This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yager, E.
Right arrow Articles by Winslow, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yager, E.
Right arrow Articles by Winslow, G.

 Previous Article  |  Next Article 

Infection and Immunity, December 2005, p. 8009-8016, Vol. 73, No. 12
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.12.8009-8016.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Essential Role for Humoral Immunity during Ehrlichia Infection in Immunocompetent Mice

Eric Yager,1 Constantine Bitsaktsis,2 Bisweswar Nandi,2 Jere W. McBride,3 and Gary Winslow1,2*

The Department of Biomedical Sciences, School of Public Health, University at Albany, Albany, New York 12201-0509,1 Department of Pathology, Center for Biodefense and Emerging Infectious Diseases and Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas 77555,3 Wadsworth Center, New York State Department of Health, P.O. Box 22002, Albany, New York 12201-20022

Received 4 May 2005/ Returned for modification 25 May 2005/ Accepted 22 September 2005


arrow
ABSTRACT
 
Although cellular immunity is essential for host defense during intracellular bacterial infections, humoral immunity can also play a significant role in host defense during infection by some intracellular bacteria, including the ehrlichiae. Antibodies can protect susceptible SCID mice from fatal Ehrlichia chaffeensis infection, an observation that has been hypothesized to involve the opsonization of bacteria released from host cells. To determine whether humoral immunity plays an essential role during ehrlichia infection in immunocompetent mice, we utilized a murine model of fatal monocytotropic ehrlichiosis caused by Ixodes ovatus ehrlichia. Mice lacking either B cells or Fc{gamma}RI were unable to resolve a low-dose (sublethal) I. ovatus ehrlichia infection, which suggested that humoral immunity is essential for resistance. Polyclonal sera generated in I. ovatus ehrlichia-infected mice recognized a conserved ehrlichia outer membrane protein and, when administered to infected mice, caused a significant decrease in bacterial infection. Mice experimentally depleted of complement, or deficient for complement receptors 1 and 2, were also susceptible to sublethal I. ovatus ehrlichia infection, as were mice that lacked the phox91 subunit of NADPH oxidase. The data are consistent with a mechanism whereby bacteria released from infected cells are lysed directly by complement or undergo antibody-mediated Fc{gamma}R-dependent phagocytosis and subsequent exposure to reactive oxygen intermediates. The findings suggest mechanisms whereby antibodies contribute to immunity against intracellular bacteria in immunocompetent mice.


arrow
INTRODUCTION
 
The lack of a clear in vivo role for antibodies in protection against infection by several well-characterized pathogens, including Mycobacterium tuberculosis and Listeria monocytogenes, has contributed to the idea that humoral immunity has at most a minor role in protection against intracellular bacterial infection (17, 21). This is due in part to the fact that intracellular bacteria reside within host cells, which are thought to provide an environment that is protected from the activities of antibodies and complement. Nevertheless, accumulating evidence has indicated that humoral immune responses can be important for protection against a number of intracellular pathogens (5), including Salmonella enterica serovar Typhimurium (30, 31), Cryptococcus neoformans (33), and Listeria monocytogenes (11, 12). Antibodies have also proved to be effective during rickettsial and ehrlichial infections (14, 27, 42). It has been suggested that past failures to identify protective antibodies during some intracellular infections could be attributed to insufficient dosages of protective antibodies, inappropriate specificity and/or isotype, and host genetic background (6). Thus, humoral immunity may play a more important role in host defense during intracellular bacterial infections than previously realized.

Our previous studies of humoral immunity demonstrated that passive transfer of antibodies could prevent fatal disease during Ehrlichia chaffeensis infection of immunodeficient SCID mice (27, 48). It was later proposed that antibodies mediated bacterial clearance, at least in part, by opsonizing bacteria released from infected host cells (26). Although these findings demonstrated a possible therapeutic role for antibodies during ehrlichial infections, the relevance of the findings for infections in healthy immunocompetent mice and humans was unclear.

E. chaffeensis does not cause fatal disease in immunocompetent mice, so recent studies of ehrlichial immunity have utilized a mouse model of fatal monocytotropic ehrlichiosis caused by infection with an ehrlichia closely related to E. chaffeensis, known as Ixodes ovatus ehrlichia (39, 41). I. ovatus ehrlichia infection causes disease in immunocompetent mice that closely resembles human monocytotropic ehrlichiosis, and this murine model of ehrlichiosis has been used to investigate cellular immunity (3, 20). As has been described for other intracellular bacteria, cellular immunity is essential for host defense during I. ovatus ehrlichia infection (3). A major role is played by type 1 CD4 T cells (3), although evidence suggests that cross-reactive antibodies elicited during heterologous ehrlichial infection can contribute to protective immunity (20). The requirement for humoral immunity during I. ovatus ehrlichia infection was not resolved, however, and although our previous studies in the SCID mouse model suggested that antibodies encounter bacteria outside of host cells, the mechanism(s) whereby antibodies might contribute to pathogen clearance in immunocompetent mice was unclear. In the present study we demonstrate that humoral immunity is essential for host defense during low-dose I. ovatus ehrlichia infection, and we suggest that the relevant mechanism(s) involves classical antibody- and complement-mediated, Fc{gamma} receptor-dependent, opsonization mechanisms that are characteristic of host defense against well-described extracellular bacteria.


arrow
MATERIALS AND METHODS
 
Mice. C57BL/6J, BALB/cByJ, BALB/c-scid, C57BL/6-scid, B6.129S6-Cybbtm1Din/J (gp91phox–/–), B6;129Fcer1gtm1Rav (FcR-common {gamma} chain; Fc{epsilon}R–/–), and B6.129S2-IgH-6tm1Cgn/J (µMT–/–) mice were obtained from the Jackson Laboratory (Bar Harbor, ME) or were bred in the Wadsworth Center Animal Care Facility, in accordance with institutional guidelines for animal welfare and use. JH-deleted mice (JHD–/–; BALB/c genetic background) were kindly provided by M. J. Shlomchik (Yale University, New Haven, CT) and GenPharm (San Jose, CA), mice deficient for Fc{gamma}RIII (CD16; C57BL/6 genetic background) were obtained from J. S. Verbeek (Leiden University Medical Center, Leiden, The Netherlands), the B6.129-Fc{gamma}RI-deficient mice were obtained from P. M. Hogarth (Austin Research Institute, Heidelberg, Victoria, Australia), and CD21/CD35-deficient mice (CR1/CR2–/–; C57BL/6 genetic background) were obtained from H. Molina (Washington University School of Medicine, St. Louis, MO). The studies utilized 6- to 12-week-old, sex-matched mice. Although some of the gene-targeted mutations were available only on a B6.129 genetic background, infection studies of B6.129 mice have not revealed any differences in susceptibility to I. ovatus ehrlichia infection. Institutional Animal Care and Use Committee guidelines do not permit the use of death as an experimental endpoint in animal studies, so morbid animals that were judged to be incapable of surviving infection were humanely sacrificed, and the data have been reported with respect to the percentage of animals that were "nonmorbid." Mice identified as morbid typically exhibit hunched posture, ruffled fur, weight loss, and decrease responses to stimuli and have been judged to be incapable of surviving infection.

Bacterial infections. Mice were infected with I. ovatus ehrlichia via the peritoneum, as described previously (3), using aliquots of infected allogeneic splenocytes that had been stored at –80°C in sucrose-phosphate-glutamate buffer (0.0038 M KH2PO4, 0.0072 M K2HPO4, 0.0049 M L-glutamate, 0.218 M sucrose, pH 7.2). The bacterial copy number in each aliquot was determined by quantitative PCR analysis of I. ovatus ehrlichia 16S rRNA genes within 10 to 50 ng of tissue DNA, as described previously (3). The I. ovatus ehrlichia 50% lethal dose for inbred C57BL/6J and BALB/cByJ mice was determined to be approximately 200 bacteria. Low-dose infection typically utilized 50 to 100 bacteria (as enumerated by PCR) and did not cause fatal disease in infected immunocompetent mice. Ehrlichia muris was obtained from Y. Rikihisa (Ohio State University, Columbus) and D. Walker (University of Texas Medical Branch, Galveston) and was obtained from infected mouse splenocytes, as described for I. ovatus ehrlichia.

Production and purification of recombinant ehrlichia proteins. A portion of the I. ovatus ehrlichia p28 OMP-19 gene was amplified from liver homogenates of I. ovatus ehrlichia-infected mice by PCR using oligonucleotides obtained from an alignment of ehrlichia p28 outer membrane protein (OMP) gene sequences, as described previously (29), except that an annealing temperature of 48°C was used in the thermal cycling protocol. The amplicons were cloned into a TOPO/TA cloning vector (Invitrogen), and nucleotide sequence analysis of individual clones was performed. The I. ovatus ehrlichia p28 OMP-19 gene was identified based on sequence comparison with E. chaffeensis p28-19 (36, 49). The remaining I. ovatus ehrlichia OMP-19 nucleotide sequence was obtained by PCR using the following oligonucleotide primers obtained from the 5' and 3' ends of the E. muris p28 OMP-19 gene: 5' GAGATATACCATGGGGCCAATACAGGATAGTAA 3' and 5' GAGCTCGAATTCGGTACATTTAGTGTTACTATTGC 3'. PCR was performed using an annealing temperature of 52°C for 40 cycles. The cloned gene does not contain the putative signal sequence, and amino-terminal Pro-Ile residues encoded by the oligonucleotide used for cloning are not likely to be expressed in the native I. ovatus ehrlichia OMP-19. The PCR products were isolated and cloned into the pET-28 vector (Invitrogen), using restriction endonuclease sites (NcoI and EcoRI) that had been incorporated into the oligonucleotides used for PCR. Expression and purification of the recombinant I. ovatus ehrlichia OMP-19 were performed as described previously (27).

Ehrlichia quantitative PCR. Tissues from I. ovatus ehrlichia-infected mice were digested in lysis buffer (100 mM Tris-HCl [pH 8.3], 5 mM EDTA, 0.2% sodium dodecyl sulfate, 200 mM NaCl, 0.2 mg of proteinase K per ml) at 55°C for 16 h. Fifty microliters of the digest was subjected to extraction with 0.5 ml of DNAzol reagent (Molecular Research Center, Inc.) for a minimum of 30 min at room temperature, and nucleic acids were precipitated in 0.25 ml of prechilled (–20°C) absolute ethanol for a minimum of 30 min at room temperature. The precipitate was collected by centrifugation, washed twice with 75% ethanol, dissolved in 0.2 ml of 8 mM sodium hydroxide, and then treated with 3 µl of 1 M HEPES to adjust the pH to 7.4. The concentration of the purified DNA (containing both mouse and bacterial genomes) was determined by measurement of absorbance at 260 nm using a spectrometer (Eppendorf, Hamburg, Germany). Quantitation of the ehrlichiae in tissue DNA samples was carried out as described previously (3). Quantitation of E. muris was performed in a manner identical to that for I. ovatus ehrlichia, except that the following oligonucleotides from the E. muris 16S rRNA gene were utilized: 5' ATAGGTTCGCTATTAGTGGC 3' and 5' CACCTCTACACTAGGAATTCCGC 3'.

Immune serum. Immune serum was obtained from C57BL/6 mice 4 weeks following low-dose I. ovatus ehrlichia infection and was administered to each recipient 1 and 4 days following high-dose challenge infection. Normal serum was obtained from an uninfected C57BL/6 mouse. E. muris immune serum was obtained 4 weeks following inoculation of C57BL/6 mice with infected splenocytes containing approximately 4 x 104 bacteria.

ELISA. Assay for I. ovatus ehrlichia-specific serum immunoglobulins (Igs) was performed by enzyme-linked immunosorbent assay (ELISA), as described previously (27), using recombinant I. ovatus ehrlichia p28 OMP-19 as the antigen.

Experimental depletion of complement. Mice were depleted of complement by treatment with 200 µg/kg of body weight of Naja naja kaouthia cobra venom factor (CVF; Calbiochem, La Jolla, CA), as described previously (15). A single dose of CVF was sufficient to deplete complement component C3 from the plasma of mice for up to 3 days, as determined using an ELISA specific for mouse complement component C3. Depletion was effectively maintained using successive doses of CVF. After I. ovatus ehrlichia infection, mice were administered injections of CVF every 3 days until the end of the experiment.

Detection of host-cell-free ehrlichiae. Blood from I. ovatus ehrlichia-infected mice was obtained via cardiac puncture and was collected in tubes containing the anticoagulant EDTA. Samples were centrifuged at 200 x g for 10 min to separate the cellular fraction from the plasma. The plasma was collected and centrifuged at 300 x g for 10 min, and the supernatant was passed through a 5-µm filter to remove any residual peripheral blood mononuclear cells and cell debris, as described previously (26). The centrifuged material was resuspended in sucrose-phosphate-glutamate buffer, and the number of bacteria in the suspension was determined using the quantitative PCR assay.

Statistical analyses. Statistical tests for data in Fig. 1 and 2 involved calculating the medians between paired control and experimental groups, followed by use of the Mann-Whitney test or Fisher's exact probability test to assess differences between the groups. Statistical tests for data in Fig. 3 and 4b utilized a one-way analysis of variance followed by Dunnett's multiple comparison test to assess differences between groups. Survival studies were subjected to log rank analysis to assess significance. All statistical analyses were performed using Prism 4 software (GraphPad, San Diego, CA).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. B lymphocytes are required for immunity during I. ovatus ehrlichia infection. B-cell-deficient JHD–/– (a) and µMT–/– mice (b) mice were infected with approximately 1 x 102 bacteria, administered via the peritoneum, and morbidity was monitored at the indicated times thereafter. Five mice were used per group, and the data are representative of three independent experiments. Log rank analyses indicated that survival differences in panels a and b were statistically significant (P = 0.0126 and 0.0119, respectively). In separate experiments, bacterial colonization in spleen tissue was determined in mice on day 10 postinfection (c). The values represent bacterial copy numbers of the I. ovatus ehrlichia 16S rRNA gene detected in 10 ng of spleen DNA. Typically, 10 to 100 bacteria are detected within 10 ng of genomic DNA isolated from the spleens of infected C57BL/6 mice on day 10 postinfection. Congenic BALB/c and C57BL/6 mice were used as controls for the JHD and µMT mice, respectively. Statistical analyses (performed using Fisher's exact probability test) demonstrated that the higher bacterial loads in the gene-targeted mice were statistically significant (P < 0.05).



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 2. Transfer of I. ovatus ehrlichia (IOE) immune serum reduced the bacterial burden in high-dose-infected mice. I. ovatus ehrlichia immune sera were obtained from low-dose-infected C57BL/6 mice 28 days following infection. Recipient mice were administered normal or immune sera (0.2 ml) 1 and 4 days following a high dose of I. ovatus ehrlichia (approximately 1,000 bacteria). Bacterial colonization of spleen tissue was examined on day 10 postinfection. Each of the recipient mice is indicated, and the horizontal line indicates the mean of each group. Statistical analyses were performed using the Mann-Whitney test (P = 0.014; 95% confidence, one-tailed). The data are representative of two experiments. The immune serum used in the experiments shown was the same as that analyzed in Table 1.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 3. Fc{gamma}RI is essential for I. ovatus ehrlichia host defense. C57BL/6 mice and mice deficient for the FcR common {gamma} chain (FcR{gamma}c KO), Fc{gamma}RI, and Fc{gamma}RIII (as indicated) were infected with a low dose of I. ovatus ehrlichia (approximately 1 x 102 bacteria), and morbidity was monitored (a). The survival data were statistically significant (P = 0.0341). In separate experiments, bacterial colonization in spleen tissue was analyzed in mice on day 10 postinfection (b). Five mice were used per group, and the data are representative of three independent experiments. Results of the statistical analysis (one-way analysis of variance) are indicated. **, P < 0.01; *, P < 0.05.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4. I. ovatus ehrlichia immunity requires both complement and complement receptors. a. C57BL/6 mice were depleted of complement by treatment with CVF 1 day prior to low-dose I. ovatus ehrlichia infection and every 3 days thereafter. Control mice were administered vehicle alone. Five mice were used per group, and the data are representative of three independent experiments. b. C57BL/6 mice or mice doubly deficient for complement receptors 1 and 2 (CR1/CR2) were administered a low dose of I. ovatus ehrlichia. Five mice were used per group, and the data are representative of three experiments. Log rank analyses indicated that survival differences in panels a and b were statistically significant (P = 0.0144 and 0.0009, respectively).


arrow
RESULTS
 
B cells are essential for host defense during I. ovatus ehrlichia infection. Our previous studies of humoral immunity during ehrlichial infection of SCID mice suggested that B cells and antibodies could also play a role during infection of immunocompetent mice. To determine whether B cells were essential for immunity during I. ovatus ehrlichia infection, we investigated disease susceptibility in two strains of B-cell-deficient mice (JHD–/– and µMT–/–) that were infected with I. ovatus ehrlichia obtained from cryopreserved infected mouse splenocytes. Mice were infected with a low dose of bacteria previously established to be sublethal in immunocompetent mice (approximately 100 bacteria). The BALB/c JHD–/– mice carry a targeted deletion of the immunoglobulin heavy chain J locus (7); as a consequence, they lack mature B lymphocytes and are unable to produce IgG and IgM. Low-dose-infected JHD–/– mice became moribund by day 14 postinfection (Fig. 1a). Moribund mice typically exhibited hunched posture, ruffled fur, weight loss, and decreased responses to stimuli and were judged to be incapable of surviving infection. BALB/c control mice infected with an equivalent dose of I. ovatus ehrlichia did not succumb and resolved the infection within 10 days, as described previously (3). To confirm that the apparent requirement for B cells was independent of genetic background and the induced mutation, we also analyzed C57BL/6 congenic mice genetically deficient for the heavy chain of IgM (µMT–/–). These mice do not express membrane-bound IgM, and as a consequence, they also lack mature B cells and fail to produce antibodies (24). Low-dose-infected C57BL/6 µMT–/– mice were also susceptible to fatal disease, unlike wild-type control mice (Fig. 1b). The B-cell-deficient mice exhibited significantly higher levels of bacterial infection in spleen tissue 10 days postinfection than did congenic control mice (Fig. 1c). These data demonstrate that B cells are essential for protection against low-dose I. ovatus ehrlichia challenge infection.

Antibodies generated in I. ovatus ehrlichia-infected mice recognize a conserved outer membrane protein. Previous studies have demonstrated that outer membrane proteins (p28 OMPs) are immunodominant antigens during infection with the closely related ehrlichia E. chaffeensis (27), and OMP antibodies are highly effective at controlling infection in SCID mice. To determine whether p28 OMPs were also recognized during I. ovatus ehrlichia infection, we performed ELISA to evaluate and quantitate OMP antibodies. The ELISA used recombinant I. ovatus ehrlichia p28 OMP-19 which had been produced in E. coli and purified to homogeneity. OMP-19 is an OMP expressed during E. chaffeensis infection in mice (40), so there is a high likelihood that the I. ovatus ehrlichia homologue of this OMP is expressed during I. ovatus ehrlichia infection. Immune serum obtained from C57BL/6 mice 28 days post-low-dose-infection revealed a total reciprocal immunoglobulin titer of 320 (Table 1), which is consistent with published data (20). Analysis of isotype-specific responses in I. ovatus ehrlichia immune serum revealed low to moderate levels of p28 OMP-19 IgM and IgG2b but undetectable IgG1, IgG2a, and IgG3 (Table 1). By comparison, mice infected with E. muris generated eightfold-higher cross-reactive I. ovatus ehrlichia OMP-19 total Ig and IgM responses and detectable IgG of all isotypes. Nevertheless, OMP-19 antibodies are generated during low-dose I. ovatus ehrlichia infection, and it is possible that these contributed to protective immunity. Immunoblot analyses performed to identify other antigens in I. ovatus ehrlichia-infected mice were unsuccessful (data not shown), but it is likely that other OMP and non-OMP antigens, in addition to p28 OMP-19, are recognized and contribute to humoral immunity.


View this table:
[in this window]
[in a new window]
 
TABLE 1. p28 OMP-19 immunoglobulin titers in infected micea

Antibodies contribute to I. ovatus ehrlichia immunity during low-dose infection. The susceptibility of the B-cell-deficient mice to low-dose I. ovatus ehrlichia challenge infection suggested that protection was mediated by antibodies. To address whether antibodies could contribute to immune protection, immune serum was administered to C57BL/6 mice following high-dose I. ovatus ehrlichia infection (two times the 50% lethal dose). The experiment was performed using high-dose-infected mice because low-dose-I. ovatus ehrlichia-infected mice normally resolve infection and exhibit low levels of bacterial infection. Moreover, as low-dose-I. ovatus ehrlichia-infected mice are not protected from a subsequent high-dose challenge (3), administration of immune sera was unlikely to provide protection from fatal high-dose I. ovatus ehrlichia infection. Therefore, we addressed whether administration of immune serum could mediate a reduction in bacterial infection following high-dose infection. The immune sera were obtained from C57BL/6 mice 4 weeks following low-dose I. ovatus ehrlichia infection, and 0.2-ml aliquots were administered 1 and 4 days following high-dose I. ovatus ehrlichia infection. Transfer of immune sera caused a reduction in bacterial infection in the spleen on day 10 postinfection, relative to mice that were administered normal mouse sera (Fig. 2). These data indicate that antibodies can contribute to host defense during fatal monocytotropic ehrlichial infection in immunocompetent mice and suggest that the susceptibility of the B-cell-deficient mice to fatal infection was at least in part due to a failure to produce antibodies.

Fc{gamma}RI is required for host defense. The mechanisms whereby antibodies mediate immunity to intracellular bacteria have not been fully resolved. Because effector functions of antibodies are commonly mediated by binding of Ig constant regions to FcRs, we examined whether FcRs were required during I. ovatus ehrlichia infection, by infecting mice genetically deficient for Fc{gamma}RI, Fc{gamma}RIII, or the FcR common {gamma} chain. The FcR common {gamma} chain is required for function of both Fc{gamma}RI and Fc{gamma}RIII. Mice lacking Fc{gamma}RI alone succumbed to low-dose I. ovatus ehrlichia infection, whereas C57BL/6 and Fc{gamma}RIII-deficient mice did not (Fig. 3a). The FcR common {gamma} chain-deficient and Fc{gamma}RI-deficient mice exhibited significantly higher bacterial burdens than the C57BL/6 mice 10 days postinfection (Fig. 3b). In separate experiments, the Fc{gamma}RIII-deficient mice cleared the infection, like the wild-type mice (data not shown). These data demonstrate that Fc{gamma}RI is essential for host defense during I. ovatus ehrlichia infection.

Complement and complement receptors are necessary for resolution of I. ovatus ehrlichia infection. Complement has not been reported to be involved in host defense against most intracellular bacteria. However, antibody binding to the pathogen surfaces can initiate the classical complement pathway, and upon activation, complement components can facilitate the destruction of microbes through direct lysis and/or phagocytosis (44). To determine whether complement was required during I. ovatus ehrlichia infection, we experimentally depleted complement in C57BL/6 mice, prior to and during infection, by treatment with CVF. CVF is a structural analog of complement component C3 and has been used extensively to deplete complement in animals (8). CVF administration depleted C3 to undetectable levels for at least 3 days following treatment (data not shown). The CVF-treated mice succumbed to low-dose I. ovatus ehrlichia infection (Fig. 4a), indicating that complement is required for immunity. Other experiments were performed to address the requirements for complement receptors (CRs). CR1 and CR2 recognize complement components and are involved in the uptake of opsonized particles, as well as in the generation of B-cell responses (10, 18). Mice deficient for both CR1 and CR2 were also susceptible to low-dose infection (Fig. 4b), further supporting a role for complement in I. ovatus ehrlichia immunity.

Host-cell-free bacteria were detected during I. ovatus ehrlichia infection. Complement- and/or Fc{gamma}R-mediated phagocytosis-dependent elimination of I. ovatus ehrlichia suggested that bacteria are exposed to these components and receptors extracellularly. Previous studies of E. chaffeensis revealed that these ehrlichiae could be recovered from the plasma of infected mice (26), so it was hypothesized that I. ovatus ehrlichia would also be found outside host cells during active infection. To address this possibility, we collected host-cell-free plasma from C57BL/6 mice 10 days following a high-dose I. ovatus ehrlichia infection. To determine whether host-cell-free bacteria were present, we filtered the plasma to remove contaminating peripheral blood mononuclear cells and assayed bacteria using quantitative PCR. As was observed during E. chaffeensis infection, I. ovatus ehrlichia was detected in the host-cell-free plasma of infected mice (mean copy number, 2.6 x 105 ± 28,740 bacteria per ml). The plasma was infectious, as BALB/c-scid mice infected with the plasma succumbed to disease (data not shown). These data suggest that I. ovatus ehrlichia, like E. chaffeensis, can be also be found outside host cells during infection; this characteristic may cause the bacteria to be susceptible to humorally mediated host defenses.

A role for NADPH oxidase in host defense. Antibody-antigen complexes bind and cross-link Fc{gamma}Rs expressed on phagocytic cells, thereby facilitating phagocytosis of bound antigens. Concomitant with the uptake of antibody-antigen complexes, reactive oxygen species (ROS) are generated at the phagosomal membrane by action of the NADPH-oxidase enzyme complex (22). The production of ROS has been shown to be critical for host defense against many extracellular and intracellular pathogens (34, 46). To examine the role of ROS generation during I. ovatus ehrlichia infection, we challenged mice deficient for gp91phox, a component of the NADPH oxidase enzyme complex, with low-dose I. ovatus ehrlichia. gp91phox–/–-deficient mice succumbed to low-dose challenge by day 14 postinfection (Fig. 5), indicating that NADPH oxidase-dependent ROS are critical for the resolution of I. ovatus ehrlichia infection and may play a role in humoral immunity.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. NADPH oxidase-derived reactive oxygen species are essential for I. ovatus ehrlichia immunity. Wild-type C57BL/6 mice, and mice deficient for gp91phox, were administered a low dose of I. ovatus ehrlichia. Five mice were used per group, and the data are representative of three independent experiments. The data were statistically significant (P = 0.0341), as determined by log rank analysis.


arrow
DISCUSSION
 
Our data demonstrate an essential role for B cells and antibodies during low-dose I. ovatus ehrlichia infection in immunocompetent mice. Although several studies have now demonstrated that passive transfer of antibodies can mediate immunity during ehrlichial and rickettsial infections (13, 14, 48), the requirement for antibodies during normal host defense in immunocompetent mice had been unclear. The requirement for B cells for immunity to low-dose I. ovatus ehrlichia challenge in turn suggested a role for antibodies in host defense. Accordingly, transfer of immune sera to mice following high-dose I. ovatus ehrlichia challenge infection resulted in a reduction of bacterial load. It is unlikely that nonspecific inflammatory factors in immune serum contributed to protection, as the immune serum was obtained well after low-dose I. ovatus ehrlichia infection had been resolved. These data strongly suggest that antibodies generated during I. ovatus ehrlichia infection are necessary for protection against low-dose infection in C57BL/6 mice.

Although the data support an essential role for antibodies, p28 OMP-19 titers generated during I. ovatus ehrlichia infection were much lower than those generated during E. muris or E. chaffeensis infection (20, 27; this study). Previous data indicated that anti-OMP responses are both dominant and protective during E. chaffeensis infection, so it is likely, nevertheless, that OMP responses are good indicators of protective humoral immunity during I. ovatus ehrlichia infection. Thus, one explanation for the observed effect of immune serum is that the relatively low OMP-19 titers in the low-dose-I. ovatus ehrlichia-infected mice were sufficient for protection against low-dose, but not high-dose, I. ovatus ehrlichia infection. This may explain why low-dose-I. ovatus ehrlichia-infected mice were not protected from a subsequent high-dose challenge infection (3). Another explanation is that antibodies of other (non-OMP) specificities were involved in immunity. In either case, the data do not diminish the potential importance of antibodies in ehrlichia infection. Instead, they indicate that even relatively weak antibody responses may be protective during low-dose infection, an observation that is probably physiologically relevant, given that relatively low numbers of bacteria are likely to be transmitted during tick feeding. Why apparently more robust humoral immunity is generated during heterologous ehrlichia infection than during low-dose I. ovatus ehrlichia infection is not presently understood. However, the observation that I. ovatus ehrlichia elicits relatively weak p28 OMP-19 antibody responses suggests that humoral responses may be poorly induced during I. ovatus ehrlichia infection. The low p28 OMP-19 responses are unlikely to be due only to reduced antigen levels in the low-dose-I. ovatus ehrlichia-infected mice, as similar observations were made in high-dose-I. ovatus ehrlichia-challenged mice (20). An alternative explanation is that OMPs other than OMP-19 are targets of antibody recognition in I. ovatus ehrlichia-infected mice. Although it is possible that I. ovatus ehrlichia expresses OMPs other than OMP-19, it is surprising that cross-reactive OMP-19 responses generated in E. muris-infected mice were much more robust than I. ovatus ehrlichia OMP-19 responses generated during I. ovatus ehrlichia infection. Thus, the data are more consistent with the notion that I. ovatus ehrlichia-infected mice generate relatively poor antibody responses.

Although our data demonstrate an essential role for B cells during I. ovatus ehrlichia infection, some caution is in order when the studies of the B-cell-deficient mice are interpreted, because these mice exhibit deficiencies in lymphoid tissue organization or other defects that may affect other nonhumoral arms of the immune response (17, 21, 38). Passive transfer of immune sera can protect B-cell-deficient animals from some pathogens, indicating that the essential function of B cells during these infections was antibody production (9, 43). However, in our studies, attempts to complement the susceptibility of B-cell-deficient mice to low-dose I. ovatus ehrlichia infection by passive transfer of immune sera were unsuccessful (E. Yager and G. Winslow, unpublished data). These observations suggest that B cells perform other functions, in addition to antibody production, that are necessary for immunity during low-dose I. ovatus ehrlichia infection. For example, B cells have been suggested to mediate protection against C. neoformans via the secretion of cytokines that modulate the inflammatory response to infection (38), and B cells may mediate host defense against the bacterium Pneumocystis carinii by facilitating the activation and expansion of CD4 T cells (28). Although B cells may play similar roles during I. ovatus ehrlichia infection, our findings nevertheless support the conclusion that at least one essential function of B cells during the response to primary low-dose I. ovatus ehrlichia infection is the production of specific antibodies.

How might antibodies function to mediate protection against an intracellular bacterium? Our previous work has suggested a possible mechanism whereby antibodies opsonize bacteria that either escape from infected host cells or are released during cell lysis. These studies revealed that a significant number of bacteria were found in the plasma of mice during E. chaffeensis infection (26), and similar observations were made for I. ovatus ehrlichia in the present studies. We have provided additional support for the notion that antibodies function by binding host-cell-free bacteria by also demonstrating an essential requirement for Fc{gamma}RI, which may function in phagocytosis of antibody-opsonized extracellular bacteria. In studies of E. chaffeensis infection, no evidence was found to support alternate explanations that antibodies may gain access to bacteria residing within host cells or that pathogen-specific immune complexes could trigger an FcR-mediated microbicidal respiratory burst in infected host cells (Yager and Winslow, unpublished).

As Fc{gamma}RI was required for protection, it was unexpected that IgG ELISA titers were low to undetectable in low-dose-I. ovatus ehrlichia-infected mice. Nevertheless, it is possible that the IgG2b OMP-19 responses detected in response to I. ovatus ehrlichia infection were sufficient to activate Fc{gamma}RI. IgG2b was apparently not protective in the absence of Fc{gamma}RI, suggesting that a new FcR (FcRIV [35]) was not sufficient for protection or that the IgG2b titers were too low to be effective. An alternative explanation is that IgG of other specificities was involved in the protective humoral response in low-dose-I. ovatus ehrlichia-infected mice.

The differential requirement for Fc{gamma}RI and Fc{gamma}RIII suggests that antibody effector functions are critical for immunity in this model. Fc{gamma}RI is the high-affinity FcR; it binds monomeric Ig and immune complexes and may be required for optimal antigen presentation (19). Fc{gamma}RIII is a low-affinity receptor and binds only immune complexes. Both activating Fc{gamma}Rs may function during the humoral response, but Fc{gamma}RIII clearly cannot compensate for the lack of Fc{gamma}RI. These observations are consistent with data indicating that mice deficient for Fc{gamma}RI show greatly reduced rates of uptake for particles bound by IgG2a, even in the presence of Fc{gamma}RIII (2). Thus, the different susceptibilities may simply reflect a greater involvement of Fc{gamma}RI in bacterial phagocytosis. In addition, although the two receptors share similar preferences for IgG isotypes, Fc{gamma}RI has 10-fold-higher affinity for IgG (16, 37, 45). During E. chaffeensis infection, highly effective antibodies were of the IgG2a isotype (25), so if this is also true of I. ovatus ehrlichia infection, it may indicate that the requirement for Fc{gamma}RI reflects its higher affinity for IgG. It is also possible that cell type expression differences also contribute to the requirement for Fc{gamma}RI, especially as monocytes/macrophages are targets of I. ovatus ehrlichia infection and Fc{gamma}RI, but not Fc{gamma}RIII, is upregulated by gamma interferon on activated mouse macrophages (19). This raises a question as to whether Fc{gamma}RI expression is required on infected host cells, or if uninfected Fc{gamma}R-positive cells can mediate immunity. The requirement for Fc{gamma}R expression on host cells is being addressed in ongoing studies and will help to resolve the mechanism whereby antibodies function during intracellular infection.

We have also demonstrated a role for complement and CRs in I. ovatus ehrlichia immunity, which is consistent with the hypothesis that the ehrlichiae are opsonized when encountered in the extracellular milieu, because complement is not known to function within host cells. Caution is again warranted in the interpretation of the complement and CR studies, due to pleiotropic effects of the mutations or depletion protocols; these effects may compromise cellular immunity. Nevertheless, the requirement for complement for I. ovatus ehrlichia humoral immunity is consistent with the hypothesis that the classical pathway of complement fixation is utilized and that the bacteria are encountered by antibodies outside host cells. Our findings demonstrating a role for complement contrast with results of studies of humoral immunity during E. chaffeensis infection of SCID mice, in which experimental complement depletion did not affect the ability of monoclonal antibodies to mediate protection (Yager and Winslow, unpublished data). E. chaffeensis is less virulent for mice than is I. ovatus ehrlichia, so perhaps non-complement-dependent mechanisms are sufficient to allow antibodies to mediate protection during E. chaffeensis, but not I. ovatus ehrlichia, infection. Alternatively, complement may also be required for optimal cellular immunity, or for both cellular immunity and humoral immunity, during I. ovatus ehrlichia infection (4, 32). The observation that classical complement-mediated pathways of host defense were not sufficient to protect mice from low-dose I. ovatus ehrlichia infection in Fc{gamma}R-deficient mice suggests that complement- and FcR-mediated host defenses are nonredundant.

Our data are consistent with a mechanism of humoral immunity during I. ovatus ehrlichia infection whereby bacteria are released from host cells and encounter antibodies that in turn mediate complement fixation and/or binding to host Fc{gamma}RI and complement receptors. Binding of immune complexes to Fc{gamma}RI may mediate a respiratory burst responsible for pathogen killing. The latter scenario is supported by our finding that the phox91 component of the NADPH oxidase is required for host defense, although we have not yet determined whether antibody-mediated mechanisms actually involve ROS. Nevertheless, our findings reveal that ROS are essential for the elimination of I. ovatus ehrlichia and are consistent with evidence that other ehrlichiae may be susceptible to killing by ROS (1).

Although the proposed mechanism may explain how antibodies can be effective during intracellular bacterial infection, bacteria residing within host cells would still presumably be protected from antibodies, unless the bacteria are released during host cell cytolysis or cytolysis is mediated by CD8 T cells. CD8 T cells are not essential for protection against low-dose I. ovatus ehrlichia infection (3), however, so we propose that antibodies opsonize bacteria released after bacterium-induced host cell cytolysis and that CD4 T cells produce soluble mediators such as gamma interferon that act to induce killing of bacteria residing within host cells. This scenario may resemble immunity during infections by cytopathic viruses, where it has been suggested that soluble mediators produced by T cells, and neutralizing antibodies, are required for host immunity (23).

Our findings demonstrate that antibodies are an essential component of host defense during ehrlichial infection in an animal model and suggest that antibodies may function in a similar fashion in humans and/or other animals. If so, the elicitation of protective antibodies may be a desirable objective as part of the development of vaccines and therapies for ehrlichial diseases. It is also possible that antibodies—even if not required for host protection in other intracellular bacterial infections—will nevertheless be useful for vaccines and/or therapies against both the ehrlichiae and other intracellular bacteria of public health significance.


arrow
ACKNOWLEDGMENTS
 
We thank Marcia Blackman for critical reading of the manuscript and M. Hogarth (Austin Research Institute, Heidelberg, Victoria, Australia), M. J. Schlomchik (Yale University, New Haven, CT), GenPharm (San Jose, CA), J. S. Verbeek (Leiden University Medical Center, Leiden, The Netherlands), and H. Molina (Washington University School of Medicine, St. Louis, MO) for providing the genetically deficient mice. We also thank M. Kawahara of the Nagoya Public Health Research Institute for his generous gift of I. ovatus ehrlichia. We acknowledge the use of the Wadsworth Center Immunology Core Facility and the Wadsworth Center Animal Care Facility. Finally, we thank Jennifer Huntington and Kathryn Hogle for excellent technical assistance.

This work was supported by U.S. Public Health Service grant R01 AI47963 to G.W.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Wadsworth Center, 120 New Scotland Avenue, Albany, NY 12208. Phone: (518) 473-2795. Fax: (518) 486-9858. E-mail: gary.winslow{at}wadsworth.org. Back

Editor: T. R. Kozel


arrow
REFERENCES
 
    1
  1. Banerjee, R., J. Anguita, D. Roos, and E. Fikrig. 2000. Infection by the agent of human granulocytic ehrlichiosis prevents the respiratory burst by down-regulating gp91phox1. J. Immunol. 164:3946-3949.[Abstract/Free Full Text]
  2. 2
  3. Barnes, N., A. L. Gavin, P. S. Tan, P. Mottram, F. Koentgen, and P. M. Hogarth. 2002. Fc{gamma}RI-deficient mice show multiple alterations to inflammatory and immune responses. Immunity 16:379-389.[CrossRef][Medline]
  4. 3
  5. Bitsaktsis, C., J. Huntington, and G. M. Winslow. 2004. Production of interferon-g by CD4 T cells is essential for resolving ehrlichia infection. J. Immunol. 172:6894-6901.[Abstract/Free Full Text]
  6. 4
  7. Carroll, M. C. 2004. The complement system in regulation of adaptive immunity. Nat. Immunol. 5:981-986.[CrossRef][Medline]
  8. 5
  9. Casadevall, A. 1998. Antibody-mediated protection against intracellular pathogens. Trends Microbiol. 6:102-107.[CrossRef][Medline]
  10. 6
  11. Casadevall, A., and L. A. Pirofski. 2003. Exploiting the redundancy in the immune system: vaccines can mediate protection by eliciting ‘unnatural’ immunity. J. Exp. Med. 197:1401-1404.[Free Full Text]
  12. 7
  13. Chen, J., M. Trounstine, F. W. Alt, F. Young, C. Kurahara, J. F. Loring, and D. Huszar. 1993. Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus. Int. Immunol. 5:647-656.[Abstract/Free Full Text]
  14. 8
  15. Cochrane, A. H., F. Santoro, V. Nussenzweig, R. W. Gwadz, and R. S. Nussenzweig. 1982. Monoclonal antibodies identify the protective antigens of sporozoites of Plasmodium knowlesi. Proc. Natl. Acad. Sci. USA 79:5651-5655.[Abstract/Free Full Text]
  16. 9
  17. Connolly, S. E., and J. L. Benach. 2001. Cutting edge: the spirochetemia of murine relapsing fever is cleared by complement-independent bactericidal antibodies. J. Immunol. 167:3029-3032.[Abstract/Free Full Text]
  18. 10
  19. Cooper, N. R., and G. R. Nemerow. 1985. Complement effector mechanisms in health and disease. J. Investig. Dermatol. 85:39s-46s.[CrossRef][Medline]
  20. 11
  21. Edelson, B. T., P. Cossart, and E. R. Unanue. 1999. Paradigm revisited: antibody provides resistance to Listeria infection. J. Immunol. 163:4087-4090.[Abstract/Free Full Text]
  22. 12
  23. Edelson, B. T., and E. R. Unanue. 2001. Intracellular antibody neutralizes listeria growth. Immunity 14:503-512.[CrossRef][Medline]
  24. 13
  25. Feng, H. M., and D. H. Walker. 2004. Mechanisms of immunity to Ehrlichia muris: a model of monocytotropic ehrlichiosis. Infect. Immun. 72:966-971.[Abstract/Free Full Text]
  26. 14
  27. Feng, H. M., T. Whitworth, J. P. Olano, V. L. Popov, and D. H. Walker. 2004. Fc-dependent polyclonal antibodies and antibodies to outer membrane proteins A and B, but not to lipopolysaccharide, protect SCID mice against fatal Rickettsia conorii infection. Infect. Immun. 72:2222-2228.[Abstract/Free Full Text]
  28. 15
  29. Finnie, J., R. Stewart, and W. Aston. 1981. A comparison of cobra venom factor-induced depletion of serum C3 in eight different strains of mice. Dev. Comp. Immunol. 5:697-701.[Medline]
  30. 16
  31. Gavin, A. L., N. Barnes, H. M. Dijstelbloem, and P. M. Hogarth. 1998. Identification of the mouse IgG3 receptor: implications for antibody effector function at the interface between innate and adaptive immunity. J. Immunol. 160:20-23.[Abstract/Free Full Text]
  32. 17
  33. Glatman-Freedman, A., A. J. Mednick, N. Lendvai, and A. Casadevall. 2000. Clearance and organ distribution of Mycobacterium tuberculosis lipoarabinomannan (LAM) in the presence and absence of LAM-binding immunoglobulin M. Infect. Immun. 68:335-341.[Abstract/Free Full Text]
  34. 18
  35. Heyman, B. 2000. Regulation of antibody responses via antibodies, complement, and Fc receptors. Annu. Rev. Immunol. 18:709-737.[CrossRef][Medline]
  36. 19
  37. Ioan-Facsinay, A., S. J. de Kimpe, S. M. Hellwig, P. L. van Lent, F. M. Hofhuis, H. H. van Ojik, C. Sedlik, S. A. da Silveira, J. Gerber, Y. F. de Jong, R. Roozendaal, L. A. Aarden, W. B. van den Berg, T. Saito, D. Mosser, S. Amigorena, S. Izui, G.-J. B. van Ommen, M. van Vugt, J. G. van de Winkel, and J. S. Verbeek. 2002. FcgRI (CD64) contributes substantially to severity of arthritis, hypersensitivity responses, and protection from bacterial infection. Immunity 16:391-402.[CrossRef][Medline]
  38. 20
  39. Ismail, N., L. Soong, J. W. McBride, G. Valbuena, J. P. Olano, H. M. Feng, and D. H. Walker. 2004. Overproduction of TNF-alpha by CD8+ type 1 cells and down-regulation of IFN-gamma production by CD4+ Th1 cells contribute to toxic shock-like syndrome in an animal model of fatal monocytotropic ehrlichiosis. J. Immunol. 172:1786-1800.[Abstract/Free Full Text]
  40. 21
  41. Johnson, C. M., A. M. Cooper, A. A. Frank, C. B. Bonorino, L. J. Wysoki, and I. M. Orme. 1997. Mycobacterium tuberculosis aerogenic rechallenge infections in B cell-deficient mice. Tuber. Lung Dis. 78:257-261.[CrossRef][Medline]
  42. 22
  43. Jones, O. T. 1994. The regulation of superoxide production by the NADPH oxidase of neutrophils and other mammalian cells. Bioessays 16:919-923.[CrossRef][Medline]
  44. 23
  45. Kagi, D., P. Seiler, J. Pavlovic, B. Ledermann, K. Burki, R. M. Zinkernagel, and H. Hengartner. 1995. The roles of perforin- and Fas-dependent cytotoxicity in protection against cytopathic and noncytopathic viruses. Eur. J. Immunol. 25:3256-3262.[Medline]
  46. 24
  47. Kitamura, D., J. Roes, R. Kühn, and K. Rajewsky. 1991. A B cell-deficient mouse by generated targeted disruption of the membrane exon of the immunoglobulin µ chain gene. Nature 350:423-426.[CrossRef][Medline]
  48. 25
  49. Li, J. S., F. Chu, A. Reilly, and G. M. Winslow. 2002. Antibodies highly effective in SCID mice during infection by the intracellular bacterium Ehrlichia chaffeensis are of picomolar affinity and exhibit preferential epitope and isotype utilization. J. Immunol. 169:1419-1425.[Abstract/Free Full Text]
  50. 26
  51. Li, J. S., and G. Winslow. 2003. Survival, replication, and antibody susceptibility of Ehrlichia chaffeensis outside of host cells. Infect. Immun. 71:4229-4237.[Abstract/Free Full Text]
  52. 27
  53. Li, J. S., E. Yager, M. Reilly, C. Freeman, G. R. Reddy, F. K. Chu, and G. Winslow. 2001. Outer membrane protein specific monoclonal antibodies protect SCID mice from fatal infection by the obligate intracellular bacterial pathogen Ehrlichia chaffeensis. J. Immunol. 166:1855-1862.[Abstract/Free Full Text]
  54. 28
  55. Lund, F. E., K. Schuer, M. Hollifield, T. D. Randall, and B. A. Garvy. 2003. Clearance of Pneumocystis carinii in mice is dependent on B cells but not on P. carinii-specific antibody. J. Immunol. 171:1423-1430.[Abstract/Free Full Text]
  56. 29
  57. McBride, J. W., X. Yu, and D. H. Walker. 1999. Molecular cloning of the gene for a conserved major immunoreactive 28-kilodalton protein of Ehrlichia canis: a potential serodiagnostic antigen. Clin. Diagn. Lab. Immunol. 6:392-399.[Abstract/Free Full Text]
  58. 30
  59. McSorley, S. J., and M. K. Jenkins. 2000. Antibody is required for protection against virulent but not attenuated Salmonella enterica serovar Typhimurium. Infect. Immun. 68:3344-3348.[Abstract/Free Full Text]
  60. 31
  61. Mittrücker, H.-W., B. Raupach, A. Köhler, and S. H. E. Kaufmann. 2000. Role of B lymphocytes in protective immunity against Salmonella typhimurium infection. J. Immunol. 164:1648-1652.[Abstract/Free Full Text]
  62. 32
  63. Morgan, B. P., K. J. Marchbank, M. P. Longhi, C. L. Harris, and A. M. Gallimore. 2005. Complement: central to innate immunity and bridging to adaptive responses. Immunol. Lett. 97:171-179.[CrossRef][Medline]
  64. 33
  65. Mukherjee, S., S. C. Lee, and A. Casadevall. 1995. Antibodies to Cryptococcus neoformans glucuronoxylomannan enhance antifungal activity of murine macrophages. Infect. Immun. 63:573-579.[Abstract]
  66. 34
  67. Murray, H. W., and Z. A. Cohn. 1979. Macrophage oxygen-dependent antimicrobial activity. I. Susceptibility of Toxoplasma gondii to oxygen intermediates. J. Exp. Med. 150:938-949.[Abstract/Free Full Text]
  68. 35
  69. Nimmerjahn, F., P. Bruhns, K. Horiuchi, and J. V. Ravetch. 2005. Fc{gamma}RIV: a novel FcR with distinct IgG subclass specificity. Immunity 23:41-51.[CrossRef][Medline]
  70. 36
  71. Ohashi, N., Y. Rikihisa, and A. Unver. 2001. Analysis of transcriptionally active gene clusters of major outer membrane protein multigene family in Ehrlichia canis and E. chaffeensis. Infect. Immun. 69:2083-2091.[Abstract/Free Full Text]
  72. 37
  73. Ravetch, J. V., and S. Bolland. 2001. IgG Fc receptors. Annu. Rev. Immunol. 19:275-290.[CrossRef][Medline]
  74. 38
  75. Rivera, J., O. Zaragoza, and A. Casadevall. 2005. Antibody-mediated protection against Cryptococcus neoformans pulmonary infection is dependent on B cells. Infect. Immun. 73:1141-1150.[Abstract/Free Full Text]
  76. 39
  77. Shibata, S., M. Kawahara, Y. Rikihisa, H. Fujita, Y. Watanabe, C. Suto, and T. Ito. 2000. New Ehrlichia species closely related to Ehrlichia chaffeensis isolated from Ixodes ovatus ticks in Japan. J. Clin. Microbiol. 38:1331-1338.[Abstract/Free Full Text]
  78. 40
  79. Singu, V., H. Liu, C. Cheng, and R. R. Ganta. 2005. Ehrlichia chaffeensis expresses macrophage- and tick cell-specific 28-kilodalton outer membrane proteins. Infect. Immun. 73:79-87.[Abstract/Free Full Text]
  80. 41
  81. Sotomayor, E. A., V. L. Popov, H. M. Feng, D. H. Walker, and J. P. Olano. 2001. Animal model of fatal human monocytotropic ehrlichiosis. Am. J. Pathol. 158:757-769.[Abstract/Free Full Text]
  82. 42
  83. Sun, W., J. W. IJdo, S. R. Telford III, E. Hodzic, Y. Zhang, S. W. Barthold, and E. Fikrig. 1997. Immunization against the agent of human granulocytic ehrlichiosis in a murine model. J. Clin. Investig. 100:3014-3018.[Medline]
  84. 43
  85. Thomsen, A. R., A. Nansen, C. Andersen, J. Johansen, O. Marker, and J. P. Christensen. 1997. Cooperation of B cells and T cells is required for survival of mice infected with vesicular stomatitis virus. Int. Immunol. 9:1757-1766.[Abstract/Free Full Text]
  86. 44
  87. Underhill, D. M., and A. Ozinsky. 2002. Phagocytosis of microbes: complexity in action. Annu. Rev. Immunol. 20:825-852.[CrossRef][Medline]
  88. 45
  89. Unkeless, J. C., and H. N. Eisen. 1975. Binding of monomeric immunoglobulins to Fc receptors of mouse macrophages. J. Exp. Med. 142:1520-1533.[Abstract/Free Full Text]
  90. 46
  91. Vazquez-Torres, A., J. Jones-Carson, P. Mastroeni, H. Ischiropoulos, and F. C. Fang. 2000. Antimicrobial actions of the NADPH phagocyte oxidase and inducible nitric oxide synthase in experimental salmonellosis. I. Effects on microbial killing by activated peritoneal macrophages in vitro. J. Exp. Med. 192:227-236.[Abstract/Free Full Text]
  92. 47
  93. Reference deleted.
  94. 48
  95. Winslow, G. M., E. Yager, K. Shilo, E. Volk, and F. K. Chu. 2000. Antibody-mediated elimination of the obligate intracellular bacterial pathogen Ehrlichia chaffeensis during active infection. Infect. Immun. 68:2187-2195.[Abstract/Free Full Text]
  96. 49
  97. Yu, X., J. W. McBride, X. Zhang, and D. H. Walker. 2000. Characterization of the complete transcriptionally active Ehrlichia chaffeensis 28 kDa outer membrane protein multigene family. Gene 248:59-68.[CrossRef][Medline]


Infection and Immunity, December 2005, p. 8009-8016, Vol. 73, No. 12
0019-9567/05/$08.00+0     doi:10.1128/IAI.73.12.8009-8016.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Racine, R., Chatterjee, M., Winslow, G. M. (2008). CD11c Expression Identifies a Population of Extrafollicular Antigen-Specific Splenic Plasmablasts Responsible for CD4 T-Independent Antibody Responses during Intracellular Bacterial Infection. J. Immunol. 181: 1375-1385 [Abstract] [Full Text]  
  • Thirumalapura, N. R., Stevenson, H. L., Walker, D. H., Ismail, N. (2008). Protective Heterologous Immunity against Fatal Ehrlichiosis and Lack of Protection following Homologous Challenge. Infect. Immun. 76: 1920-1930 [Abstract] [Full Text]  
  • Rawool, D. B., Bitsaktsis, C., Li, Y., Gosselin, D. R., Lin, Y., Kurkure, N. V., Metzger, D. W., Gosselin, E. J. (2008). Utilization of Fc Receptors as a Mucosal Vaccine Strategy against an Intracellular Bacterium, Francisella tularensis. J. Immunol. 180: 5548-5557 [Abstract] [Full Text]  
  • Luo, T., Zhang, X., Wakeel, A., Popov, V. L., McBride, J. W. (2008). A Variable-Length PCR Target Protein of Ehrlichia chaffeensis Contains Major Species-Specific Antibody Epitopes in Acidic Serine-Rich Tandem Repeats. Infect. Immun. 76: 1572-1580 [Abstract] [Full Text]  
  • Nandi, B., Hogle, K., Vitko, N., Winslow, G. M. (2007). CD4 T-Cell Epitopes Associated with Protective Immunity Induced following Vaccination of Mice with an Ehrlichial Variable Outer Membrane Protein. Infect. Immun. 75: 5453-5459 [Abstract] [Full Text]  
  • Bitsaktsis, C., Nandi, B., Racine, R., MacNamara, K. C., Winslow, G. (2007). T-Cell-Independent Humoral Immunity Is Sufficient for Protection against Fatal Intracellular Ehrlichia Infection. Infect. Immun. 75: 4933-4941 [Abstract] [Full Text]  
  • Nethery, K. A., Doyle, C. K., Zhang, X., McBride, J. W. (2007). Ehrlichia canis gp200 Contains Dominant Species-Specific Antibody Epitopes in Terminal Acidic Domains. Infect. Immun. 75: 4900-4908 [Abstract] [Full Text]  
  • Bitsaktsis, C., Winslow, G. (2006). Fatal Recall Responses Mediated by CD8 T cells during Intracellular Bacterial Challenge Infection. J. Immunol. 177: 4644-4651 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yager, E.
Right arrow Articles by Winslow, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yager, E.
Right arrow Articles by Winslow, G.