Previous Article | Next Article ![]()
Infection and Immunity, February 2005, p. 1151-1160, Vol. 73, No. 2
0019-9567/05/$08.00+0 doi:10.1128/IAI.73.2.1151-1160.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
IRIS, Chiron Vaccines,1 Department of Molecular Biology, University of Siena, Siena, Italy2
Received 22 April 2004/ Returned for modification 8 June 2004/ Accepted 4 October 2004
|
|
|---|
|
|
|---|
50% of meningococcal-disease cases worldwide, is the only serogroup whose infection is not preventable by vaccination (5, 28, 29). The B polysaccharide is a polymer of
(2-8)-linked N-acetyl-neuraminic acid (or polisyalic acid), which is also present in glycoproteins of developing and adult neural tissues of mammals, which are tolerant to it. The poor immune response, together with a high risk of autoimmunity, has been a main obstacle to the development of a capsular-polysaccharide-based vaccine (8, 9, 14). For this reason, research has been focused on the identification of noncapsular antigens. The most successful research identified vaccines that are composed of outer membrane vesicles (OMVs) prepared by detergent extraction from the bacteria. OMVs derived from clinical isolates have been developed in Cuba (serosubtype P1.19, 15), Norway (serosubtype P1.7, 16), and the United States (serosubtype P1.7-2, 3). Although it has been shown to be efficacious in clinical trials (3, 4, 23, 31, 32), the main limitation of OMV is that PorA, the immunodominant antigen, shows sequence and antigenic variability, and consequently, the protection induced is mainly strain specific (4). In recent years, additional protein antigens have been proposed as possible vaccine candidates, and these vaccines are presently in different phases of development (16, 21, 36).
The genome sequence of a serogroup B strain (MC58) allowed the in silico analysis of the entire gene repertoire and the discovery of novel surface-exposed antigens able to induce antibodies with bactericidal activity (BCA) (7, 13, 19, 25, 27, 33). One of the antigens identified by the genomic approach was GNA 1870, a surface-exposed lipoprotein with a molecular mass of 26,964 Da. Sequencing of the gene in 71 strains representative of the genetic and geographic diversity of the N. meningitidis population showed that the protein can be divided into three main variants (19). Conservation within each variant ranges between 91.6 and 100%, while between the variants the conservation can be as low as 62.8%. The protein is expressed by all strains of N. meningitidis, and antibodies against a recombinant form of the protein elicit complement-mediated bactericidal activity against strains that carry the same variant and induce passive protection in the infant rat model. A vaccine containing the three variants of GNA 1870 may be able to protect against all N. meningitidis strains (19).
Recent studies have confirmed the importance of this protein in inducing bactericidal antibodies against N. meningitidis (10) and have shown that protection in the infant rat model using monoclonal antibodies (MAbs) against GNA 1870 can also be achieved in the absence of measurable bactericidal activity (37). To further characterize the immunological properties of GNA 1870, we generated polyclonal antisera and a monoclonal antibody with bactericidal activity against the protein or its domains and used them to map linear and conformational epitopes. We found that most of the functional epitopes are located in one region and that arginine 204 is a key residue for a protective epitope.
|
|
|---|
[F
80lacZ
M15
(lacZYA-argF) U169 deoR recA1 endA1 hsdR17(rk mk+) phoA supE44 thi-1 gyrA96 relA1 tonA] and BL21 Star (DE3) [F ompT hsdSB (rB mB) gal dcm rne131 (DE3)] (Invitrogen) were used as the cloning strain and expression host, respectively. N. meningitidis strains MC58, 961-5945, BZ83, F6124, BZ133, M1239, and NZ98/254 were previously described (7, 19). Strains M2934, M4030, and M2197 are clinical isolates from the United States, kindly provided by Tanja Popovic (Centers for Disease Control and Prevention, Atlanta, Ga.). Isogenic MC58, M2934, and BZ83 knockout mutants, in which the gna1870 gene was truncated and replaced with an erythromycin antibiotic cassette, were generated as previously described (19).
GNA 1870 cloning, expression, and purification in E. coli. gna1870 genes from N. meningitidis strains MC58, 961-5945, and M1239, coding for variants 1, 2, and 3, respectively, were expressed in E. coli as previously described (19).
Combinations of forward (for) and reverse (rev) oligonucleotides (Fig. 1), forA-revA, forB-revB, forC-revC, forA-revB, and forB-revC, were used for the amplification of gna1870 DNA sequences coding for domains A, B, C, AB, and BC, respectively. Forward primers included, as a tail, the CGCGGATCCCATATG sequence containing the NdeI restriction site, whereas reverse primers included the sequence CCCGCTCGAG, containing the XhoI restriction site (restriction sites are underlined).
![]() View larger version (51K): [in a new window] |
FIG. 1. DNA sequence of the gene coding for the mature form of GNA 1870 variant 1 (strain MC58). The sequences of the oligonucleotides used in this study are underlined.
|
In all cases, the PCR conditions were as follows: 94°C for 30 s, 52°C for 30 s, and 72°C for 1 min (5 cycles); 94°C for 30 s, 65°C for 30 s, and 72°C for 1 min (30 cycles).
PCRs were performed on
10 ng of MC58 (variant 1) or M1239 (variant 3) chromosomal DNA, using AmpliTaq DNA polymerase (Perkin-Elmer). Amplified DNA fragments corresponding to the A, B, C, AB, and BC domains were digested with NdeI and XhoI enzymes (BioLabs) and cloned into the pET-21b+ expression vector (Novagen) digested with NdeI and XhoI. Amplified fragments coding for the B3 and C domains were digested with NdeI-HindIII and HindIII-XhoI, respectively, and cloned into pET-21b+ digested with NdeI-XhoI to express the B3C domain as a C-terminal His tag fusion.
DNA sequencing was performed using an ABI 377 Automatic Sequencer, and sequence analysis was performed using Editview, GeneJockey, and MacBoxshade software.
Recombinant plasmids were transformed into E. coli BL21 Star (DE3), used as an expression host strain, and recombinant proteins were expressed as C-terminal His tag fusions.
Recombinant strains were grown at 37°C to an A600 of 0.6 to 0.8 in Luria broth medium containing 100 µg of ampicillin/ml. Expression of the recombinant proteins was induced with 1 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) (Sigma), and the culture was shaken for another 3 h at the same temperature. Following induction, cells were collected by centrifugation at 8,000 x g for 15 min at 4°C, and then the pellet was resuspended in 50 mM phosphate buffer, pH 8, containing 300 mM NaCl, 10 mM imidazole, and a complete EDTA-free protease inhibitor (Roche, Mannheim, Germany). All subsequent procedures were performed at 4°C. The cells were disrupted by sonication. Debris and membranes were separated by centrifugation at 16,000 x g for 30 min and then discarded; the supernatants were loaded on metal-chelating affinity chromatography columns. The columns were washed, and the recombinant proteins were purified in their soluble forms in a single-step elution using a 50 mM phosphate buffer, pH 8, containing 300 mM NaCl and 250 mM imidazole.
The lipopolysaccharide contents of the purified proteins were evaluated using the LAL assay (BioWhittaker kit, composed of control standard endotoxin from E. coli and the Limulus Amebocyte Lysate Kinetic-QCL Reagent with a sensitivity of 0.005 IU). The standard curve ranged from a concentration of 50 to 0.005 IU/ml, by using serial 10-fold dilutions. The amount of lipopolysaccharide was 3.41 IU/µg for GNA 1870 variant 1 and 1.28, 0.03, 2.27, 40.95, and 0.24 IU/µg for the A, B, C, AB, and BC domains, respectively.
Construction of GNA 1870 R204H mutant.
DNA encoding the recombinant GNA 1870 variant 1 (from strain MC58) was used as a template for the site-directed mutagenesis of the arginine in position 204 to a histidine residue. PCR mutagenesis was performed using the GeneTailor Site-Directed Mutagenesis system (Invitrogen) and the following oligonucleotides: forR204H (GATATCAAGCCGGATGGAAAACACCATGCCGTCATCAGC), which contains the CGC
CAC mutation (Arg-204 to His) (boldface), and revR204H (TTTTCCATCCGGCTTGATATCGGCGGCGGCCAGGTC).
After mutagenesis, 2 µl of the reaction mixture was transformed into E. coli strain DH5
-T1R and sequenced. DNA containing the mutation was transformed into E. coli strain BL21-Star (DE3); the recombinant GNA 1870 R204H mutant protein was expressed and purified as a C-terminal His tag fusion, as described above.
Mouse immunizations. To prepare antisera, 20 µg each of variant 1, variant 2, and variant 3 GNA 1870 recombinant proteins and 20 µg each of the A, B, C, AB, BC, and B3C domains were used to immunize 6-week-old CD1 female mice (Charles River). Four to six mice per group were used. The recombinant proteins were administered intraperitoneally, together with complete Freund's adjuvant for the first dose and incomplete Freund's adjuvant for the second (day 21) and third (day 35) booster doses. The same immunization schedule was performed using aluminum hydroxide (3 mg/ml) as the adjuvant. Blood samples for analysis were taken on day 49.
Preparation of MAbs. Four- to 6-week-old female CD1 mice were immunized with 20 µg of variant 1 GNA 1870 recombinant protein administered intraperitoneally together with complete Freund's adjuvant as described above (except for the third dose, which was administered without adjuvant). Three days later, the mice were sacrificed and their spleen cells were fused with myeloma cells (P3 x 63-Ag8.653) at a ratio of five spleen cells to one myeloma cell. After a 2-week incubation in hypoxanthine-aminopterin-thymidine selective medium, the hybridoma supernatants were screened for antibody binding activity by enzyme-linked immunosorbent assays (ELISAs) performed on microtiter plates as follows.
Variant 1 GNA 1870 (1 µg/ml in phosphate-buffered saline [PBS]) was used to coat 96-well plates (Greiner) at 100 µl per well. The coating with whole-cell bacteria was performed with 100 µl of bacterial cells in PBS containing 0.025% formaldehyde (optical density at 620 nm [OD620], 0.25 to 0.3) by overnight incubation at 4°C. The wells were washed three times with 300 µl of washing buffer (PBS containing 0.1% Tween 20) and then were saturated with 200 µl of saturation buffer (2.7% polyvinylpyrrolidone 10 in water). One hundred microliters of the hybridoma supernatants (undiluted) and a polyclonal anti-GNA 1870 mouse serum (positive control) were added to each well, and the plates were incubated for 2 h at 37°C. The plates were washed three times with washing buffer. One hundred microliters of horseradish peroxidase (HRP)-conjugated rabbit anti-mouse (Sigma) diluted 1/2,000 with dilution buffer (1% bovine serum albumin [BSA]-0.1% Tween 20 in PBS) was added to each well, and the plates were incubated for 1.5 h at 37°C. One hundred microliters of substrate buffer for HRP (25 ml of citrate buffer, pH 5, 10 mg of O-phenyldiamine, and 10 µl of H2O2, 30%) were added to each well, and the plates were incubated for 20 min; the reaction was stopped with 100 µl of sulfuric acid (12.5% [vol/vol]). ELISA titers were expressed as the reciprocal of the last dilution of sera or hybridoma supernatants, which gave an OD490 value of 0.4. The ELISA titers were considered positive when the dilution of serum with an OD490 of 0.4 was higher than 1/400. Hybridomas secreting GNA 1870-specific antibodies were cloned twice by limiting dilution and then expanded and frozen for subsequent use in tissue culture or for ascites fluid production in BALB/c mice. The subclasses of the MAb were determined using a mouse MAb isotyping kit (Amersham Pharmacia Biotech). Among the selected MAbs, one IgG2a anti-GNA 1870 MAb, designated MAb 502, was used in all the binding and functional studies described below. This MAb was purified from mouse ascites fluid by Hi-Trap affinity columns (Amersham Pharmacia Biotech), and after exhaustive dialysis in PBS buffer, the concentration of the purified MAb was determined using a modified Lowry method with BSA as a standard (DC Protein Assay; Bio-Rad, Munich, Germany). The specificity of MAb 502 binding was determined by Western blotting.
Peptide spot synthesis. Spot synthesis (11) of 12-mer peptides, overlapping by 10, was performed on amino-polyethyleneglycol-cellulose membranes by an automated spot synthesizer (MultiSynTech, Bochum, Germany) using 9-fluorenylmethoxycarbonyl chemistry and O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate-1,3-diisopropylethylamine activation. After the final synthesis cycle, the side chain protective groups were removed using a mixture of trifluoroacetic acid-triisobutylsilane-water-dichloromethane (50/3/2/45).
Peptide binding assay. Cellulose-bound peptides were soaked in ethanol to prevent hydrophobic interaction between the peptides. Nonspecific binding was blocked by incubating cellulose membranes overnight at 4°C with 10 ml of 2% casein in TBS (50 mM Tris-HCl, 137 mM NaCl, and 27 mM KCl, pH 7.0) containing 0.05% Tween 20. The membranes were incubated for 2 h at 37°C with the anti-GNA 1870 MAb 502 (6.08 µg/ml) or anti-GNA 1870 polyclonal antibodies at a 1/250 dilution, followed by 1/3,000 dilution of alkaline phosphatase-conjugated goat anti-mouse immunoglobulin G (IgG) (Bio-Rad). The membranes were developed with bromo-4-chloro-3-indolylphosphate (Sigma-Aldrich, Steinheim, Germany) and 3-(4,5dimethylthiazol-2-yl)-2,5diphenyl-tetrazolium bromide (Sigma-Aldrich) substrates in buffer (100 mM Tris, pH 8.9, 100 mM NaCl, 2 mM MgCl2). Quantitative evaluation of the signals was obtained using a Speedy II 2200 optical scanner (Umax Technologies, Fremont, Calif.). The analysis was repeated twice with identical results. The response of alkaline phosphatase-conjugated goat anti-mouse IgG on the same panel of peptides was considered background and subtracted from the value of each peptide. Membranes incubated with an unrelated antiserum (anti-NadA; 1/250 dilution) (7) were used as negative controls. The results were comparable to those obtained by incubation with the secondary conjugated antibody (data not shown).
Whole-cell extract preparation.
N. meningitidis wild-type strains and
gna1870 mutant strains were grown overnight on a chocolate agar plate at 37°C in 5% CO2. Colonies from each strain were collected and used to inoculate 7 ml of Mueller-Hinton broth containing 0.25% glucose to an initial OD620 of 0.05 to 0.06. The cultures were incubated for
2.5 h at 37°C with shaking until an OD620 of 0.5 was reached and then centrifuged for 10 min at 3,500 x g. The supernatant was discarded, and the pellet was resuspended in 500 µl of PBS. The bacteria were inactivated by heating them at 56°C for 30 min.
SDS, Western blot, and dot blot analyses.
Fifteen microliters each of total cell extract of N. meningitidis strains and of
gna1870 strains and 1 µg each of purified GNA 1870 variants 1, 2, and 3 and of the A, B, AB, C, BC, and B3C domains were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis. Samples were loaded onto SDS-PAGE (10% acrylamide [Invitrogen] and 12.5 and 15% acrylamide [Bio-Rad]) and transferred onto a nitrocellulose membrane (Bio-Rad) (34).
Western blot analyses were performed according to standard procedures (17), using anti-GNA 1870 polyclonal antibodies at a 1/3,000 dilution in PBS containing 3% (wt/vol) skim milk, 0.01% Triton, and MAb 502 at a 1/1,000 dilution (1.52 µg/ml) or anti-whole E. coli cell extract polyclonal antibodies at 1/5,000 dilution, followed by incubation with a 1/2,000 dilution of HRP-labeled anti-mouse IgG (Sigma). Scanning was performed using a LabScan (Pharmacia) and Imagemaster software (Pharmacia).
One microgram of recombinant GNA 1870 variant 1 purified protein; 1 µg of each of the purified recombinant A, B, AB, C, and BC domains; 1 µg of the B-C mixture; and 3 µl of whole-cell lysates of the MC58 strain and of the MC58
gna1870 knockout were spotted on a nitrocellulose membrane. Some of the samples were boiled for 10 min. The nitrocellulose filters were incubated with the MAb and then with the HRP-conjugated anti-mouse IgG as described for Western blot analysis.
Fluorescence-activated cell sorter (FACS) analysis. The abilities of polyclonal anti-GNA 1870, anti-domain variant 1 sera, and MAb 502 to bind to the surfaces of live meningococci were determined with a FACScan flow cytometer using polyclonal sera at 1/200 dilution and MAb 502 at 0.37 µg/ml. Antibody binding was detected using an anti-mouse (whole-molecule) fluorescein isothiocyanate-conjugated secondary antibody (Sigma). The positive control included SEAM 3, a MAb specific for the meningococcus B capsular polysaccharide, at 0.25 µg/ml (12).
The histograms were generated by acquisition of 10,000 events. The y axis was arbitrarily set to get the maximum value of 100.
Complement-mediated bactericidal activity. Serum BCA against N. meningitidis strains was evaluated as previously described (22), with pooled baby rabbit serum (CedarLane) used as a complement source. Briefly, N. meningitidis strains were grown overnight on chocolate agar plates at 37°C in 5% CO2. Colonies were inoculated in Mueller-Hinton broth containing 0.25% glucose to reach an OD620 of 0.05 to 0.08 and incubated at 37°C with shaking until the OD620 reached 0.23 to 0.24. The bacteria were diluted in Gey's balanced salt solution (Sigma) and 1% (wt/vol) BSA (assay buffer) at the working dilution of 104 CFU/ml. All mouse sera to be tested were heat inactivated for 30 min at 56°C. The total volume in each well was 50 µl, with 25 µl of serial twofold dilutions of test serum, 12.5 µl of bacteria at the working dilution, and 12.5 µl of baby rabbit complement. MAb 502 was tested starting from a concentration of 0.38 mg/ml. Positive serum samples and/or an anticapsular monoclonal antibody (12) was included in each assay. Controls included bacteria incubated with complement serum and immune sera incubated with bacteria and with complement inactivated by being heated at 56°C for 30 min. Immediately after the addition of the baby rabbit complement, 10 µl of the controls was plated on Mueller-Hinton agar plates using the tilt method (time zero). The plate was incubated for 1 h at 37°C; 7 µl of each sample was spotted on Mueller-Hinton agar plates, and 10 µl of the controls was plated on Mueller-Hinton agar plates using the tilt method (time 1). The agar plates were incubated for 18 h at 37°C, and the colonies corresponding to time zero and time 1 were counted.
Serum bactericidal titers were defined as the serum dilution resulting in 50% decrease in CFU per milliliter after a 60-min incubation of bacteria with the reaction mixture compared to the control CFU per milliliter at time zero. Typically, bacteria incubated with the negative control antibody in the presence of complement showed a 150 to 200% increase in CFU per milliliter during the 60-min incubation. The bactericidal titers reported in this study are related to pooled mouse sera.
|
|
|---|
The results of this analysis are shown in Fig. 2a. Anti-variant 1 polyclonal antiserum recognized a number of different peptides within the region spanning residues 8 to 164 and corresponding to peptides 1 to 73. No linear peptides were recognized on the carboxy-terminal region from residues 164 to 255 (corresponding to peptides 74 to 119).
![]() View larger version (51K): [in a new window] |
FIG. 2. (a) Epitope mapping of mouse polyclonal antisera generated by immunization with variant 1, variant 2, and variant 3 GNA 1870 (derived from strains MC58, 961-5945, and M1239, respectively) using overlapping dodecapeptides on variant 1 GNA 1870. (b) Amino acid sequence of GNA 1870 variant 1 (strain MC58) showing domains A (amino acids [aa] 8 to 101), B (aa 101 to 164), C (aa 164 to 255), AB (aa 8 to 164), and BC (aa 101 to 255).
|
These results suggest that the region composed of the first 93 residues contains linear epitopes that are common to the three GNA 1870 variants. The region 101 to 164 contains linear epitopes that are recognized only by anti-variant 1 antibodies; this result is consistent with the low degree of homology of this region among the three variants. The absence of positive peptides in the 164-to-255 region suggests either that this region is embedded in the three-dimensional structure and not exposed to the immune system or that it contains conformational epitopes that are not present in linear peptides. For convenience, we divided GNA 1870 into three domains, A, B, and C, corresponding to amino acids 8 to 101, 101 to 164, and 164 to 255, respectively. The amino acid sequences of GNA 1870 variant 1 (strain MC58) and of the related A, B, C, AB, and BC domains are shown in Fig. 2b.
Immunological properties of GNA 1870 domains. The regions of DNA coding for the A, B, and C domains were amplified from strain MC58, cloned into the pET21 vector, and expressed in E. coli as histidine fusion proteins. In addition, the AB and BC domains, from residues 8 to 164 and from residues 101 to 255, respectively, were also cloned, expressed in E. coli, and purified (Fig. 3a). A Western blot analysis using anti-whole E. coli cell lysate showed the absence of E. coli contaminants in the purified protein preparations (data not shown). The purified fusion proteins, which were recognized by antibodies against variant 1 in Western blotting (Fig. 3b), were used to immunize mice. Antisera were analyzed in Western blotting and FACS analysis and for bactericidal activity.
![]() View larger version (51K): [in a new window] |
FIG. 3. (a) SDS gel (10% acrylamide; Invitrogen) of purified recombinant A, B, C, AB, and BC domains and of GNA 1870 variant 1 protein (MC58). (b) Western blot analysis of purified recombinant A, B, C, AB, and BC domains and of GNA 1870 variant 1 protein (MC58) using anti-variant 1 polyclonal antisera. The high-molecular-mass band is not recognized by anti-E. coli antibodies (data not shown), suggesting that it likely represents a high-molecular-mass aggregate of GNA 1870. (c) FACS analysis of antisera against A, B, C, AB, and BC domains and GNA 1870 of MC58 and the related MC58 gna1870 knockout strain. The shaded and unshaded profiles are related to preimmune and immune sera, respectively.
|
gna1870 knockout strain. A bactericidal assay was performed on immune sera derived by immunization with the different domains in combination with Freund's or aluminium hydroxide as adjuvants (Table 1). The bactericidal activity of the anti-BC antisera was comparable to that induced by anti-GNA 1870 antibodies, suggesting that the BC portion contains most of the functional epitopes. In contrast, no bactericidal activity was detected with anti-B or anti-AB antibodies. Finally, the antibodies against the A and C domains were bactericidal only when immunization was performed in the presence of alum as an adjuvant. To investigate whether the high bactericidal activity induced by the BC domain derives from the contribution of the B domain to the correct folding of the C domain or from the presence of discontinuous epitopes within the two domains, we constructed a hybrid BC domain, named B3C, by fusion of the B domain of variant 3 (M1239) and the C domain of variant 1 (MC58). The B domains of variants 1 and 3 show 43.8% identity. This hybrid domain was purified and used to immunize mice. Antibodies against the hybrid B3C domain were evaluated for bactericidal activity against MC58 and M1239. As shown in Table 2, the bactericidal titers induced by the anti-B3C antibodies against strain MC58 were lower than those induced by the BC domain and comparable to that induced by the C domain alone and were completely negative against M1239. Although we cannot exclude the possibility that the folding of the C domain induced by the B3 domain is not correct, the data support the hypothesis that the bactericidal antibodies could be directed against epitopes composed of sequences located on both domains.
|
View this table: [in a new window] |
TABLE 1. Bactericidal activities of mouse polyclonal antibodies
|
|
View this table: [in a new window] |
TABLE 2. Bactericidal activities of mouse polyclonal antibodies against strains MC58 and M1239, representative of variants 1 and 3, respectively
|
To verify whether MAb 502 recognizes an epitope present only on variant 1, we performed a Western blot analysis of the three purified variants. As shown in Fig. 4a, MAb 502 recognized variant 1 but not variants 2 and 3, whereas the anti-variant 1 polyclonal antiserum used as a control recognized all three variants.
![]() View larger version (22K): [in a new window] |
FIG. 4. Western blot analyses. (a) Recombinant GNA 1870 variants 1, 2, and 3 using MAb 502 or the polyclonal anti-variant 1 antisera (SDS-12.5% PAGE; Bio-Rad). The high-molecular-mass bands are not recognized by anti-E.coli antibodies (data not shown), suggesting that they likely represent high-molecular-mass aggregates of GNA 1870. (b) Total cell lysates of N. meningitidis strains probed with MAb 502 or with the polyclonal anti-variant 1. Lanes 1, strain MC58 (variant 1); lanes 2, MC58 gna1870; lanes 3, strain M2934 (variant 1); lanes 4, M2934 gna18790; lanes 5, strain BZ83 (variant 1); lanes 6, BZ83 gna1870; lanes 7, strain 961-5945 (variant 2); lanes 8, strain M1239 (variant 3); lanes M, molecular mass marker (SDS-15% PAGE; Bio-Rad). (c) Recombinant GNA 1870 and domains A, B, C, AB, and BC probed with MAb 502 (SDS-12.5% PAGE; Bio-Rad).
|
gna1870, M2934
gna1870, and BZ83
gna1870 knockout strains (Fig. 4b, lanes 2, 4, and 6). As expected, variants 1, 2, and 3 were all recognized by the anti-variant GNA 1870 polyclonal antiserum (Fig. 4b, lanes 1, 3, 5, 7, and 8). To further map the region of variant 1 containing the epitope recognized by MAb 502, a Western blot analysis was performed on the A, B, C, AB, and BC domains. The results, reported in Fig. 4c, show that only the BC domain is recognized by the monoclonal antibody, suggesting that MAb 502 recognizes an epitope located in the region 101 to 255 that might be conformational.
To investigate the temperature sensitivity of the MAb 502 epitope, recombinant GNA 1870 and MC58 whole-cell lysate were boiled for 10 min and blotted on a nitrocellulose membrane, which was then incubated with the monoclonal antibody. As shown in Fig. 5a, recognition of the native samples was much stronger than that of the boiled samples. The sensitivity to denaturing conditions, such as temperature, suggests that the epitope is conformational. As expected, no signals were detected in the case of MC58
gna1870 whole-cell lysate, used as a negative control. Finally, in order to determine whether the epitope could be reconstituted by the mixture of the two separate B and C domains, the two recombinant domains were incubated for 1 h at room temperature and subsequently spotted onto a nitrocellulose membrane. As shown in Fig. 5b, the MAb was not able to recognize the A, B, and C domains but did recognize the B-C mixture. This result suggests that the epitope can be reconstituted in vitro and confirms that the residues forming the epitope are located on the two domains.
![]() View larger version (38K): [in a new window] |
FIG. 5. Dot blots using MAb 502. (a) 1 µg of recombinant GNA 1870 (native or boiled); 3 µl of MC58 whole-cell lysate (native or boiled); 3 µl of MC58 gna1870 whole-cell lysate (native or boiled). (b) 1 µg each of A, B, C, and BC domains and of B-plus-C mixture.
|
|
View this table: [in a new window] |
TABLE 3. Bactericidal activities and Western blot and FACS reactivities of MAb502 and anti-GNA 1870 polyclonal antibodies against strains carrying identical (MC58, M2934, and BZ83) or different (M2197, M4030, F6124, BZ133, and NZ98/254) variant 1 GNA 1870 sequences
|
![]() View larger version (69K): [in a new window] |
FIG. 7. Sequence alignment, secondary-structure prediction, and hydrophilic profile of the BC domain of GNA 1870 antigen (residues 101 to 255). GNA 1870 sequences from MC58 and five subvariant 1 strains (F6124, BZ133, M4030, M2197, and NZ98/254) are aligned using ClustalW. The asterisks mark residues unique to MC58, namely, Phe109, Ile114, Asn178, and Gly202. The arrowhead indicates Arg204, essential for MAb 502 binding. Secondary-structure prediction was carried out on the full-length MC58 sequence using the PHD algorithm (30) available at the PredictProtein web server (http://cubic.bioc.columbia.edu/predictprotein/). Alpha helices and beta strands predicted with reliability scores higher than 4 are represented in orange and green, respectively. The hydrophilic profile was calculated using the Hopp and Woods parameters (15; http://www.expasy.org) using a sliding window of nine residues.
|
![]() View larger version (18K): [in a new window] |
FIG. 6. Dose-dependent binding of MAb 502 to strains MC58, BZ83, and M2934.
|
|
View this table: [in a new window] |
TABLE 4. Bactericidal activities of MAb502 and anti-GNA 1870 polyclonal antibodies against strains carrying the same variant 1 GNA 1870 sequence
|
A secondary-structure prediction for the GNA 1870 sequence performed with the PHD algorithm (30) and the hydrophilic profile calculated using the Hopp and Woods parameters (15) suggest that the protein adopts an alpha-beta fold. Arginine 204, isoleucine 114, asparagine 178, and glycine 202 are localized within loops corresponding to positive peaks on the hydrophilic plot (Fig. 7). Computer analysis indicates, therefore, that these residues are likely to be exposed on the protein surface.
|
|
|---|
Having established that the BC fragment is almost as good as the whole GNA 1870 at inducing high bactericidal titers and that the monoclonal antibody (MAb 502) identified in this study recognizes an epitope located on the BC domain, we decided to use it to map the bactericidal epitope. Consistent with the above-mentioned data, we found that the epitope was not present in any of the linear peptides spanning the entire length of the molecule or in the separate A, B, and C recombinant fragments. The epitope was, however, present in the BC recombinant fragment and was also detected in a sample containing a mixture of the B and C fragments. Furthermore, the recognition by dot blotting of the purified protein and of the protein expressed by MC58 was stronger for the native sample than for the boiled sample, suggesting that the epitope is sensitive to denaturation.
These data indicate that the bactericidal epitope is conformational and that it is generated only when the B and C fragments are present together either as a BC recombinant fragment or as a mix of B and C fragments. The recognition of the epitope in Western blotting under denaturing conditions is probably due to the strong tendency of the protein to refold in the Western blotting membrane. Generation of epitopes by mixing fragments containing part of the epitope is rare, but it has been described previously in the case of a neutralizing antibody against pertussis toxin (2). In that case, the epitope described was a stable immunodominant conformational epitope that was important for a vaccine. In our case, it is encouraging to find an epitope with similar properties in a vaccine candidate against meningococci.
Finally, we decided to use Western blotting, FACS analysis, and BCA in order to finely map the bactericidal epitope using a collection of strains expressing GNA 1870 variant 1 with few amino acid changes, as well as strains expressing variant 2 and 3 proteins. We found that MAb 502 did not recognize all variant 1 strains by FACS analysis and Western blotting but only a subgroup that have an arginine in position 204. Variant 1 strains with a histidine in position 204, as well as a mutant obtained by site-directed mutagenesis in which arginine 204 had been replaced by a histidine, were not recognized. Interestingly, in the BCA assay, the antibody killed only the ET5 strains, which have identical amino acid sequences. The observation that non-ET5 strains positive in Western blotting and FACS analysis were not killed is intriguing, and while we can speculate that few amino acid changes present in these proteins may be responsible for the changed functional activity of the antibody, full understanding of this phenomenon requires further analysis.
The data indicate that the epitope recognized by a bactericidal antibody against GNA 1870 is likely to be composed of amino acids present in fragments B and C, which are distant in the primary amino acid sequence and which are closer in the three-dimensional structure. Secondary-structure predictions suggest that the four residues unique to the strains carrying identical MC58 variant 1 sequencesarginine 204, isoleucine 114, asparagine 178, and glycine 202are localized within loops likely to be exposed on the surface (Fig. 7). Site-directed mutagenesis of these residues may help to better define in future the role of each of these amino acids in the formation of the epitope.
While this study elucidates the nature of one bactericidal epitope of GNA 1870 and provides a framework to understand how bactericidal activity against this protein may be generated, it is clear that the antibody response elicited by the whole GNA 1870 recombinant protein is more powerful because it has higher bactericidal titers and is less sensitive to sequence variability. In fact, while MAb 502 was sensitive to a few amino acid changes, the whole protein was able to induce antibodies able to kill all variant 1 strains, although they had sequence identities ranging from 91.6 to 97.1% (19). It is therefore likely that the polyclonal response to GNA 1870 is against a number of slightly different epitopes, which on average are less sensitive than MAb 502 to amino acid changes. The polyclonal nature of the protective immune response is of fundamental importance in the development of a vaccine, since it decreases the risk of generating escape mutants and facilitates the immune response of a genetically different population.
The epitopes inducing bactericidal activity in GNA 1870 are also different in nature from those described for other meningococcal proteins (6, 18, 20). In fact, the crystal structures of OpcA (26) and NspA (35), two outer membrane proteins of meningococci inducing bactericidal antibodies, showed that they are composed of transmembrane beta barrels containing surface-exposed loops, often with variable sequences, where the bactericidal epitopes are located. In the case of GNA 1870, secondary-structure prediction analysis shows that it is a lipoprotein with a predicted globular architecture consisting of similar proportions of alpha helices and beta strands, a structure very different from those of OpcA and NspA. The different structures of the protein and of the protective epitopes indicate that GNA 1870 represents not only a previously unknown protective antigen but also a novel antigenic structure, which hopefully may overcome some of the limitations of the previously known antigens.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»