to L. donovani infection, and LPG injection in vivo induces a small (
1.5%) subset of iNKT to produce IFN-
(1). It is noteworthy that amastigotes, as used here, do not express LPG, suggesting that glycoinositolphospholipids may be the physiological ligand in our model. Murine Kupffer cells, hepatocytes, and hepatic dendritic cells all express CD1d (4, 5, 13, 47), providing the opportunity for presentation of CD1 ligands derived from L. donovani. However, recent in vitro studies have indicated that L. donovani infection can down-regulate the expression of CD1d on human monocyte-derived dendritic cells (2), suggesting that infected cells may not be efficient at presenting to CD1d-restricted NKT cells. Alternatively, the known capacity of NKT cells to rapidly respond to activation by cytokines, notably IL-12, may provide an alternate activation pathway independent of CD1d-restricted presentation of novel pathogen antigens (45). However, in this context, L. donovani has been shown to infect macrophages without triggering IL-12p40 secretion (19), and there is little detectable IL-12p40 in the liver at these early times (16). Further studies to define the mechanism of NKT-cell activation in this model are clearly warranted.
Our data also allow some comment on the subject of cross-regulation of NKT-cell and NK-cell responses. In
GalCer-treated mice, NKT cells provide a source of IFN-
that is essential for the production of IFN-
by NK cells and for their effector function (7). Thus, V
14 NKT-cell-deficient mice have reduced expression of IFN-
by NK cells following IL-12 administration compared to normal mice (44). In L. donovani infection, the cross-regulation of these populations appears different. While NK cells in SCID and RAG/ mice are unable to produce IFN-
after L. donovani infection (27), this does not appear to be the result of a loss of IFN-
production by iNKT cells, since NK responses are intact in their absence in iNKT-cell-deficient mice. It remains possible that dNKT cells found in iNKT-deficient mice provide cross-regulation of NK cell function, and this awaits confirmation in CD1d/ mice. It is also of interest that CXCL10 has been shown to regulate NK-cell effector function (40, 49), but our finding that NK-cell IFN-
responses are intact in iNKT-cell-deficient mice that fail to sustain CXCL10 expression also suggests that this pathway of NK-cell activation is not of major significance here.
Finally, our data appear to indicate that an early hepatic IFN-
response is not per se sufficient to regulate CXCL10 expression. Rather, even with NK cells and dNKT cells, which together combine to provide 75% of the total number of IFN-
-producing cells found in wild-type mice, iNKT-cell-deficient mice still fail to sustain CXCL10 mRNA accumulation. We are currently considering two possibilities to account for this striking dependence on iNKT cells. One possibility is that cellular interactions between iNKT cells and those cells which make CXCL10 are essential to provide a locally high concentration of IFN-
. This model would presuppose that such interactions do not occur with NK cells or other dNKT cells and assumes a cognate interaction. Alternatively, or in addition, the regulation of CXCL10 by IFN-
may require second signals involving as-yet-undefined cellular or soluble receptor-ligand interactions between those cells producing CXCL10 and the iNKT cells that regulate them. In this context, it is of interest that CD40L expression on iNKT cells has recently been implicated in interactions between iNKT cells and dendritic cells that are essential for effective cellular immunity (17) and that dendritic cells, at least in the hepatic lymph node, are a potent source of CXCL10 (52).
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by grants from the British Medical Research Council and The Wellcome Trust and by a fellowship from the Swedish Foundation for International Cooperation in Research and Higher Education (to M.S.).
 |
FOOTNOTES
|
|---|
* Corresponding author. Present address: Immunology and Infection Unit, Department of Biology, University of York, Heslington, York YO10 5YW, United Kingdom. Phone: 441904328840. Fax: 44190432844. E-mail: pmk2{at}york.ac.uk. 
Editor: W. A. Petri, Jr.
Present address: Center for Infectious Medicine, Department of Medicine, F59, Karolinska Institutet, Karolinska University Hospital, Huddinge, 14186 Stockholm, Sweden. 
Present address: Immunology and Infection Unit, Department of Biology, University of York, Heslington, York YO10 5YW, United Kingdom. 
 |
REFERENCES
|
|---|
| 1. | Amprey, J. L., J. S. Im, S. J. Turco, H. W. Murray, P. A. Illarionov, G. S. Besra, S. A. Porcelli, and G. F. Spath. 2004. A subset of liver NK T cells is activated during Leishmania donovani infection by CD1d-bound lipophosphoglycan. J. Exp. Med. 200:895-904.[Abstract/Free Full Text] |
| 2. | Amprey, J. L., G. F. Spath, and S. A. Porcelli. 2004. Inhibition of CD1 expression in human dendritic cells during intracellular infection with Leishmania donovani. Infect. Immun. 72:589-592.[Abstract/Free Full Text] |
| 3. | Apostolou, I., Y. Takahama, C. Belmant, T. Kawano, M. Huerre, G. Marchal, J. Cui, M. Taniguchi, H. Nakauchi, J. J. Fournie, P. Kourilsky, and G. Gachelin. 1999. Murine natural killer T(NKT) cells [correction of natural killer cells] contribute to the granulomatous reaction caused by mycobacterial cell walls. Proc. Natl. Acad. Sci. USA 96:5141-5146.[Abstract/Free Full Text] |
| 4. | Blumberg, R. S., D. Gerdes, A. Chott, S. A. Porcelli, and S. P. Balk. 1995. Structure and function of the CD1 family of MHC-like cell surface proteins. Immunol. Rev. 147:5-29.[CrossRef][Medline] |
| 5. | Brigl, M., and M. B. Brenner. 2004. CD1: antigen presentation and T cell function. Annu. Rev. Immunol. 22:817-890.[CrossRef][Medline] |
| 6. | Cacalano, G., J. Lee, K. Kikly, A. M. Ryan, S. Pitts-Meek, B. Hultgren, W. I. Wood, and M. W. Moore. 1994. Neutrophil and B cell expansion in mice that lack the murine IL-8 receptor homolog. Science 265:682-684.[Abstract/Free Full Text] |
| 7. | Carnaud, C., D. Lee, O. Donnars, S. H. Park, A. Beavis, Y. Koezuka, and A. Bendelac. 1999. Cutting edge: cross-talk between cells of the innate immune system: NKT cells rapidly activate NK cells. J. Immunol. 163:4647-4650.[Abstract/Free Full Text] |
| 8. | Chieppa, M., G. Bianchi, A. Doni, A. Del Prete, M. Sironi, G. Laskarin, P. Monti, L. Piemonti, A. Biondi, A. Mantovani, M. Introna, and P. Allavena. 2003. Cross-linking of the mannose receptor on monocyte-derived dendritic cells activates an anti-inflammatory immunosuppressive program. J. Immunol. 171:4552-4560.[Abstract/Free Full Text] |
| 9. | Cotterell, S. E., C. R. Engwerda, and P. M. Kaye. 1999. Leishmania donovani infection initiates T cell-independent chemokine responses, which are subsequently amplified in a T cell-dependent manner. Eur. J. Immunol. 29:203-214.[CrossRef][Medline] |
| 10. | Cyster, J. G. 1999. Chemokines and cell migration in secondary lymphoid organs. Science 286:2098-2102.[Abstract/Free Full Text] |
| 11. | Cyster, J. G. 2003. Lymphoid organ development and cell migration. Immunol. Rev. 195:5-14.[CrossRef][Medline] |
| 12. | Deng, W., Y. Ohmori, and T. A. Hamilton. 1994. Mechanisms of IL-4-mediated suppression of IP-10 gene expression in murine macrophages. J. Immunol. 153:2130-2136.[Abstract] |
| 13. | Dory, D., H. Echchannaoui, M. Letiembre, F. Ferracin, J. Pieters, Y. Adachi, S. Akashi, W. Zimmerli, and R. Landmann. 2003. Generation and functional characterization of a clonal murine periportal Kupffer cell line from H-2Kb-tsA58 mice. J. Leukoc. Biol. 74:49-59.[Abstract/Free Full Text] |
| 14. | Duthie, M. S., M. Wleklinski-Lee, S. Smith, T. Nakayama, M. Taniguchi, and S. J. Kahn. 2002. During Trypanosoma cruzi infection CD1d-restricted NK T cells limit parasitemia and augment the antibody response to a glycophosphoinositol-modified surface protein. Infect. Immun. 70:36-48.[Abstract/Free Full Text] |
| 15. | Eberl, G., and H. R. MacDonald. 1998. Rapid death and regeneration of NKT cells in anti-CD3epsilon- or IL-12-treated mice: a major role for bone marrow in NKT cell homeostasis. Immunity 9:345-353.[CrossRef][Medline] |
| 16. | Engwerda, C. R., S. C. Smelt, and P. M. Kaye. 1996. An in vivo analysis of cytokine production during Leishmania donovani infection in scid mice. Exp. Parasitol. 84:195-202.[CrossRef][Medline] |
| 17. | Fujii, S., K. Liu, C. Smith, A. J. Bonito, and R. M. Steinman. 2004. The linkage of innate to adaptive immunity via maturing dendritic cells in vivo requires CD40 ligation in addition to antigen presentation and CD80/86 costimulation. J. Exp. Med. 199:1607-1618.[Abstract/Free Full Text] |
| 18. | Gasper, N. A., C. C. Petty, L. W. Schrum, I. Marriott, and K. L. Bost. 2002. Bacterium-induced CXCL10 secretion by osteoblasts can be mediated in part through Toll-like receptor 4. Infect. Immun. 70:4075-4082.[Abstract/Free Full Text] |
| 19. | Gorak, P. M., C. R. Engwerda, and P. M. Kaye. 1998. Dendritic cells, but not macrophages, produce IL-12 immediately following Leishmania donovani infection. Eur. J. Immunol. 28:687-695.[CrossRef][Medline] |
| 20. | Hansen, D. S., and L. Schofield. 2004. Regulation of immunity and pathogenesis in infectious diseases by CD1d-restricted NKT cells. Int. J. Parasitol. 34:15-25.[CrossRef][Medline] |
| 21. | Hansen, D. S., M. A. Siomos, L. Buckingham, A. A. Scalzo, and L. Schofield. 2003. Regulation of murine cerebral malaria pathogenesis by CD1d-restricted NKT cells and the natural killer complex. Immunity 18:391-402.[CrossRef][Medline] |
| 22. | Harada, M., K. Seino, H. Wakao, S. Sakata, Y. Ishizuka, T. Ito, S. Kojo, T. Nakayama, and M. Taniguchi. 2004. Down-regulation of the invariant Valpha14 antigen receptor in NKT cells upon activation. Int. Immunol. 16:241-247.[Abstract/Free Full Text] |
| 23. | Ishikawa, H., H. Hisaeda, M. Taniguchi, T. Nakayama, T. Sakai, Y. Maekawa, Y. Nakano, M. Zhang, T. Zhang, M. Nishitani, M. Takashima, and K. Himeno. 2000. CD4(+) v(alpha)14 NKT cells play a crucial role in an early stage of protective immunity against infection with Leishmania major. Int. Immunol. 12:1267-1274.[Abstract/Free Full Text] |
| 24. | IUIS/WHO Subcommittee on Chemokine Nomenclature. 2003. Chemokine/chemokine receptor nomenclature. Cytokine 21:48-49.[CrossRef][Medline] |
| 25. | Kakimi, K., L. G. Guidotti, Y. Koezuka, and F. V. Chisari. 2000. Natural killer T cell activation inhibits hepatitis B virus replication in vivo. J. Exp. Med. 192:921-930.[Abstract/Free Full Text] |
| 26. | Kawai, T., O. Takeuchi, T. Fujita, J. Inoue, P. F. Muhlradt, S. Sato, K. Hoshino, and S. Akira. 2001. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J. Immunol. 167:5887-5894.[Abstract/Free Full Text] |
| 27. | Kaye, P. M., and G. J. Bancroft. 1992. Leishmania donovani infection in scid mice: lack of tissue response and in vivo macrophage activation correlates with failure to trigger natural killer cell-derived gamma interferon production in vitro. Infect. Immun. 60:4335-4342.[Abstract/Free Full Text] |
| 28. | Khan, I. A., J. A. MacLean, F. S. Lee, L. Casciotti, E. DeHaan, J. D. Schwartzman, and A. D. Luster. 2000. IP-10 is critical for effector T cell trafficking and host survival in Toxoplasma gondii infection. Immunity 12:483-494.[CrossRef][Medline] |
| 29. | Lu, B., B. J. Rutledge, L. Gu, J. Fiorillo, N. W. Lukacs, S. L. Kunkel, R. North, C. Gerard, and B. J. Rollins. 1998. Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice. J. Exp. Med. 187:601-608.[Abstract/Free Full Text] |
| 30. | Luster, A. D. 1998. Chemokineschemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338:436-445.[Free Full Text] |
| 31. | Luster, A. D. 2002. The role of chemokines in linking innate and adaptive immunity. Curr. Opin. Immunol. 14:129-135.[CrossRef][Medline] |
| 32. | Luster, A. D., and J. V. Ravetch. 1987. Genomic characterization of a gamma-interferon-inducible gene (IP-10) and identification of an interferon-inducible hypersensitive site. Mol. Cell. Biol. 7:3723-3731.[Abstract/Free Full Text] |
| 33. | Matte, C., and M. Olivier. 2002. Leishmania-induced cellular recruitment during the early inflammatory response: modulation of proinflammatory mediators. J. Infect. Dis. 185:673-681.[CrossRef][Medline] |
| 34. | McLoughlin, R. M., S. M. Hurst, M. A. Nowell, D. A. Harris, S. Horiuchi, L. W. Morgan, T. S. Wilkinson, N. Yamamoto, N. Topley, and S. A. Jones. 2004. Differential regulation of neutrophil-activating chemokines by IL-6 and its soluble receptor isoforms. J. Immunol. 172:5676-5683.[Abstract/Free Full Text] |
| 35. | Nakae, S., Y. Komiyama, S. Narumi, K. Sudo, R. Horai, Y. Tagawa, K. Sekikawa, K. Matsushima, M. Asano, and Y. Iwakura. 2003. IL-1-induced tumor necrosis factor-alpha elicits inflammatory cell infiltration in the skin by inducing IFN-gamma-inducible protein 10 in the elicitation phase of the contact hypersensitivity response. Int. Immunol. 15:251-260.[Abstract/Free Full Text] |
| 36. | Ohmori, Y., and T. A. Hamilton. 1995. The interferon-stimulated response element and a kappa B site mediate synergistic induction of murine IP-10 gene transcription by IFN-gamma and TNF-alpha. J. Immunol. 154:5235-5244.[Abstract] |
| 37. | Perera, P. Y., T. N. Mayadas, O. Takeuchi, S. Akira, M. Zaks-Zilberman, S. M. Goyert, and S. N. Vogel. 2001. CD11b/CD18 acts in concert with CD14 and Toll-like receptor (TLR) 4 to elicit full lipopolysaccharide and taxol-inducible gene expression. J. Immunol. 166:574-581.[Abstract/Free Full Text] |
| 38. | Proost, P., S. Verpoest, K. Van de Borne, E. Schutyser, S. Struyf, W. Put, I. Ronsse, B. Grillet, G. Opdenakker, and J. Van Damme. 2004. Synergistic induction of CXCL9 and CXCL11 by Toll-like receptor ligands and interferon-gamma in fibroblasts correlates with elevated levels of CXCR3 ligands in septic arthritis synovial fluids. J. Leukoc. Biol. 75:777-784.[Abstract/Free Full Text] |
| 39. | Racoosin, E. L., and S. M. Beverley. 1997. Leishmania major: promastigotes induce expression of a subset of chemokine genes in murine macrophages. Exp. Parasitol. 85:283-295.[CrossRef][Medline] |
| 40. | Robertson, M. J. 2002. Role of chemokines in the biology of natural killer cells. J. Leukoc. Biol. 71:173-183.[Abstract/Free Full Text] |
| 41. | Schaefer, T. M., K. Desouza, J. V. Fahey, K. W. Beagley, and C. R. Wira. 2004. Toll-like receptor (TLR) expression and TLR-mediated cytokine/chemokine production by human uterine epithelial cells. Immunology 112:428-436.[CrossRef][Medline] |
| 42. | Seino, K., M. Harada, and M. Taniguchi. 2004. NKT cells are relatively resistant to apoptosis. Trends Immunol. 25:219-221.[CrossRef][Medline] |
| 43. | Sher, A., E. Pearce, and P. Kaye. 2003. Shaping the immune response to parasites: role of dendritic cells. Curr. Opin. Immunol. 15:421-429.[CrossRef][Medline] |
| 44. | Smyth, M. J., N. Y. Crowe, D. G. Pellicci, K. Kyparissoudis, J. M. Kelly, K. Takeda, H. Yagita, and D. I. Godfrey. 2002. Sequential production of interferon-gamma by NK1.1(+) T cells and natural killer cells is essential for the antimetastatic effect of alpha-galactosylceramide. Blood 99:1259-1266.[Abstract/Free Full Text] |
| 45. | Taniguchi, M., M. Harada, S. Kojo, T. Nakayama, and H. Wakao. 2003. The regulatory role of Valpha14 NKT cells in innate and acquired immune response. Annu. Rev. Immunol. 21:483-513.[CrossRef][Medline] |
| 46. | Tomura, K., and S. Narumi. 1999. Differential induction of interferon (IFN)-inducible protein 10 following differentiation of a monocyte, macrophage cell lineage is related to the changes of nuclear proteins bound to IFN stimulus response element and kappaB sites. Int. J. Mol. Med. 3:477-484.[Medline] |
| 47. | Trobonjaca, Z., F. Leithauser, P. Moller, R. Schirmbeck, and J. Reimann. 2001. Activating immunity in the liver. I. Liver dendritic cells (but not hepatocytes) are potent activators of IFN-gamma release by liver NKT cells. J. Immunol. 167:1413-1422.[Abstract/Free Full Text] |
| 48. | Tsuboi, N., Y. Yoshikai, S. Matsuo, T. Kikuchi, K. Iwami, Y. Nagai, O. Takeuchi, S. Akira, and T. Matsuguchi. 2002. Roles of Toll-like receptors in C-C chemokine production by renal tubular epithelial cells. J. Immunol. 169:2026-2033.[Abstract/Free Full Text] |
| 49. | Vester, B., K. Muller, W. Solbach, and T. Laskay. 1999. Early gene expression of NK cell-activating chemokines in mice resistant to Leishmania major. Infect. Immun. 67:3155-3159.[Abstract/Free Full Text] |
| 50. | Wu, C., Y. Ohmori, S. Bandyopadhyay, G. Sen, and T. Hamilton. 1994. Interferon-stimulated response element and NF kappa B sites cooperate to regulate double-stranded RNA-induced transcription of the IP-10 gene. J. Interferon Res. 14:357-363.[Medline] |
| 51. | Yagi, J., U. Dianzani, H. Kato, T. Okamoto, T. Katsurada, D. Buonfiglio, T. Miyoshi-Akiyama, and T. Uchiyama. 1999. Identification of a new type of invariant V alpha 14+ T cells and responsiveness to a superantigen, Yersinia pseudotuberculosis-derived mitogen. J. Immunol. 163:3083-3091.[Abstract/Free Full Text] |
| 52. | Yoneyama, H., S. Narumi, Y. Zhang, M. Murai, M. Baggiolini, A. Lanzavecchia, T. Ichida, H. Asakura, and K. Matsushima. 2002. Pivotal role of dendritic cell-derived CXCL10 in the retention of T helper cell 1 lymphocytes in secondary lymph nodes. J. Exp. Med. 195:1257-1266.[Abstract/Free Full Text] |
| 53. | Zaph, C., and P. Scott. 2003. Interleukin-12 regulates chemokine gene expression during the early immune response to Leishmania major. Infect. Immun. 71:1587-1589.[Abstract/Free Full Text] |
Infection and Immunity, November 2005, p. 7541-7547, Vol. 73, No. 11
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.11.7541-7547.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Campos-Martin, Y., Colmenares, M., Gozalbo-Lopez, B., Lopez-Nunez, M., Savage, P. B., Martinez-Naves, E.
(2006). Immature Human Dendritic Cells Infected with Leishmania infantum Are Resistant to NK-Mediated Cytolysis but Are Efficiently Recognized by NKT Cells. J. Immunol.
176: 6172-6179
[Abstract]
[Full Text]